ID: 1082881594

View in Genome Browser
Species Human (GRCh38)
Location 11:58043387-58043409
Sequence ATGAATAGACAAATAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 1, 2: 17, 3: 133, 4: 942}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082881594 Original CRISPR ATGAATAGACAAATAGACAA AGG (reversed) Intronic
900857004 1:5194324-5194346 ATGAACAAACAAATAGATAAAGG + Intergenic
900898486 1:5500932-5500954 ATGCATAGCTAAATAGATAATGG - Intergenic
900930857 1:5736461-5736483 ATGGATAGATAGATAGACAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901786939 1:11630833-11630855 ATGAATAGATGAATAAATAAAGG + Intergenic
902125916 1:14211201-14211223 ATAAATAAACAAATAGAGATAGG - Intergenic
902459485 1:16562577-16562599 ATGAATATAATAATAGACACAGG + Exonic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
902825134 1:18967944-18967966 AAAAATAGACAAATGGACCAAGG + Intergenic
902914342 1:19627412-19627434 ATAAATGGATAAATAGACACAGG + Exonic
903152680 1:21423256-21423278 ATGAATATAATAATAGACACAGG + Intergenic
903160449 1:21484729-21484751 ATGAATATAATAATAGACACAGG - Exonic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905155068 1:35970724-35970746 ATAAATAAATAAATAAACAAAGG - Intronic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905592694 1:39178428-39178450 ATGATAGGACAAAAAGACAAAGG - Intronic
906189633 1:43888489-43888511 ATAAATAAACAAACAAACAAGGG + Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
906550011 1:46657034-46657056 ATGCAGAGTCAAATAGACATGGG + Intronic
906842115 1:49150438-49150460 ATGCATAGAAAAAAAGACAAAGG + Intronic
906857070 1:49319477-49319499 ATGGGTAGAAAAATAGAAAAAGG - Intronic
907591889 1:55682023-55682045 AGTAATAGACAAACAGCCAATGG - Intergenic
907640354 1:56182935-56182957 ATAAACAGAAAAATAGCCAAAGG + Intergenic
907885121 1:58585718-58585740 AAGAATACACAAATAGTAAATGG + Intergenic
908168946 1:61485818-61485840 ATGGATTAAAAAATAGACAATGG + Intergenic
908464767 1:64382600-64382622 GTGACAAGAAAAATAGACAAGGG + Intergenic
909125162 1:71658663-71658685 ACTAATAGACAATTAGAAAAGGG + Intronic
910270372 1:85387629-85387651 CTCAAAAGACAAAAAGACAAGGG - Intronic
910329286 1:86051344-86051366 GTGATATGACAAATAGACAATGG + Intronic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910546812 1:88427337-88427359 ATCAATATTCAAGTAGACAAAGG + Intergenic
910552513 1:88492134-88492156 CTGATTAGAGAAATAGACGAAGG + Intergenic
910617997 1:89220970-89220992 ATGTAGAGACAAAGAAACAATGG + Intergenic
910645769 1:89513567-89513589 AAAAATGGACAAATGGACAAAGG - Intergenic
910993882 1:93083442-93083464 ATGACTAGACAAACAAAAAAAGG - Intronic
911455846 1:98122626-98122648 ATGAATAGATAAACAAACATGGG + Intergenic
911692972 1:100856288-100856310 AAAAATAGACACATAGACCAAGG - Intergenic
911890793 1:103369104-103369126 ATGAAAAGACAAATAAAACATGG - Intergenic
912112515 1:106360508-106360530 ACTAATAGACACATAGACACTGG + Intergenic
912327983 1:108786632-108786654 AAGGATAGACAAATTGACCATGG - Intronic
912407276 1:109451004-109451026 ATGAATGGACAAATAAACTGTGG + Intergenic
912574216 1:110650140-110650162 AAGAATAAATGAATAGACAAAGG + Intergenic
912857648 1:113185250-113185272 AAAAAGAGACACATAGACAATGG + Intergenic
913014043 1:114715015-114715037 ATAAATAGATAAATAAATAAAGG - Intronic
913606102 1:120467562-120467584 ATGAATATAATAATAGACACAGG - Intergenic
913644289 1:120841934-120841956 ATGAATATAATAATAGACACAGG - Intergenic
913714831 1:121523161-121523183 ATGAATAAATAAATAAATAAAGG - Intergenic
914082454 1:144421650-144421672 ATGAATATAATAATAGACACAGG + Exonic
914177353 1:145290160-145290182 ATGAATATAATAATAGACACAGG + Exonic
914210327 1:145572604-145572626 ATGAATATAATAATAGACACAGG + Intergenic
914234701 1:145798511-145798533 AACAACAGACATATAGACAATGG - Intronic
914269251 1:146064955-146064977 ATGAATATAATAATAGACACAGG + Exonic
914314202 1:146494329-146494351 ATGAATATAATAATAGACACAGG + Intergenic
914485133 1:148102306-148102328 ATGAATATAATAATAGACACAGG + Exonic
914500145 1:148239052-148239074 ATGAATATAATAATAGACACAGG - Intergenic
914532084 1:148531642-148531664 ATGAATATAATAATAGACACAGG + Exonic
914585097 1:149054293-149054315 ATGAATATAATAATAGACACAGG + Exonic
914636314 1:149556079-149556101 ATGAATATAATAATAGACACAGG - Intergenic
914768579 1:150662372-150662394 ATAAATAAATAAATAAACAAAGG + Intronic
915012390 1:152699452-152699474 AAGAATAGAAGAATTGACAATGG - Intergenic
915464562 1:156089275-156089297 ATAAATAAATAAATAAACAAGGG - Intronic
915747489 1:158175568-158175590 ATGATTTGAAATATAGACAATGG + Intergenic
916062832 1:161112936-161112958 ATATATACACAAAAAGACAAAGG + Intronic
916325414 1:163553249-163553271 ATGAAAGGAGAAATAAACAAAGG - Intergenic
916402725 1:164466567-164466589 CTGAATAGGCAAATAAACAGTGG - Intergenic
917008536 1:170444449-170444471 GTAAAGAGACAAATAAACAATGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917753672 1:178077820-178077842 ATGTGTAGACTGATAGACAAGGG + Intergenic
917810546 1:178653912-178653934 GTGAAAAGACAAGAAGACAAAGG - Intergenic
917942917 1:179941144-179941166 ATGTATATACAAATAGACTATGG + Intergenic
918231221 1:182534426-182534448 ACCAATAGAAAAATAGACAAAGG - Intronic
918329158 1:183440380-183440402 ATGAATAAACAAATAAATTAGGG + Intergenic
918554851 1:185786436-185786458 ATGAAAATACATATAGGCAAAGG + Intronic
918580573 1:186122455-186122477 ATGAATACATAAATAGATCATGG - Intronic
918637240 1:186792431-186792453 ATGAATGAACAAATATATAATGG + Intergenic
918645381 1:186897986-186898008 ATGATGAGAAAAATAGACACTGG - Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918658844 1:187064266-187064288 ATGAACAGAAAGATAGATAAAGG + Intergenic
918888468 1:190229858-190229880 ATGAACATATAAAAAGACAAGGG + Intronic
919002261 1:191847731-191847753 ATGAACAGACACATAGAGCAAGG + Intergenic
919345734 1:196375554-196375576 ATGAATAAACAAGAAGACAGTGG - Intronic
919711028 1:200728607-200728629 ATGAATGGAAAGATATACAAAGG + Intergenic
920220651 1:204397508-204397530 ATAAATAAATAAATAGAAAAAGG + Intergenic
920273080 1:204781689-204781711 AAGATTATACAAATAGTCAATGG + Intergenic
920354738 1:205362955-205362977 ATGAATAGATAAATAAAACATGG - Intergenic
920394616 1:205635226-205635248 ATGGATAGACTAAAAGAAAAAGG + Intergenic
920418742 1:205815665-205815687 AGGAATAGAATAATAGAAAATGG - Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920612173 1:207452397-207452419 ATGAATAAATAAATAGAGAAGGG + Intergenic
920728460 1:208460297-208460319 AACAACAAACAAATAGACAATGG - Intergenic
920755528 1:208727468-208727490 AGGAAGAGACCAAAAGACAAAGG - Intergenic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
922333895 1:224603159-224603181 ATGCAAAGACAAATACATAATGG - Intronic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922892987 1:229075876-229075898 ATGAATAAATAAGTAGACCAAGG - Intergenic
922912864 1:229232174-229232196 ATGCCTAGGCAAATAGAGAAGGG - Intergenic
923236966 1:232043365-232043387 GTGAATAAATAAATAAACAATGG - Intergenic
923717721 1:236439227-236439249 GTGAATAGATAAATAGACTGTGG - Intronic
923916299 1:238509878-238509900 ATGAATAGATAGATAGATGATGG - Intergenic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924370506 1:243344068-243344090 TTGAATAGTCTAATAGAAAATGG + Intronic
924379113 1:243445446-243445468 ATGAAAAGGAAAATATACAATGG + Intronic
924595135 1:245438664-245438686 ATGAATAGACAAAAAAAACATGG + Intronic
924891683 1:248289170-248289192 AGTAATAGAAATATAGACAAAGG + Intergenic
1062840055 10:663231-663253 ATGAATAGAAAGATCTACAAGGG + Intronic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1063625939 10:7690081-7690103 AAGAGGAGACAAAAAGACAAAGG - Intergenic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1065270145 10:24021745-24021767 AAGAATAGATAAATAGACAGTGG + Intronic
1065510004 10:26469206-26469228 ATAAATAGATAAATAGAATAAGG - Intronic
1065582685 10:27187355-27187377 AGGAATAAACAAAAAGACTAAGG + Intergenic
1065677415 10:28192910-28192932 AAGTATAAACAAATAGATAATGG + Intronic
1065818551 10:29504958-29504980 ATTAATAGACAAATAAACTGTGG + Intronic
1066384458 10:34930378-34930400 ATGAATAGAATAATAGACATTGG - Intergenic
1066580693 10:36877827-36877849 AGAAACAGACAAATAGACATGGG - Intergenic
1066618043 10:37315849-37315871 ATGAATAGAAAAACAGAGAAAGG - Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067072804 10:43148241-43148263 AGAAATAGACATATAGTCAATGG - Intronic
1068277584 10:54822509-54822531 ATGAATAGATAAATAAATTATGG - Intronic
1068590670 10:58849601-58849623 AAGAATAGAGAAATAAATAATGG + Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068679266 10:59801681-59801703 ATGACTAAATAAATAAACAAGGG - Intronic
1068852998 10:61765986-61766008 ACGAATAGAAAAATTGAAAAAGG + Exonic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070228146 10:74533429-74533451 AATGATAGACAAATAGTCAATGG + Intronic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070374628 10:75817626-75817648 ATGTAAAGACACAAAGACAATGG + Intronic
