ID: 1082871168

View in Genome Browser
Species Human (GRCh38)
Location 11:57944618-57944640
Sequence CATCAGAGGGAGACCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082871156_1082871168 26 Left 1082871156 11:57944569-57944591 CCGAGATGGCGGCAGTACAGTCC 0: 150
1: 893
2: 395
3: 401
4: 10880
Right 1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG No data
1082871158_1082871168 5 Left 1082871158 11:57944590-57944612 CCAGCCTCGGCTTTCACAACTTT 0: 16
1: 6
2: 2
3: 23
4: 266
Right 1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG No data
1082871160_1082871168 1 Left 1082871160 11:57944594-57944616 CCTCGGCTTTCACAACTTTGGTG 0: 16
1: 7
2: 2
3: 9
4: 103
Right 1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082871168 Original CRISPR CATCAGAGGGAGACCGGGGA GGG Intergenic
No off target data available for this crispr