ID: 1082872225 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:57953829-57953851 |
| Sequence | GAGGTTGAGCAGAAGCAGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082872225_1082872233 | 23 | Left | 1082872225 | 11:57953829-57953851 | CCACCCTGCTTCTGCTCAACCTC | No data | ||
| Right | 1082872233 | 11:57953875-57953897 | CCAGTCCCAATGAGATAAGCTGG | 0: 8 1: 134 2: 369 3: 444 4: 463 |
||||
| 1082872225_1082872234 | 24 | Left | 1082872225 | 11:57953829-57953851 | CCACCCTGCTTCTGCTCAACCTC | No data | ||
| Right | 1082872234 | 11:57953876-57953898 | CAGTCCCAATGAGATAAGCTGGG | 0: 10 1: 101 2: 416 3: 945 4: 1036 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082872225 | Original CRISPR | GAGGTTGAGCAGAAGCAGGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||