1070429377 10:76321498-76321520 ATCAATAGAAAAATAGACAAAGG - Intronic
1070873861 10:79783198-79783220 ATCAACAGATAAATGGACAAAGG - Intergenic
1071096226 10:81978572-81978594 ATGTATAGAGAAATATACTATGG - Intronic
1071159745 10:82731648-82731670 ATGAATAGATAAATAAAATATGG - Intronic
1071214348 10:83382010-83382032 AAGAATAGACAAATATATAAAGG + Intergenic
1071238073 10:83672695-83672717 AGGAATGGAGAAATAGATAAAGG + Intergenic
1071348460 10:84715703-84715725 ATGAATAGACAACATGTCAAAGG - Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071640794 10:87305337-87305359 ATCAACAGATAAATGGACAAAGG - Intergenic
1071654442 10:87432599-87432621 ATCAACAGATAAATGGACAAAGG + Intergenic
1071714185 10:88078370-88078392 ATAAATAAACAAATATGCAAAGG - Intergenic
1071952461 10:90720297-90720319 AGGAAAAGACAAATTGCCAAGGG + Intergenic
1072186183 10:93041377-93041399 ATAAATAAACAAACAAACAAGGG - Intronic
1072232962 10:93428621-93428643 ATGAACAGAAAAATGGAAAAAGG - Intronic
1072521939 10:96236865-96236887 ATGAGTAGACATACAGACAAAGG - Intronic
1072627820 10:97124896-97124918 TGGAATAGAGAAATAGGCAAAGG + Intronic
1072813733 10:98484538-98484560 ATCAACAGAAAAATAGGCAAAGG - Intronic
1073086475 10:100893525-100893547 AATAATAGAAAAATAGGCAAAGG + Intergenic
1073811783 10:107160327-107160349 ATGAATTGCCAAATAGACACAGG - Intronic
1074141060 10:110672872-110672894 ATGTATAGACAAAAAAGCAAAGG - Intronic
1074370936 10:112900344-112900366 ATGAGTAGCAAAATACACAAGGG - Intergenic
1074629654 10:115238085-115238107 AAGAATAGACAAATAAATCAAGG - Intronic
1074690300 10:115998275-115998297 TTTAATTGACAAATAGAGAAGGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075040181 10:119101869-119101891 ATGAACAGATAATTAAACAAAGG - Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075200316 10:120396951-120396973 ATGCATAGACATGTAGGCAAAGG + Intergenic
1075947366 10:126447312-126447334 ATAAATAGACAAAAAGTGAAGGG + Intronic
1076044983 10:127285165-127285187 ATGAATAGTAAAACAGAGAAGGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076920407 10:133450226-133450248 ATGAATAGATAACTATATAAAGG + Intergenic
1077905416 11:6529153-6529175 GTGAATAGACATACAGAAAAGGG - Intronic
1078093317 11:8281208-8281230 ATGAAGAGACAAGTAGAGATGGG + Intergenic
1078524962 11:12093279-12093301 ACAAATAGACAAACAGACATTGG + Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078922966 11:15847869-15847891 ATGATTAGATAAATAGGCAAAGG - Intergenic
1078960617 11:16264029-16264051 ATGATTACACACAGAGACAAAGG - Intronic
1079578758 11:22035619-22035641 ATGAATAAAGGAAGAGACAAAGG - Intergenic
1079658407 11:23010589-23010611 ATCAATAGATACATAGAAAAGGG - Intergenic
1079702237 11:23562963-23562985 ATTAACAGATAAATAGATAAAGG - Intergenic
1079892216 11:26070144-26070166 TTGAAGAGACACATAGACTAAGG - Intergenic
1079906587 11:26255725-26255747 ATGTATAAACAAATAAATAATGG - Intergenic
1080097563 11:28427282-28427304 AAGAATAGACACATAGACCAAGG - Intergenic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1080285923 11:30611449-30611471 AAGGACAGACAAATAGATAATGG - Intergenic
1080375552 11:31705701-31705723 ATTAATAGACATATTGATAATGG - Intronic
1080435031 11:32232128-32232150 ATGAATTGACAAATACCCCAAGG - Intergenic
1080680390 11:34470268-34470290 AGGAATAGACAAATGGAAGAGGG + Intronic
1080913157 11:36626081-36626103 ATCAATCAACAAATAAACAAAGG - Intronic
1081006570 11:37751612-37751634 ATAAACAGACAAATGGATAAAGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081116442 11:39207461-39207483 ATAAAGAGAGAAAGAGACAAGGG - Intergenic
1081344803 11:41971469-41971491 ATGAATAGTCAAGTAGAGAGAGG - Intergenic
1081624343 11:44639594-44639616 GTGAAAAGACAAATATAGAATGG + Intergenic
1081668817 11:44932092-44932114 ATGGATAGAGACATAGACAAGGG - Exonic
1082731872 11:56807910-56807932 ATTAATAGAAAAAAAGATAAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1082898668 11:58221339-58221361 ATAAATAAATAAATACACAAGGG - Intergenic
1083093762 11:60227741-60227763 AGAAATAGACAAATAGATCAAGG + Intronic
1083100107 11:60294790-60294812 AGAAATAGACAAATAGATAATGG - Intronic
1085370218 11:75996358-75996380 ATGAATAAATGAATTGACAAAGG - Intronic
1085879808 11:80453099-80453121 ATAAATAAACAAATAAATAATGG - Intergenic
1086099180 11:83081508-83081530 ATAAATAAATAAATAGAAAATGG - Intergenic
1086184326 11:83995617-83995639 AAAAACAGACACATAGACAAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086719613 11:90104346-90104368 ATGAATAAACAAGCAAACAAAGG + Intergenic
1086762898 11:90655620-90655642 ATGTATACACACATAGACATAGG + Intergenic
1086909608 11:92457301-92457323 ATGAATAGGCAGAGATACAATGG + Intronic
1087381019 11:97405009-97405031 ATGAATGGAAAATTAGACATAGG - Intergenic
1087438633 11:98154762-98154784 ATGAATGGATAAATAGAAAGTGG - Intergenic
1087582754 11:100079583-100079605 GCAAATAGACAAATAGACATGGG + Intronic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087848253 11:102997970-102997992 ATAAATTGAAAAAGAGACAAGGG - Intergenic
1088129741 11:106472952-106472974 ATGAATAAACCAACAAACAAAGG + Intergenic
1088393845 11:109345636-109345658 AGGAATAGAAAAATTAACAAAGG - Intergenic
1088464934 11:110125039-110125061 AACAATTGAGAAATAGACAAAGG + Intronic
1088515614 11:110630024-110630046 AAGATTAGAGAAGTAGACAAGGG - Intronic
1088829738 11:113525143-113525165 ACGAATAAAGGAATAGACAATGG + Intergenic
1089237340 11:117041957-117041979 ATGAATGGAAGAATAGAGAATGG - Intronic
1090544007 11:127741626-127741648 GTGAATAGATAAACAGACTATGG - Intergenic
1091166744 11:133483546-133483568 ATAGATAGATAACTAGACAAAGG + Intronic
1091204124 11:133807832-133807854 TTGAAAAGCCAAATAGACCAGGG - Intergenic
1091492213 12:942914-942936 ATGAATAGGCAACCAGACAGAGG + Intronic
1091535924 12:1409424-1409446 AGGAAGAGACAAACAGAGAAAGG + Intronic
1092631970 12:10390506-10390528 ATAGATAGACAAATTGAGAAGGG + Intronic
1093072465 12:14721266-14721288 ATGTATACACACATACACAATGG - Intergenic
1093250865 12:16803491-16803513 ATGAAAAGCCAAATAGAAAATGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093799596 12:23357190-23357212 ATTAATAGACTGAGAGACAAGGG - Intergenic
1094234939 12:28152949-28152971 ATAAAAACAAAAATAGACAATGG - Intronic
1094448209 12:30555947-30555969 AAGAAAAGAAAAATAGACATTGG + Intergenic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1094754071 12:33445863-33445885 GTGAATGGAGAAATAGATAAAGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095122454 12:38435774-38435796 ATACATAGACAGATAGACATAGG - Intergenic
1095396797 12:41771067-41771089 TCAAATAGACAAATAGACAGTGG + Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096419683 12:51446428-51446450 AAGGAGAGACAAATAGAGAAAGG + Intronic
1096564249 12:52463606-52463628 AAGAATAGACAAATAGATCAAGG + Intergenic
1097012394 12:55962482-55962504 ATAAATAAACAAATAAATAAGGG - Intronic
1097390765 12:59010076-59010098 ATCAATAGACAAACAGCAAAAGG - Intergenic
1097513442 12:60571951-60571973 AAGAATGGACAAACAGAAAAAGG + Intergenic
1097715626 12:62962890-62962912 ATAAAAAGACAAAAGGACAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098523490 12:71460259-71460281 ATGAAGAGAGAAATACAAAAAGG + Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1098753798 12:74331332-74331354 ATGAAAGCAAAAATAGACAAGGG + Intergenic
1098999439 12:77160843-77160865 ATGAGTTGAAAAATTGACAAAGG - Intergenic
1099059936 12:77895211-77895233 ATGAATAGAGTAATCAACAAAGG + Intronic
1099135672 12:78896804-78896826 ATGAATACAAAAAGAGAAAAAGG + Intronic
1099564710 12:84228899-84228921 ATAAATATCCAAATACACAAAGG - Intergenic
1099572540 12:84342240-84342262 TTGAATAGGTAAATAGATAAGGG - Intergenic
1099872440 12:88366816-88366838 GTGACTAGAGAAAGAGACAATGG - Intergenic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1102693119 12:114777143-114777165 ATAAATAAATAAATAGGCAAAGG + Intergenic
1103199320 12:119073798-119073820 TTTAATAGATAAATAGACATAGG + Intronic
1103438936 12:120948704-120948726 GTGAATGGACAAATAGAATATGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104160725 12:126177971-126177993 AGTAATAGAGAAATAGATAATGG - Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1105425823 13:20294207-20294229 ATGAATAGATAAATAATTAAGGG + Intergenic
1105455526 13:20537782-20537804 ATGAATTGACAAATATACATGGG - Intergenic
1106030916 13:26001806-26001828 ATGAAAAGACAACTACAAAATGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106238282 13:27884697-27884719 ATGAACAAAAACATAGACAAAGG + Intergenic
1106354737 13:28970206-28970228 AAACATTGACAAATAGACAATGG - Intronic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107060331 13:36153664-36153686 AGGAATAGAGAAATAGATGATGG + Intergenic
1107387208 13:39924978-39925000 AAGAATATACAAATATACAAGGG - Intergenic
1107452524 13:40523174-40523196 ATAAATAGATAAATAGATGATGG + Intergenic
