ID: 1082872225

View in Genome Browser
Species Human (GRCh38)
Location 11:57953829-57953851
Sequence GAGGTTGAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082872225_1082872233 23 Left 1082872225 11:57953829-57953851 CCACCCTGCTTCTGCTCAACCTC No data
Right 1082872233 11:57953875-57953897 CCAGTCCCAATGAGATAAGCTGG 0: 8
1: 134
2: 369
3: 444
4: 463
1082872225_1082872234 24 Left 1082872225 11:57953829-57953851 CCACCCTGCTTCTGCTCAACCTC No data
Right 1082872234 11:57953876-57953898 CAGTCCCAATGAGATAAGCTGGG 0: 10
1: 101
2: 416
3: 945
4: 1036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082872225 Original CRISPR GAGGTTGAGCAGAAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr