ID: 1082869692

View in Genome Browser
Species Human (GRCh38)
Location 11:57932572-57932594
Sequence CAATCACTTTCTGCGAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082869692_1082869694 29 Left 1082869692 11:57932572-57932594 CCAGGTCTCGCAGAAAGTGATTG No data
Right 1082869694 11:57932624-57932646 TTGTGTGTATTTGAACACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082869692 Original CRISPR CAATCACTTTCTGCGAGACC TGG (reversed) Intergenic
No off target data available for this crispr