1107672662 13:42761916-42761938 ATGAATAGAAAAATGAATAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108552740 13:51562855-51562877 ATGAATGGATAAATAAACTATGG + Intergenic
1108753238 13:53470372-53470394 ATAGATAGATCAATAGACAAAGG - Intergenic
1108869794 13:54969783-54969805 GTGAATAGATAAATAAACTATGG + Intergenic
1109053932 13:57521640-57521662 ATTAAAACACAAAAAGACAATGG + Intergenic
1109224630 13:59677845-59677867 GTGAATGGCAAAATAGACAAAGG + Intronic
1109224660 13:59678195-59678217 ATGAATAGAACAATAAAAAAAGG - Intronic
1109514290 13:63421410-63421432 ATGACTAAAAAAAGAGACAAGGG + Intergenic
1109684242 13:65792604-65792626 GTGAAAAGACAACTACACAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110063466 13:71070180-71070202 AAGAATAGACACATAGACCAAGG - Intergenic
1110084045 13:71354926-71354948 AATAATAGACTAATAGACATGGG + Intergenic
1110457063 13:75700995-75701017 ATGAATGAACAAATAGAACATGG - Intronic
1110605244 13:77424861-77424883 ATCAATGGACAAATAGATATAGG - Intergenic
1110607301 13:77447883-77447905 ATGGATAGCCAAATAGAAATAGG + Intergenic
1110928597 13:81187158-81187180 ATAAATAAATAAATAAACAAAGG - Intergenic
1111272606 13:85906329-85906351 ATGAACAGACACAAAGAAAAGGG - Intergenic
1111325207 13:86685299-86685321 TTGAATAAACAAATAAATAAAGG + Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112794746 13:103044496-103044518 ATCATTAGACAAATACAAAATGG - Exonic
1113275531 13:108725278-108725300 ATGAACAGAAAAATTGATAATGG - Intronic
1113315620 13:109176467-109176489 ATGAATAAAAAAAAAGAAAACGG - Intronic
1113405742 13:110038041-110038063 ATGAATAGAGAAAGAAACAGTGG - Intergenic
1114879753 14:26769511-26769533 AAAAACAGACACATAGACAATGG + Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115167369 14:30464102-30464124 GTGGATAGAAAAATAGAAAAGGG - Intergenic
1115189227 14:30729060-30729082 AAAAATGGACAAATGGACAAAGG - Intronic
1115317256 14:32037805-32037827 AGAAATAGACACAGAGACAAGGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116620746 14:47200496-47200518 AAGAAAAGAAAAATAGAAAAAGG - Intronic
1117648410 14:57877182-57877204 AAGAAGAGAACAATAGACAATGG - Intronic
1117654916 14:57945231-57945253 ATGCATCCACAAACAGACAATGG + Intronic
1117768604 14:59108612-59108634 ATGAAGAGAGAAATATTCAAGGG + Intergenic
1117861848 14:60100193-60100215 TTCAATAGAAAAATAGGCAAAGG + Intronic
1117902996 14:60554677-60554699 ATGAATAGACAAATAAAACATGG + Intergenic
1117994261 14:61463943-61463965 ATGAATGGACAAAGAAACAACGG - Intronic
1118086405 14:62423042-62423064 AAGAAAAGAAAAACAGACAAAGG + Intergenic
1118527970 14:66667446-66667468 AAGAATAGACACATAACCAAAGG + Intronic
1118690400 14:68333245-68333267 AAAAATAGAAAAATAGACGAGGG + Intronic
1119105696 14:71921486-71921508 ATGAATAAAGAAATATACAATGG + Intergenic
1119170733 14:72534580-72534602 ATGAATAGATAAATGGGTAAAGG - Intronic
1120138056 14:80893817-80893839 TTGGATAGACAAATAAACTAGGG + Intronic
1120361138 14:83503855-83503877 ATGATTAAATAAATAGACCAAGG - Intergenic
1120671936 14:87372624-87372646 ATGGATAGATAGATAGATAAAGG - Intergenic
1120795506 14:88628247-88628269 AAGCAGACACAAATAGACAAAGG + Intronic
1120833428 14:89018487-89018509 ATGAATAGATAAATAAAATATGG - Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1122333410 14:100945598-100945620 ATGAATGGATCAATAAACAAAGG + Intergenic
1122497359 14:102167889-102167911 ATGAATGGATAAATATACAAGGG + Intronic
1122727994 14:103772216-103772238 ATAAATGCACAAATAGACTATGG - Intronic
1122730833 14:103796291-103796313 ATAAATAAATAAATAGGCAAAGG + Intronic
1122850452 14:104525495-104525517 GTGAACAGACAAATACATAAAGG + Intronic
1123221434 14:106860490-106860512 ATGAATAAGCAAAAAGATAAGGG - Intergenic
1123803575 15:23848525-23848547 ATGAACAGACAAATAAAATATGG - Intergenic
1123828907 15:24113341-24113363 ATGTATAAACAAACAGAAAAGGG - Intergenic
1124020691 15:25920066-25920088 AAAAACAGACACATAGACAATGG - Intergenic
1124044235 15:26133616-26133638 GGGGATAGACAAATAGACGAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124711146 15:32013255-32013277 ATGAAGAGACAAGTGGATAAAGG - Intergenic
1124784444 15:32666460-32666482 ATGAACAGAGAAATAGCCAAAGG - Intronic
1124827193 15:33109292-33109314 ATTAATAGATAAATGGCCAAAGG + Intronic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125053139 15:35325367-35325389 AAAAATAGACAATTAGACCAAGG + Intronic
1126118433 15:45229772-45229794 ATAAATAAACAAATAGAGACAGG - Intergenic
1126168863 15:45677236-45677258 ATGGATAGATAGATAGACAAAGG - Intronic
1126553235 15:49955630-49955652 ATGAATAGACAAACAGATAAGGG + Intronic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1127042782 15:54995601-54995623 AAGAACAGACATATAGACCAAGG + Intergenic
1127242199 15:57128909-57128931 ATGAACAGATAAATAAAAAATGG - Intronic
1127285285 15:57527428-57527450 ATGAATAGAATAATACACCAGGG - Intronic
1127372436 15:58354003-58354025 ATGGAAAGACAAAAAGATAATGG + Intronic
1127626499 15:60785394-60785416 ATGAATAGGTAAACAGAGAAGGG + Intronic
1127687029 15:61356450-61356472 ATGAATAGACAAATAAAATGTGG + Intergenic
1128006300 15:64244928-64244950 ATAAACAGACAAAGAGACCAAGG + Intronic
1128659995 15:69492554-69492576 AAGAATAGGCAAATACACCATGG - Intergenic
1128880717 15:71240107-71240129 ATGAATACAAAAATATACATTGG + Intronic
1129052241 15:72791755-72791777 ATGAATAGATAAACAAATAATGG - Intergenic
1129146834 15:73656127-73656149 ATAAATAAATAAATAGGCAAAGG - Intergenic
1129588648 15:76894435-76894457 ATGAAAAGAAAAAAAGAGAAAGG + Intronic
1129864747 15:78897767-78897789 AGGAATACACAAATATACAATGG - Exonic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1129964624 15:79723177-79723199 ATGAATAGAAACATGGACACAGG + Intergenic
1129964640 15:79723335-79723357 ATAAATGGATAAATACACAAAGG + Intergenic
1130018493 15:80206433-80206455 ACCAATAGAAAAATAGATAAAGG - Intergenic
1130031664 15:80319914-80319936 ATGCATAGATACATAGACATAGG - Intergenic
1130382560 15:83383593-83383615 ACAAATGGAAAAATAGACAAAGG - Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1131026647 15:89148243-89148265 ATCAATAGAAAAATAGACAAAGG + Intronic
1131269853 15:90940510-90940532 ATGGATGGACAGACAGACAAAGG - Intronic
1131351409 15:91703864-91703886 ATGTATAGAAATATAGAGAAAGG - Intergenic
1131424277 15:92332940-92332962 CTCAATAGAAAAATAGTCAAAGG - Intergenic
1131571086 15:93536976-93536998 ATGATTAAACAAATAAATAAAGG - Intergenic
1131723202 15:95194402-95194424 ATGAATAGAAAAATATGCACAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1131974025 15:97923955-97923977 AATAATAGATAATTAGACAAAGG + Intergenic
1133083872 16:3346317-3346339 ATGAATAAATAAATAGGAAAAGG + Intergenic
1135055240 16:19226617-19226639 ATGGAGTTACAAATAGACAAGGG + Intronic
1135690722 16:24535382-24535404 ATAAATAAATAAATAGAAAAGGG - Intergenic
1136061297 16:27728425-27728447 ATAAATAAACAAATAAATAAAGG - Intronic
1137253382 16:46756551-46756573 ATAAATACACAAATCAACAAAGG - Intronic
1137507746 16:49069221-49069243 GTGAATAGAGATATAAACAAAGG - Intergenic
1137851263 16:51747152-51747174 AAAAATAAACAAACAGACAAAGG + Intergenic
1137963038 16:52904230-52904252 AAAAACAGACATATAGACAAAGG + Intergenic
1138225006 16:55285731-55285753 TTCAATAGAAAAATAGACATGGG + Intergenic
1138807729 16:60110657-60110679 ATGTTGAGACAAATAGTCAAGGG - Intergenic
1138907747 16:61358226-61358248 ATGAATGGATAAAGAGACTATGG + Intergenic
1139143403 16:64295751-64295773 AAAGATAGACAAATAGTCAATGG - Intergenic
1139184019 16:64782566-64782588 GTGAATAGATAAATAAACCATGG - Intergenic
1139232829 16:65302897-65302919 ATGAATAGATAAATAAACCAAGG + Intergenic
1139247254 16:65457151-65457173 ATGAATAGATGGATAGATAAAGG - Intergenic
1140401123 16:74672549-74672571 ATGAACAGAAAATTAGACCAGGG + Intronic
1140572179 16:76120352-76120374 CTGAATGGACAAATAGAATAAGG + Intergenic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1140963192 16:79937322-79937344 GTGCACAGACATATAGACAAAGG + Intergenic
1141021634 16:80502294-80502316 AAGAATGGACTAATACACAAGGG - Intergenic
1141129113 16:81422775-81422797 ATCAATCAACAAGTAGACAAGGG + Intergenic
1142423109 16:89985184-89985206 AAGAAAAGAAAAAGAGACAAAGG + Intergenic
1143725941 17:8846308-8846330 AAAAATAGACATATAAACAATGG - Intronic
1143742154 17:8962311-8962333 ATGAATGTACAAAAAGACACAGG + Intronic
1144162348 17:12572009-12572031 ATGAATAGATAAAGAGATTATGG - Intergenic
1144311309 17:14016568-14016590 ATGAAAAAAAAAATAGAAAAAGG - Intergenic
1144358957 17:14472854-14472876 ATCAATAGAAAAATAGCAAACGG - Intergenic
1145005925 17:19337751-19337773 ATGAAGGGAAAAATGGACAAGGG + Intronic
1145185797 17:20793028-20793050 ACAAATAGAAAAATGGACAAAGG - Intergenic
1145358539 17:22187710-22187732 ATCAATAGATGAATGGACAAAGG - Intergenic
1146271054 17:31486246-31486268 ATAAATAAACAAATAGAGACAGG + Intronic
1146714120 17:35069582-35069604 ATGAGTAGACAAATACCCAAAGG + Intronic
1146909261 17:36637831-36637853 ATGTATCGAGAAATAGACAGTGG - Intergenic
