ID: 1082866024

View in Genome Browser
Species Human (GRCh38)
Location 11:57900851-57900873
Sequence TGGTGCTAGGAGAAGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082866016_1082866024 -8 Left 1082866016 11:57900836-57900858 CCTTTGGAAGCCCCTTGGTGCTA No data
Right 1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG No data
1082866012_1082866024 15 Left 1082866012 11:57900813-57900835 CCATTGTGTAGTTAAGGTCTTGG No data
Right 1082866024 11:57900851-57900873 TGGTGCTAGGAGAAGTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082866024 Original CRISPR TGGTGCTAGGAGAAGTGTGG GGG Intergenic
No off target data available for this crispr