1146909262 17:36637863-36637885 ATGTATCGAGAAATAGACAGTGG - Intergenic
1148411326 17:47469825-47469847 ACAAATAGAAAAATGGACAAAGG + Intergenic
1149112617 17:53051075-53051097 AAAAATAGACACATAGACTAAGG + Intergenic
1149209141 17:54283969-54283991 ATTCATAAACACATAGACAAAGG + Intergenic
1149288460 17:55192163-55192185 GTGAATTGATAAAAAGACAAAGG + Intergenic
1149589128 17:57815316-57815338 AGGAATAGGCAATTAGACCAGGG - Intergenic
1150135851 17:62694595-62694617 AGGAGTTGAGAAATAGACAATGG + Intergenic
1150949147 17:69782829-69782851 ATGAAAACAAAAATAGACAATGG + Intergenic
1151212579 17:72555593-72555615 ATGAATAAATAAATAAACGAGGG + Intergenic
1151252900 17:72851271-72851293 ATGAATAAACAAATAGCCCAGGG - Intronic
1151998232 17:77626155-77626177 ATCAATAGATAAGTAGATAAGGG - Intergenic
1152158541 17:78651611-78651633 ACCAATAGAAAAATAGTCAAAGG + Intergenic
1152681141 17:81668687-81668709 ATAAATAAACAAACAAACAAAGG - Intronic
1153171556 18:2321918-2321940 ATGAACAGACAAACAGATAAAGG + Intergenic
1153206614 18:2710239-2710261 ATGAACAGACATATAGACCTAGG - Intronic
1153627363 18:7034413-7034435 ATGAATAAACAAACATAAAATGG + Intronic
1153748576 18:8206612-8206634 TTTAATAGAAAAATAGGCAAAGG + Intronic
1154113341 18:11589590-11589612 AAGAATAGCCAAATAAACCAGGG - Intergenic
1154131469 18:11740060-11740082 ATAAATACATAAATAGAAAAGGG - Intronic
1155286644 18:24295350-24295372 ATAAATAGACAACCAGAGAATGG - Intronic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155669651 18:28354130-28354152 ACAAATAGAAAAATAGTCAATGG + Intergenic
1156279047 18:35615239-35615261 AAGCATAGACAAATAGATAATGG + Intronic
1156701804 18:39834955-39834977 ATGAAGACACAAAGACACAATGG - Intergenic
1157001936 18:43537194-43537216 ATGTACAAACAAATTGACAAAGG - Intergenic
1157015255 18:43704406-43704428 TTGAATATACGAACAGACAATGG - Intergenic
1157034853 18:43959148-43959170 ATGAATAAATAAATAAATAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158610164 18:58932550-58932572 ATGAATAAACAAAAACACACAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159230271 18:65598059-65598081 ATAAATAAATAAATAAACAATGG + Intergenic
1159381049 18:67659590-67659612 ACTAATACACAAGTAGACAATGG + Intergenic
1159556547 18:69951731-69951753 ATACATAGACAAATAGACCAAGG + Intronic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161775257 19:6258259-6258281 ATGAATGGATAAACAGAAAATGG + Intronic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162132314 19:8534292-8534314 AAGAAAAGAAAAATAGCCAACGG - Intronic
1162856848 19:13475286-13475308 ATGAGTAGAAAAATAGACCTGGG - Intronic
1164062314 19:21686288-21686310 ATGAACAAATAAATAGCCAAAGG + Intergenic
1164465219 19:28482115-28482137 ATGCCTAGACAGATAGAGAAGGG + Intergenic
1165271964 19:34716720-34716742 AAAAATAGACACATAGTCAATGG + Intergenic
1165448683 19:35870174-35870196 ATGAAAAGACAAATTTATAACGG + Intronic
1166088179 19:40490629-40490651 GTATAGAGACAAATAGACAAAGG + Intronic
1166161898 19:40960411-40960433 AAGAAGAGAGAAAGAGACAAAGG - Intergenic
1166382004 19:42359676-42359698 AAAAATAGAAAAAGAGACAAAGG - Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167640744 19:50679988-50680010 ATGGAGAGACAGAGAGACAATGG + Intronic
1168499682 19:56883127-56883149 ATCAACAGATAAATGGACAATGG - Intergenic
1168611294 19:57802646-57802668 AAAAATTGACAAATATACAATGG - Intronic
1202675730 1_KI270711v1_random:4761-4783 ATGAATATAATAATAGACACAGG + Intergenic
925329104 2:3044611-3044633 AGGAATACACAAATAGCCACAGG + Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
925471482 2:4166148-4166170 ATAAATAAACAACTAAACAATGG - Intergenic
925591639 2:5515781-5515803 ATGATTAGACCAAAAGAGAAGGG + Intergenic
925848217 2:8052791-8052813 ATGTATATACAAATATACACAGG - Intergenic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
926399353 2:12480657-12480679 ATGAATAGATACATAGAAATGGG + Intergenic
926956536 2:18307296-18307318 ATGAATAGATAAATAAACTGTGG - Intronic
926977380 2:18528844-18528866 AGGAAGAGACAAATATCCAATGG - Intergenic
927061347 2:19425234-19425256 ATGAAAAGAGAAATGAACAAAGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
927747636 2:25635920-25635942 AAGGATAGACAAACAGACCAGGG + Intronic
927821574 2:26270633-26270655 ATGATTATACAATTAGACAGAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928985343 2:37175389-37175411 ATAAATAGAAATTTAGACAATGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930482798 2:51970512-51970534 GTGAATAGACAAATACATAATGG + Intergenic
930501135 2:52219589-52219611 AGGAATAGACAAATAGATCAAGG + Intergenic
931201577 2:60102685-60102707 ATGAAAAGAGAAAAAGAGAAAGG - Intergenic
931266314 2:60663426-60663448 CTGAATAGGCAAATAGATAGGGG - Intergenic
931401741 2:61937598-61937620 ATGAACAAACAAAAAGCCAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933289007 2:80415823-80415845 ATAAATAGATATATACACAATGG + Intronic
933704496 2:85279687-85279709 TTAAAAAGACAAATAGAAAAGGG + Intronic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934313018 2:91887118-91887140 ATGAAAATAAAAATAGAAAAAGG + Intergenic
934776265 2:96939517-96939539 ATGAACAAACAAAAAAACAAAGG + Intronic
934895103 2:98111131-98111153 ATGCAGAGAAAAATAGACACTGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935392052 2:102563068-102563090 ATAAATAAACAAATAGACTAAGG - Intergenic
935440050 2:103082446-103082468 ATGAACAAACAAACAAACAAAGG + Intergenic
935519301 2:104084405-104084427 AAGAATAAACAAGTAGACCAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936616429 2:114052428-114052450 AAAATTAGATAAATAGACAAAGG - Intergenic
936664957 2:114584377-114584399 ATAAATAAACAAATAAATAAAGG - Intronic
936732565 2:115401592-115401614 ATGAATAGATAAATAGACGCAGG + Intronic
936928324 2:117760846-117760868 ATGACTTGACCAATAGATAAAGG + Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937200417 2:120200437-120200459 ATGGATGGATAAATATACAATGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938123173 2:128647888-128647910 AAGATTAGAGAAATAGAGAATGG - Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938794973 2:134710411-134710433 ATGATTAAATAAATAGAAAATGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938979460 2:136512345-136512367 ATCAATGGACAAATAGACACTGG - Intergenic
939069287 2:137519262-137519284 ATAAATAAATAAATAGAAAAAGG + Intronic
939122646 2:138136709-138136731 ATGAAGAGACAAATAGATTAGGG - Intergenic
939365082 2:141220287-141220309 ATCAACAGCCAAATAGACCAAGG + Intronic
939675762 2:145070213-145070235 ATGAATAGAGAAAGAGGAAAGGG + Intergenic
940313113 2:152299759-152299781 AAGAACAGACAAATAGATCATGG - Intergenic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940587759 2:155675773-155675795 ATGAATACACATAAACACAAAGG + Intergenic
940716779 2:157235108-157235130 ATGAATGGAAAAAGAGAAAAAGG + Intergenic
941046323 2:160679542-160679564 ATAAAATGACAAATAGACACAGG - Intergenic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941425220 2:165335938-165335960 TTGAATAGACATATTGAAAAAGG + Intronic
941514381 2:166454628-166454650 ATAAAGAGATAAAAAGACAAGGG - Intronic
941832771 2:169980528-169980550 ATGAACGAACAAATAAACAAGGG - Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942707914 2:178798102-178798124 ATGAATAGAAAAATACACCAGGG - Intronic
942760695 2:179394171-179394193 AAGAGTAGAAAAATAGACACTGG + Intergenic
942821357 2:180119600-180119622 AGGAAGAGACAAATAGGAAAAGG - Intergenic
942846709 2:180435371-180435393 TTTACTAGAAAAATAGACAAAGG + Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943194682 2:184730750-184730772 GTGAATAGACAAATAAACCATGG - Intronic
943311536 2:186331553-186331575 ATGTAAAGACATATAGCCAAAGG - Intergenic
943892918 2:193313872-193313894 ATGGATAGAAAAATGGAAAAGGG - Intergenic
943904414 2:193479740-193479762 ATAAATAGAAAAGAAGACAAAGG + Intergenic
944014292 2:195015236-195015258 ATGAATAATCAAAAATACAATGG + Intergenic
944363808 2:198892668-198892690 ATCAATAGCAAAATAGACCAAGG + Intergenic
944722024 2:202433285-202433307 ATGTATAGATAGATACACAAGGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947108086 2:226688900-226688922 ATGAATAGACAATTTGCAAAAGG + Intergenic
948956693 2:241298389-241298411 ATAAATAGATAAATAAATAAAGG + Intronic
1168957573 20:1845231-1845253 ATGTATAAACACAAAGACAAGGG - Intergenic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1169657524 20:7941863-7941885 ATTAAGAGACAAATGGATAAGGG - Intergenic
1169937035 20:10894739-10894761 ATGAAGAAACAAAAAGACAGAGG - Intergenic
1170406498 20:16043432-16043454 ATCAGTATACAAATAGACAATGG - Intronic
1170493555 20:16902276-16902298 ATGAATGGACAAATAGCCTGTGG + Intergenic
1170675155 20:18471985-18472007 ATAAATACATAAATAAACAAGGG + Intronic
1170830715 20:19838483-19838505 ATGAATGGACAAACAGAATAGGG - Intergenic
1171005082 20:21456739-21456761 AAAAATAGACACATAGACCAAGG - Intergenic
1171111623 20:22489504-22489526 ATAAATAAACAAATAAATAAAGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1171983981 20:31646602-31646624 ATAAATAAATAAATAGGCAAAGG + Intergenic
1173099519 20:40072399-40072421 ATGAATGGACAAATAAAAAGTGG + Intergenic
1173129431 20:40375504-40375526 ATCAATAGAAAAATGGGCAAAGG - Intergenic
1173149520 20:40554121-40554143 ATCAATAGCCAAATAGACCAAGG + Intergenic
1173175410 20:40761202-40761224 GTGAATGGATAAATAGACTATGG - Intergenic
1173481672 20:43405614-43405636 AAGAATAGAAAAATAAAAAATGG + Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1175184184 20:57168790-57168812 ATAAATAGACAAAATGAAAAGGG - Exonic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176695045 21:9966422-9966444 AAAAATAGAGAAATATACAAGGG + Intergenic
1176978227 21:15349281-15349303 AAAAACAGACACATAGACAAAGG + Intergenic
1177105607 21:16951681-16951703 AAAAACAGACACATAGACAATGG + Intergenic
1177256256 21:18666607-18666629 CTTATTAGAAAAATAGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178042514 21:28655204-28655226 TAGAATAGACAAATAGAGGAGGG - Intergenic
1178421161 21:32444485-32444507 ATGAAGAGACACATAGGGAAAGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179474340 21:41633678-41633700 ATGGATGGACAAATGGATAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179679337 21:43007128-43007150 AAGCATAGACAAATAGTCCAAGG - Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182701447 22:32242787-32242809 AGTAATAGATAAATAGAGAAGGG + Intronic
1183106453 22:35618542-35618564 ATGGATAGACAAAGAGATGATGG - Intronic
1183613984 22:38930877-38930899 TGAAATAGACAAATAGATAATGG - Intergenic
1183801419 22:40168234-40168256 ATGAATGAACAAATAAGCAAAGG - Intronic
1183886589 22:40888588-40888610 ATGAATAGACAAATAAAATATGG - Intronic
1184703313 22:46192734-46192756 ATCACCAGACAAATAGATAAAGG + Intronic
1185293841 22:50043103-50043125 ATGGATAGACAGATAAACAGTGG + Intronic
1185293869 22:50043367-50043389 ATGGATAGATAAATAAACAGTGG + Intronic
1185293896 22:50043631-50043653 ATGGATAGATAAATAAACAGTGG + Intronic
949270429 3:2210092-2210114 TTGGATAGACAAATAGATACAGG - Intronic
949707637 3:6837250-6837272 ATGAAAACACAAATAAAAAAAGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950562629 3:13743730-13743752 ATGACTAGGCATATACACAAAGG - Intergenic
951102633 3:18707082-18707104 AAGAACAGACACATAGACCAAGG + Intergenic
951365463 3:21776574-21776596 ATCAATAGAAAAATAATCAAGGG - Intronic
951407084 3:22314497-22314519 ATGAATAGACAAATAAACTGTGG - Intronic
951637534 3:24796099-24796121 ATGATAAGACAAATGGAAAAAGG + Intergenic
952070075 3:29623807-29623829 ATCAATAGACTAATAGATAATGG + Intronic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
953048690 3:39320353-39320375 AGGAATAGACAAATAGGTCATGG - Intergenic
953097340 3:39791531-39791553 ATGAATAGACAAAGAGAAGAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953250316 3:41240176-41240198 TAAAATAGACAAATAGAAAATGG + Exonic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953514419 3:43576020-43576042 ATGAATAAATAAAGAGTCAATGG + Intronic
954528277 3:51293592-51293614 ATGAAAATAAAAATAGAAAATGG + Intronic
954723762 3:52589472-52589494 ATGAATATATAACTACACAAAGG + Intronic
954724368 3:52595188-52595210 ATGAAAAAAAAAATAGCCAAAGG - Intronic
955078131 3:55632988-55633010 ATAAATAGACAGGTGGACAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956063139 3:65369068-65369090 ATGAATGAATAAATACACAATGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956748364 3:72327366-72327388 ATGAATAGGCGAATAGATGAAGG - Intergenic
956958303 3:74367646-74367668 AGGAAAAAAAAAATAGACAAGGG + Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957617525 3:82550331-82550353 CTGTATTGACAAATAGCCAATGG - Intergenic
957866477 3:86030769-86030791 ATGAATTGATAAATAAAGAAAGG + Intronic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958180225 3:90050379-90050401 ATGAAAAGAAAAATAAACATTGG - Intergenic
958713910 3:97754691-97754713 ATGAATAAATAAATAAATAAAGG - Intergenic
959114068 3:102155437-102155459 ATGAACAGAAAAATAGATAAAGG + Intronic
959473756 3:106784868-106784890 ATGAAAACCCAAATAGACAGGGG + Intergenic
959590055 3:108069426-108069448 ATGAATAGAAAAAGACAGAAAGG + Intronic
959689988 3:109188556-109188578 AAGAATAGAAAAAAACACAATGG + Intergenic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960745288 3:120881190-120881212 AAAAACAGACACATAGACAATGG + Intergenic
961096958 3:124165736-124165758 ATGAATATAAATATATACAATGG - Intronic
961948982 3:130726796-130726818 ATGAATTGACCAATAGATAGGGG + Intronic
962418539 3:135206231-135206253 GTGAATGGACAAATAAACCATGG - Intronic
962438414 3:135388634-135388656 AGGAATAGACAAATAACAAATGG - Intergenic
962604403 3:137021230-137021252 TTCAATAGACAGAGAGACAAAGG - Intergenic
962635679 3:137329174-137329196 ATGAAGAGAACAATAAACAAAGG + Intergenic
963345655 3:144094206-144094228 ATAAATAAATAAATAGAGAATGG - Intergenic
963449870 3:145464930-145464952 AAGAATAGACACATAGACCATGG + Intergenic
963550232 3:146711305-146711327 ATGAATAGATTAATTGACACTGG + Intergenic
963606473 3:147415831-147415853 ATGAAAAGACAAGTCAACAAAGG - Exonic
963727502 3:148938466-148938488 ATAAATATACAAATATACACTGG + Intergenic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965027498 3:163320904-163320926 AAAAATAGACATATAGAAAACGG - Intergenic
965386513 3:168052761-168052783 ATAAATAGAAAAATAGAGATAGG - Intronic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
965711998 3:171564800-171564822 GTGATGAGACAAACAGACAAAGG - Intergenic
965808572 3:172568281-172568303 AAGAACAGACACATAGACCAAGG - Intergenic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966244150 3:177787359-177787381 ATGAAAAGACAAAAAGATCAAGG - Intergenic
967802500 3:193678778-193678800 ATGAATACACAAGCACACAAAGG - Intronic
967831303 3:193922341-193922363 GTAAATAGACAAATAAAAAAGGG - Intergenic
969133259 4:5008249-5008271 AGGAATACACAAATACACAAAGG + Intergenic
969255286 4:5997128-5997150 AGGACTAGATAAATAGAAAAAGG + Intergenic
969277416 4:6146037-6146059 ATGAATAGACAAATAAACTGTGG + Intronic
969571570 4:8012025-8012047 ATGAATGGACAGATAGTTAAAGG - Intronic
969708490 4:8829301-8829323 ATGAAGAGACAGAAAGACAAAGG + Intergenic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
970100108 4:12511784-12511806 GTGAATGGATAAATAGACTATGG - Intergenic
970495695 4:16623059-16623081 AGGAATAAATAAAAAGACAAGGG - Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971042954 4:22775566-22775588 ATGAATCCAGAAAAAGACAACGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971554068 4:27989474-27989496 ATGAAAAGACAACTACACACAGG - Intergenic
971769640 4:30879756-30879778 TTGATTAGATAAATAGAAAATGG + Intronic
971964415 4:33534168-33534190 ATTGATAAACAAATAGAGAAAGG + Intergenic
972094027 4:35325841-35325863 ATGTATAAACAGATAGACTATGG + Intergenic
972094126 4:35327174-35327196 ATGTATAAACAGATAGACTATGG - Intergenic
972540800 4:40037664-40037686 ATAAATAAATAAATAGAAAAAGG + Intergenic
973147663 4:46847791-46847813 AGGAATAGACAAAAATGCAAGGG + Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973887537 4:55338156-55338178 AGGAACAGACAAATAAACAATGG - Intergenic
974092508 4:57326814-57326836 ATGTATAGACAGAGAGAAAATGG - Intergenic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
974734021 4:65905309-65905331 ATGAAAGAACATATAGACAAAGG + Intergenic
974913949 4:68156762-68156784 AAAAACAGACAAATAGACCAGGG - Intergenic
974970860 4:68824547-68824569 AGTAATTGACAAATGGACAAAGG - Intronic
974992090 4:69105304-69105326 AGTAATTGACAAATACACAAAGG - Intronic
975086003 4:70340735-70340757 ATAAATAAATAAATAGACACAGG - Intergenic
975213322 4:71726171-71726193 AGGAATTTACAAATAAACAAGGG - Intergenic
975333710 4:73150785-73150807 ATAAATAAACAAAGATACAAAGG + Intronic
975454522 4:74574685-74574707 ATAAATAGAAAAATTGGCAAAGG - Intergenic
975863842 4:78705632-78705654 ATCAATAGATAAAAAGAGAAGGG - Intergenic
975905281 4:79203841-79203863 TTTAATAGAGAAAGAGACAAGGG + Intergenic
976108479 4:81644672-81644694 ATGAATGGAACAATATACAAGGG + Intronic
976233303 4:82868527-82868549 ATAAATAAATAAATAGAAAATGG + Intronic
976574144 4:86649575-86649597 AGAAACAGACATATAGACAAAGG - Intronic
976803656 4:89021483-89021505 ATGAATTGAGAAGTAGACATAGG + Intronic
976953864 4:90869142-90869164 ATGAACAGACAACTACAGAATGG - Intronic
976992813 4:91389423-91389445 ATGAATAAGCAAATAGGTAATGG - Intronic
977398539 4:96501863-96501885 AAAAATAGACACATAGACCAGGG + Intergenic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
978038100 4:104021791-104021813 TTGAATATATAAACAGACAATGG + Intergenic
978055487 4:104259019-104259041 ATGAATAGACACATAAACTGTGG + Intergenic
978229300 4:106378976-106378998 ATGCCAAGACAATTAGACAAGGG + Intergenic
978524145 4:109647559-109647581 ATGAATGAATAAATAAACAATGG - Intronic
978612184 4:110554834-110554856 ATGAAAAGACAAGTAAATAATGG + Intronic
978958703 4:114648081-114648103 ATGAAAAGTCAACTAGGCAAAGG - Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979105079 4:116674690-116674712 ATATATAGATAAATAGATAAAGG - Intergenic
979181840 4:117738714-117738736 AAGAACAGACACATAGACCAAGG + Intergenic
979348758 4:119621608-119621630 ATGAAAAGATAAATAGAGATAGG + Intronic
979359426 4:119744374-119744396 ATTAATAGAGAAATTGGCAATGG - Intergenic
979481677 4:121226161-121226183 AAAAAGAGAGAAATAGACAAAGG + Intronic
979813348 4:125066110-125066132 ATGAAAACAAAAATAGAAAAAGG + Intergenic
980367671 4:131826647-131826669 AAAAATAGAGAAATATACAAGGG + Intergenic
980420619 4:132555319-132555341 ATAGATAGACAGATAGATAATGG - Intergenic
980569631 4:134597663-134597685 ATGAATAGACAAACTCTCAATGG + Intergenic
980656240 4:135790826-135790848 AGGAATACACAAATACACAGGGG - Intergenic
980746501 4:137023482-137023504 ATGAATACACAAATATAATAGGG + Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981157210 4:141452870-141452892 ATGAATAGATAAATATAACATGG - Intergenic
981169242 4:141603064-141603086 ATGAAAAGACAAGTAGCTAATGG - Intergenic
981212659 4:142126907-142126929 ATGGGTAGACTAATAGACACAGG + Intronic
981341630 4:143628297-143628319 ATGAAGAGGACAATAGACAAGGG + Intronic
981439106 4:144762044-144762066 AAAAACAGACACATAGACAATGG + Intergenic
981456310 4:144957173-144957195 AGGAATCGACACATTGACAATGG + Intergenic
982163505 4:152593467-152593489 ATGCATAAACAAATCGACATTGG + Intergenic
982419364 4:155176661-155176683 ATGAACAGACTACTACACAAGGG - Intergenic
982494728 4:156076758-156076780 AAGAATAGACAAATAGATAAAGG - Intergenic
982593702 4:157350627-157350649 AGCAATAGAGTAATAGACAATGG - Intronic
982602171 4:157466027-157466049 ATGATAAGACAAATATACAAGGG + Intergenic
982882719 4:160740641-160740663 AAGTGTACACAAATAGACAATGG + Intergenic
983516710 4:168664985-168665007 ATGAAGAGACAAAATGTCAAGGG + Intronic
983985166 4:174050874-174050896 ATGAATAGCCAAATCGATCAAGG - Intergenic
984071404 4:175117958-175117980 ATGAAGAGAACAATAGACACTGG + Intergenic
984287655 4:177753321-177753343 ATGAATAGAAAAATGAAAAATGG + Intronic
984330365 4:178307586-178307608 ATGAATAGATAAATGGAAAGAGG + Intergenic
984848780 4:184132986-184133008 AAGAATAGTTAAATAGACTAAGG - Intronic
985202628 4:187499700-187499722 AGAAATAGACAAATAGGCCAAGG + Intergenic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986528624 5:8709629-8709651 ATAAATAAATAAATAGGCAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986852311 5:11828534-11828556 ATAAATAAATAAATAGAAAAAGG + Intronic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
987832255 5:23110226-23110248 AAAAACAGACACATAGACAAAGG + Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988252474 5:28777800-28777822 ATGACTAGTGAAATATACAAAGG + Intergenic
988266488 5:28958161-28958183 ATAAAAAGAAAAATAGAAAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988715116 5:33818463-33818485 ATAAACAGACAAATGGATAAAGG - Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
990073986 5:51819867-51819889 ATAAATATAAAAAAAGACAATGG - Intergenic
990077578 5:51869506-51869528 ATGAATAGCCAAAAATAGAAAGG - Intergenic
990092091 5:52064325-52064347 GAGAACAGACTAATAGACAAAGG + Intronic
990178162 5:53130200-53130222 ATGAATAAATAAACAAACAAAGG + Intergenic
990326669 5:54683471-54683493 AAGAACAGACAAATAGTCAATGG - Intergenic
990335696 5:54770114-54770136 ATAAATACACAAATAGACATGGG + Intergenic
990358285 5:54992716-54992738 ATAGATAGACAGACAGACAATGG + Intronic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990791225 5:59482321-59482343 AAGAAGAGACCAGTAGACAATGG - Intronic
991166761 5:63571846-63571868 CTGTATTGACAAATACACAAAGG - Intergenic
991232769 5:64355689-64355711 AAGAATAGACATATAGATCAAGG + Intronic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992147854 5:73869991-73870013 ATCCATAGACAAATATACGAAGG + Intronic
992777543 5:80101837-80101859 ATAAATAGAGAGATAGAAAATGG + Intergenic
992933067 5:81671072-81671094 ATGAATACACCTATAGACACAGG + Intronic
993205608 5:84874463-84874485 AGGAACAGACAGATAGAAAAGGG + Intergenic
993449025 5:88051782-88051804 ATAAATTGACTACTAGACAAAGG - Intergenic
993458169 5:88149018-88149040 CTAAATAGTCAAATAGACATTGG - Intergenic
993491151 5:88551689-88551711 ATGAAGAAACAAATACAAAAGGG - Intergenic
993514364 5:88812296-88812318 ATGAATAGATATATGGACAGAGG + Intronic
993705808 5:91168737-91168759 ATGAATAGATAAACAGAGTATGG - Intergenic
994014884 5:94954371-94954393 AAGAATGGAAAAATAGACACTGG + Intronic
994469863 5:100189406-100189428 AAGGATAGTCAAATAGACCAGGG - Intergenic
994521643 5:100845529-100845551 CTGAAAAGTCAAATAAACAAGGG + Intronic
994638968 5:102381458-102381480 ATTGACAGATAAATAGACAATGG - Intronic
994709608 5:103250977-103250999 AGGAATAGACATATAGATAAAGG - Intergenic
995351792 5:111185544-111185566 ATGAATAGATGAACAGAAAATGG - Intergenic
995432757 5:112099974-112099996 ATAAATTGATAAATAAACAAAGG + Intergenic
995984636 5:118154847-118154869 ATGAAGAGAAGAATAGACAAAGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996506494 5:124273974-124273996 ATCAATAGAGATATAGAAAAAGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997495769 5:134323509-134323531 AAGAATAGATAAATAGATCAAGG + Intronic
997847478 5:137301094-137301116 AGGCATAGACAAAGAGACTAAGG - Intronic
997866113 5:137464308-137464330 ATAAATAAACAAACAAACAAAGG + Intronic
998040389 5:138947618-138947640 ATGAATAGACAGACAGACTTGGG - Intronic
998571936 5:143268295-143268317 AGCAATAGACAAATAGTCAATGG - Intergenic
999084874 5:148878822-148878844 ATTAATAGAGAAATAAATAATGG + Intergenic
999190454 5:149743135-149743157 AAGAATAAACACATAAACAAAGG - Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
1000244635 5:159439228-159439250 ATAAATAGAAAAATAGCCAAGGG + Intergenic
1000354707 5:160383068-160383090 AACAAAAGAAAAATAGACAAAGG + Intergenic
1000689374 5:164296064-164296086 ATTAATAGACAAATAAACGTAGG - Intergenic
1000816405 5:165928194-165928216 AGGAAAAGACAAAAAGACACAGG - Intergenic
1000934850 5:167295063-167295085 ATGAATAGGGAAATAAACAAAGG + Intronic
1001996146 5:176160624-176160646 ATGAATACCCCAATAGAAAAAGG + Intergenic
1002323731 5:178391397-178391419 ATAAAAAGACAAATAGGCAGAGG + Intronic
1002933810 6:1654509-1654531 ATGAAAAGACAAATACTCCATGG + Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004109876 6:12706977-12706999 TTGAATAGACACATTGCCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004362176 6:14980985-14981007 ATCAATAGGAAAATAGACACTGG + Intergenic
1004406229 6:15336113-15336135 ATGAATAAATAAATAAATAAAGG + Intronic
1004590293 6:17044400-17044422 ATGTTTTGACAAATAGACACTGG - Intergenic
1004766394 6:18732613-18732635 AAGAAGAGACCAATAGACACTGG + Intergenic
1005115615 6:22332321-22332343 ATGAAGAGAGAAATACATAAGGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006287820 6:33111295-33111317 AAAAATAGGCACATAGACAAAGG - Intergenic
1006703085 6:35992994-35993016 ATAAATAAATAAATAGGCAAAGG - Intronic
1008015574 6:46515444-46515466 ATATATAGAAAAATAGATAATGG - Intergenic
1008032219 6:46709723-46709745 ATGAACAAACAAATAAACATGGG - Intronic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008448866 6:51625905-51625927 ATAAATAGAGAAAGAGAGAAGGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009931087 6:70178524-70178546 AAGAATCTAGAAATAGACAATGG + Intronic
1010200571 6:73278334-73278356 ATCAATAGAAATATAGGCAAAGG - Intronic
1010283505 6:74047766-74047788 ATGGGAAGACAAATAGATAAAGG - Intergenic
1010284533 6:74059999-74060021 ATGAAAAGACAAAATGATAAAGG - Intergenic
1010342530 6:74771675-74771697 ATGAATAAAGAAATATATAATGG - Intergenic
1010662950 6:78592554-78592576 ATAAATAGACAAATACAAAGAGG + Intergenic
1011332615 6:86227120-86227142 ATAAATAGCCAAATCGACCAAGG - Intergenic
1011355458 6:86468787-86468809 AAGAAAAGACAAAGAGAGAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012175826 6:96082481-96082503 TGGAATAGGCAAATAGCCAATGG - Intronic
1012315191 6:97776165-97776187 ATGAATAGTCGAATAAACCAAGG + Intergenic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012486657 6:99729323-99729345 AAAAACAGACACATAGACAAGGG - Intergenic
1012871560 6:104678854-104678876 AAGAACAGACAAATAGATCATGG + Intergenic
1012973028 6:105751950-105751972 ATCAACAGACAAATGGATAAAGG - Intergenic
1012977996 6:105800526-105800548 ATGAAAAGACAAGTAGATCAAGG + Intergenic
1013245252 6:108280513-108280535 AAGAATAAACAAGGAGACAAGGG - Intergenic
1013406481 6:109848472-109848494 ATAAATAAATAAATAGAAAATGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013841625 6:114402768-114402790 ATCCCTAGACACATAGACAAGGG - Intergenic
1014310589 6:119796094-119796116 AAAAATAGACACATAGCCAATGG - Intergenic
1014341234 6:120209998-120210020 AAGAAGAGACAAATAGACACTGG + Intergenic
1014448362 6:121555294-121555316 ATGAATAGATAAAGAAACTATGG + Intergenic
1014520503 6:122436852-122436874 AAGAAGACACAAATAGAGAATGG + Intergenic
1014585312 6:123190910-123190932 AAGAAGAGACAGATAGACCAGGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014789630 6:125657796-125657818 ATGAAAAGACAAACAGAACAAGG + Intergenic
1014976927 6:127898750-127898772 ATGAATAGACAAATAAAATGTGG + Intronic
1014982353 6:127959631-127959653 AACAATAGACCAATAGACATGGG + Intergenic
1015208283 6:130666846-130666868 AAGCCTATACAAATAGACAATGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016127961 6:140429178-140429200 ATAAATAGACACGTAGATAATGG - Intergenic
1016144998 6:140659735-140659757 ATAAATATACAAATACACTAAGG + Intergenic
1016177041 6:141092502-141092524 ATGAATAGATAAATATACTATGG - Intergenic
1016195224 6:141328114-141328136 ATTAATAGATAAATGGATAAAGG + Intergenic
1016201284 6:141412436-141412458 AAGAATAGTCAAATGGACCAAGG - Intergenic
1016473528 6:144401183-144401205 ATGAATAAAAAAATATAGAAAGG - Intronic
1016517198 6:144908367-144908389 AAGAATAGAGAAATAGATAGTGG + Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016607452 6:145947915-145947937 ATGAATAAAAAAAAATACAAAGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017381186 6:153831951-153831973 ATGAACAGACAGAAAAACAATGG - Intergenic
1017414083 6:154201353-154201375 ACAAAGAGACAAAGAGACAAAGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018157083 6:160995097-160995119 ATAATTAAAAAAATAGACAATGG - Intronic
1018524818 6:164697689-164697711 ATGGATAGACAATTAGAACAGGG + Intergenic
1019345591 7:528686-528708 ATGAATGGATGGATAGACAATGG + Intergenic
1019945568 7:4326180-4326202 ATAAATAGACAAATAAAATATGG - Intergenic
1020410871 7:7890137-7890159 AAGAATGGACAAATGGACAGGGG + Intronic
1020644865 7:10802468-10802490 AGAAATAGAAAAATAGACAAGGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021239022 7:18177964-18177986 ATGAATAAGCAAAAAGAAAAGGG - Intronic
1021362866 7:19738092-19738114 AAGAAAAGACAAAAAGGCAATGG + Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1022295256 7:29044713-29044735 TTGAAAAGACAAATCGAGAAAGG - Intronic
1022726184 7:32983874-32983896 CTAAATAGAAAAATAGGCAAAGG - Intronic
1023362648 7:39432130-39432152 ATGAATAGAAAAACAGCAAATGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024356461 7:48418060-48418082 ATGAATAGATAAATAGACTATGG - Intronic
1024436824 7:49366212-49366234 AGGAAGAGACAAATTGAAAAAGG - Intergenic
1024808287 7:53175782-53175804 AGGAAAACAAAAATAGACAAAGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025047412 7:55703796-55703818 CTAAATAGAAAAATAGGCAAAGG + Intergenic
1025703178 7:63838665-63838687 ATGCATAGAAAAATAGAAATTGG + Intergenic
1025733373 7:64126085-64126107 ATAAATAAACAAATAAATAAAGG - Intronic
1025956735 7:66188837-66188859 ATGGATAGATAAATAGATGATGG - Intergenic
1027215631 7:76181720-76181742 ATGAATCAACAAATAGAAAAAGG + Intergenic
1027971110 7:85083358-85083380 ATGCATGGACCAATGGACAATGG + Intronic
1027979694 7:85201707-85201729 ATAAATAGATAAATAAATAATGG - Intergenic
1028190913 7:87850779-87850801 AAGAAAAGAAAAATAGAAAAAGG + Intronic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028620583 7:92823042-92823064 ATCATTAGGCAAATAGAAAATGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029701704 7:102250735-102250757 ACGCATATACACATAGACAAGGG - Exonic
1029817505 7:103111737-103111759 AACAAAAGCCAAATAGACAATGG + Intronic
1030471535 7:109969690-109969712 ATTAACAGAAAAAAAGACAAAGG + Intergenic
1030634675 7:111935430-111935452 GTGAATAGACAGAAAAACAAAGG + Intronic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1031045652 7:116884643-116884665 GTGAACAGACAAATAAACCATGG - Intronic
1031109136 7:117584519-117584541 ACAAATAGGCAAGTAGACAATGG - Intronic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1032009450 7:128333734-128333756 ATAAAAATAAAAATAGACAAAGG + Intronic
1032112625 7:129089665-129089687 ATGAAAATACAAACAGACAATGG + Intergenic
1032143040 7:129351470-129351492 ATGAAAAGTGAAAAAGACAAAGG + Intronic
1033525183 7:142206135-142206157 AAGAATAGACATATAGATTAAGG - Intronic
1033528510 7:142240891-142240913 ATGGAGAGACAAAGATACAAAGG + Intergenic
1033610682 7:142961131-142961153 AAGAAGAGGCAAAAAGACAAGGG + Intronic
1033611487 7:142967365-142967387 TTGAATTGACAAATAGAATATGG - Intergenic
1033835641 7:145307939-145307961 ATAAAAGCACAAATAGACAAGGG + Intergenic
1034242195 7:149619117-149619139 ATGAATAAATAAATAGACACTGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034688047 7:152991013-152991035 ATAAATAGATAAATAGATGATGG - Intergenic
1034824206 7:154246675-154246697 AAGAAAAGACAAATAATCAACGG + Intronic
1034835398 7:154346920-154346942 ATGAAAGGAAAAATAGAAAATGG - Intronic
1035079368 7:156203399-156203421 TTGAATAGTAAAACAGACAATGG - Intergenic
1035255292 7:157622065-157622087 ATGAGTAGACAAGGAAACAAAGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1035647963 8:1242908-1242930 ATGGATGGACAGATAGACAGTGG + Intergenic
1035922107 8:3688375-3688397 AGGAATTGAGAAATAGACAGAGG + Intronic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1036054993 8:5241855-5241877 ATGAATAGACAGATACATAATGG + Intergenic
1036713458 8:11098745-11098767 GTGAATAGACTAATAGTTAAGGG - Intronic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1037070610 8:14643134-14643156 ATGAATAGCAAAATAGATGAAGG + Intronic
1037546097 8:19924185-19924207 AAGGATAGACATATAGTCAATGG + Intronic
1037747597 8:21659317-21659339 ATGAATGAATAAATAGATAAAGG - Intergenic
1038107857 8:24456349-24456371 ATGAATAGATAAAGAGAATATGG - Intronic
1038272017 8:26082901-26082923 ATGAATGGATAAATAGACTAAGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039098334 8:33911703-33911725 ATGAATGGATAAAGAGACTATGG + Intergenic
1039100476 8:33936494-33936516 ATGCACAGACAAATAAACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1039919730 8:41884835-41884857 ATAAATAAACAAACAAACAAGGG + Intronic
1040492210 8:47934544-47934566 ATAAATAAATAAATAGATAACGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041033502 8:53762616-53762638 AAGAATAAACAAATAGATGATGG + Intronic
1041306572 8:56468117-56468139 ATAAATAGACTAAGACACAAAGG - Intergenic
1041547293 8:59060213-59060235 ATGAAAAGACATAAAGACACGGG - Intronic
1041808503 8:61882008-61882030 ATGAATAGACACATTGAAGAGGG - Intergenic
1042948462 8:74177526-74177548 ATAAATAGTCCAATAGGCAATGG + Intergenic
1043179862 8:77075103-77075125 ATGAATAAATAAATAAAGAATGG + Intergenic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1043231393 8:77805788-77805810 AAGAATAGACAAATAGGCAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044365427 8:91339738-91339760 TTCAAAAGACAATTAGACAAGGG + Intronic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044703939 8:94990332-94990354 AAAAATAGAGAAATAGAGAATGG - Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045776988 8:105816209-105816231 ATCAATAGACGAATACCCAATGG - Intergenic
1046124462 8:109886811-109886833 ATGAATATACAAAGACATAAAGG + Intergenic
1046124559 8:109888285-109888307 ATGAAAAAACAAAGACACAAAGG - Intergenic
1046205828 8:110995225-110995247 AATAATACACAAATAGAAAAGGG - Intergenic
1046553213 8:115743086-115743108 ATGTATAGATATATAGACAGGGG + Intronic
1046804428 8:118464142-118464164 ATAAATAAATAAATAAACAAAGG + Intronic
1046862824 8:119113726-119113748 AAGAAAAGACAAATAGGAAAGGG + Intergenic
1046919151 8:119709246-119709268 ATGAATGGACAAATAAAATATGG - Intergenic
1047120723 8:121901623-121901645 ATATATAGAGAAGTAGACAATGG - Intergenic
1047896114 8:129368381-129368403 AAGAATAGAAATAGAGACAAAGG + Intergenic
1047921381 8:129638191-129638213 AAGAATAGACAAATAGCTAGAGG + Intergenic
1048248351 8:132834081-132834103 TTGAATAGCCACCTAGACAATGG - Intronic
1048413153 8:134196975-134196997 ATGGATAGAAGAATGGACAAGGG - Intergenic
1048494196 8:134921815-134921837 ATAAAGAAACAAATAGACATGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048906600 8:139095108-139095130 ATGAACAGGGAAATAGACAATGG - Intergenic
1049341671 8:142115960-142115982 ATGAATAGATAAATGAATAAGGG - Intergenic
1049578843 8:143401675-143401697 ATGAAGAGAGACAGAGACAAAGG + Intergenic
1049976367 9:863868-863890 ATCAATAGAGAAATGGGCAAAGG - Intronic
1050285433 9:4097018-4097040 ATAAATAAACAAACAAACAAAGG + Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050595702 9:7202662-7202684 AAGAAAAGGCAAAAAGACAATGG + Intergenic
1050661325 9:7886083-7886105 AGGATTAGATAAATAGATAAGGG - Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051065333 9:13095262-13095284 ATGAGTAGACAAAAAGTCCATGG - Intergenic
1051187960 9:14480530-14480552 ATGAAAATACAAATAGACCCAGG - Intergenic
1051651367 9:19329433-19329455 ATGAATAGACAAATAAAATATGG - Intronic
1051729134 9:20120973-20120995 AAGAATAGGCAAATAAATAAAGG - Intergenic
1051864972 9:21669729-21669751 ATCAACAGATAAATAGATAAAGG - Intergenic
1051914309 9:22189769-22189791 AAGAACAGATACATAGACAAAGG + Intergenic
1052656597 9:31370736-31370758 ATGAACGGACAAACAGAAAATGG - Intergenic
1052764110 9:32622808-32622830 ATGGATAAACAAATACACATTGG - Intergenic
1052782109 9:32792088-32792110 ACGAATGCAAAAATAGACAATGG + Intergenic
1052946786 9:34174989-34175011 ATGAATACACAAACACAAAAAGG - Intergenic
1053271549 9:36753001-36753023 GTGAATAGATAAATAAACCATGG + Intergenic
1053541554 9:38979232-38979254 ATAAATAAATAAATAAACAAAGG - Intergenic
1053601376 9:39613337-39613359 AAGAACAGACACATAGACCAAGG + Intergenic
1053632023 9:39952369-39952391 AAAAATAGAGAAATATACAAGGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053773743 9:41511162-41511184 AAAAATAGAGAAATATACAAGGG - Intergenic
1053859022 9:42367124-42367146 AAGAACAGACACATAGACCAAGG + Intergenic
1054211865 9:62298329-62298351 AAAAATAGAGAAATATACAAGGG - Intergenic
1054252160 9:62729100-62729122 AAGAACAGACACATAGACCAAGG - Intergenic
1054313119 9:63550502-63550524 AAAAATAGAGAAATATACAAGGG + Intergenic
1054566275 9:66763602-66763624 AAGAACAGACACATAGACCAAGG - Intergenic
1054624585 9:67384677-67384699 ATAAATAAATAAATAAACAAAGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055850174 9:80617965-80617987 AAGAAAAAACAAATAGTCAATGG - Intergenic
1056172665 9:84002455-84002477 TAGAACAGACAAATAGACAAAGG - Exonic
1056288709 9:85118726-85118748 TTGCAGGGACAAATAGACAAGGG + Intergenic
1056337263 9:85584856-85584878 CTAAATAGACACATAGGCAATGG + Intronic
1056561823 9:87736848-87736870 ATGAATAGACAAATCATCCATGG + Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056859191 9:90163966-90163988 ATAAATAGTCAAATCCACAATGG - Intergenic
1056929754 9:90864295-90864317 ATAAATAAATAAATAAACAAAGG + Intronic
1057323179 9:94032838-94032860 ATAAATAGAGAAAAAGAAAAAGG - Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057828967 9:98392806-98392828 ATGAGTAGACAGATGGACAGTGG - Intronic
1058586238 9:106509320-106509342 AACAATAGAAAAATAGGCAAGGG - Intergenic
1058873460 9:109222223-109222245 ATGAAAAGAGAAATAGATGAGGG + Intronic
1058911780 9:109526808-109526830 ATGGATAAATAAGTAGACAAAGG + Intergenic
1058998483 9:110323492-110323514 ATAAATAGATAAATAGATGAGGG + Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059686309 9:116640197-116640219 AGGAATTGAGAAATAGACTAGGG + Intronic
1059705249 9:116816907-116816929 ATAAATAAATAAATAGACGAGGG + Intronic
1060855438 9:126911431-126911453 ATGAATAGATAAATAAAATATGG - Intergenic
1061554023 9:131355338-131355360 AAGGCTAGACACATAGACAATGG - Intergenic
1203723613 Un_GL000216v2:31698-31720 TTGAATAGACACAAAAACAATGG - Intergenic
1185498559 X:579075-579097 ATGAATAGAGAGATAGATGATGG + Intergenic
1185544132 X:928315-928337 ATACATAGACAGATAGATAATGG - Intergenic
1185788193 X:2908109-2908131 ATCGATAGATAAATAGATAATGG - Intronic
1185840705 X:3388111-3388133 ATGAATGGATAAATAGATGATGG - Intergenic
1185856025 X:3536106-3536128 AGGAAGAGACAAAGAGACACAGG - Intergenic
1185883377 X:3759854-3759876 ATGGATAGATAAATAGATGATGG - Intergenic
1186366541 X:8900544-8900566 CTAAAAAGACAAATAGAGAAAGG + Intergenic
1186911151 X:14167850-14167872 AAGAATAGATAAATAGAACATGG - Intergenic
1187383078 X:18823037-18823059 AAGAATACCCATATAGACAATGG + Intronic
1187498510 X:19817120-19817142 AGGAATACACATATAGATAAAGG - Intronic
1187914762 X:24142980-24143002 AACAATAGAAAAACAGACAAAGG + Intergenic
1187967703 X:24629173-24629195 AACAATAGAAAAATAGGCAAAGG - Intronic
1188103989 X:26125842-26125864 ATAAATAGATAGATAGATAATGG - Intergenic
1188256759 X:27971190-27971212 ATGAATATAGATATAGATAACGG - Intergenic
1188327624 X:28824914-28824936 ATGAATACACAAATACAGAAAGG - Intronic
1188535906 X:31196452-31196474 ATTAATACACAAAAAGCCAAAGG + Intronic
1188903818 X:35767406-35767428 ATGATTACAAAAATATACAAAGG - Intergenic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1189786239 X:44560984-44561006 ATAAATAAACAAACAAACAAAGG + Intergenic
1189913355 X:45833566-45833588 ATTAAAAGCCAAATAGAAAAAGG + Intergenic
1189941543 X:46128369-46128391 ATGAATAGGCAAAAATAAAAAGG + Intergenic
1189963501 X:46348489-46348511 TGGAATAGACACATAGATAAAGG + Intergenic
1190100068 X:47515846-47515868 ATGAATAGATAAATAAAAAATGG - Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190431240 X:50379527-50379549 CTGAAGTGAAAAATAGACAATGG - Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190782237 X:53608999-53609021 ATAAATAAATAAATAGAAAAAGG - Intronic
1191188952 X:57645006-57645028 AAAAACAGACACATAGACAATGG + Intergenic
1191695949 X:63990520-63990542 ATCAATTCAAAAATAGACAAAGG + Intergenic
1191704180 X:64076284-64076306 ATGAATAGATAAATAAAATATGG + Intergenic
1191737858 X:64406342-64406364 AAGAATAGACTAATACAGAAAGG - Intergenic
1192085111 X:68088283-68088305 ATGAACAGACAATTAGAACACGG - Intronic
1192368546 X:70495278-70495300 AAAAATAGAGAAAAAGACAAGGG - Intronic
1192942185 X:75924331-75924353 AAAAACAGACAAATAGACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193158351 X:78199055-78199077 ATAAATAAATAAATAGAAAATGG - Intergenic
1193450757 X:81662340-81662362 ATGAAAAGAGAGAAAGACAATGG + Intergenic
1193492578 X:82167246-82167268 ATGAACAGAAGAATAGACCAAGG + Intergenic
1193570742 X:83138798-83138820 AAGAAAAGCCAAATAGAAAAAGG + Intergenic
1193615779 X:83686741-83686763 ATGAAAAGAAAAATAAACATGGG - Intergenic
1193752353 X:85361558-85361580 AAGAACAGACACATAGACCAAGG - Intronic
1193768400 X:85560195-85560217 ATCAATAGCCAAATCAACAAAGG - Intergenic
1193879429 X:86903136-86903158 ATGAAGAGAACAATAGACACTGG + Intergenic
1193944271 X:87713122-87713144 ATAAAAACACACATAGACAAAGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194011133 X:88563272-88563294 TGGAATAGAAAAATAGACACTGG + Intergenic
1194153494 X:90356733-90356755 ATGAATACACACACAGACAAGGG + Intergenic
1194178005 X:90675870-90675892 ATGAATAAATAAATATACGAGGG + Intergenic
1194202346 X:90968931-90968953 ATGCATGCACAAATATACAAAGG + Intergenic
1194376972 X:93148693-93148715 ATTAATATGCAAATAGATAAAGG + Intergenic
1194402042 X:93449823-93449845 AAAAATAGACATATAGACCAAGG - Intergenic
1194587405 X:95752913-95752935 AAGAATAGACAGATAGATCAAGG - Intergenic
1194702589 X:97132680-97132702 ATGAATATACAAATATAATAGGG + Intronic
1194854949 X:98916735-98916757 AAGAATAGACATATAGACAAAGG - Intergenic
1194859370 X:98978059-98978081 GTGAATAGTCAAATAAACATTGG + Intergenic
1194919923 X:99752169-99752191 ATAAATGGACAAATAAAGAAAGG - Intergenic
1195221833 X:102751834-102751856 ATGGATAGAAAAAGATACAAAGG - Exonic
1195814008 X:108865843-108865865 AAAAACAGACACATAGACAATGG - Intergenic
1195885328 X:109631314-109631336 ATGAATAGACAAATAGATAGAGG - Intronic
1196090873 X:111740909-111740931 CTGAATAGCCAAATAGATGAGGG + Intronic
1196604131 X:117636363-117636385 TTGAACAGACAATTAAACAAAGG - Intergenic
1196609927 X:117700876-117700898 AACAACAGACAAATAGACCAAGG + Intergenic
1196779172 X:119367151-119367173 TTGAATAGAAAAATAAACCATGG - Intergenic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1197084769 X:122458909-122458931 ATGAAGACACAAATAAAGAAAGG + Intergenic
1197350270 X:125373461-125373483 AAGAATAGACAAATAGGTCAAGG - Intergenic
1197392156 X:125880793-125880815 ATGAATAGCTAAATAAACAGTGG - Intergenic
1197539505 X:127739724-127739746 ATGAATATATAAATAAACAGTGG + Intergenic
1197573095 X:128174291-128174313 GTGAATAGATAAATAAACTATGG + Intergenic
1197580267 X:128274528-128274550 ATAAGTAGAATAATAGACAATGG + Intergenic
1197780255 X:130152187-130152209 ATGAAAAGAGAAATAAACAGGGG + Intronic
1198191172 X:134307732-134307754 ATAAATAAATAAATAGTCAAAGG + Intergenic
1198628575 X:138607782-138607804 AAGAACAGACACATAGACCAAGG - Intergenic
1199183242 X:144883348-144883370 AAAAATAGGCACATAGACAAAGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1199212516 X:145230205-145230227 ATGTATAAAAAAACAGACAAAGG + Intergenic
1199358637 X:146890892-146890914 AAAAATAGACATATAGACCAAGG + Intergenic
1199568290 X:149241062-149241084 AAGAATAGAAACATAGACCAAGG + Intergenic
1199718013 X:150520368-150520390 AGGAATAGAACAATAGACACTGG + Intergenic
1200499830 Y:3933529-3933551 ATGAATACACACACAGACAACGG + Intergenic
1200524673 Y:4258026-4258048 ATGAATAAATAAATATACGAGGG + Intergenic
1200548183 Y:4544386-4544408 ATGCATGCACAAATATACAAAGG + Intergenic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1200808061 Y:7453048-7453070 AGGAAGAGACAAAGAGACACAGG + Intergenic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic
1201271097 Y:12254375-12254397 ATAAAAAGAGAAAGAGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201482650 Y:14456672-14456694 ATATATAGATAAATAGACACAGG + Intergenic
1201525284 Y:14926289-14926311 ATGAATAAACGAAGAGAAAAAGG + Intergenic
1201651030 Y:16286931-16286953 ATTGATAGACAAATAGAGATAGG - Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic
1201681451 Y:16648674-16648696 ATAAAGAGACAAATATACATGGG - Intergenic
1201920707 Y:19230643-19230665 TTGAAAAGAAAAAAAGACAAGGG - Intergenic