ID: 1082887943

View in Genome Browser
Species Human (GRCh38)
Location 11:58108333-58108355
Sequence CAGTAACAGAAGAATAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082887943 Original CRISPR CAGTAACAGAAGAATAAGTA AGG Intronic
901351423 1:8600535-8600557 CAGTAACAAAAGAAAAAGCCAGG + Intronic
901352888 1:8614008-8614030 TAGTAACAGAGGAATAACCAAGG + Intronic
901521582 1:9788935-9788957 CAGTTACAAAAGGATAAGTGTGG - Intronic
904364286 1:30000589-30000611 ATGAGACAGAAGAATAAGTAAGG + Intergenic
905445310 1:38024859-38024881 CAATAAAAGAAGAATGAGTGAGG - Intergenic
906204065 1:43977930-43977952 CAGGGACAGAGGAATAGGTAAGG - Intronic
908987388 1:70040304-70040326 AAGAAACAGAAAAATAAGCAGGG + Intronic
909404282 1:75269498-75269520 AAGTAACAGAAGAAAATGCAAGG - Intronic
909961278 1:81846686-81846708 GAGAAAAAGAAGAATCAGTAAGG - Intronic
910030791 1:82720085-82720107 CAGGAACAGAAAGATAAATATGG - Intergenic
911482968 1:98467522-98467544 CATTAATAGAAGAATGAGAAAGG + Intergenic
911569310 1:99503804-99503826 CAGTAACATCATAATAAGGAAGG - Intergenic
912048800 1:105496276-105496298 CAGTATGTGAAGAATCAGTATGG + Intergenic
912420877 1:109541612-109541634 CAGTCACAGAACAAGAAGTAGGG - Intronic
912484100 1:110010859-110010881 CAAAAACAGAAGAATAATTTAGG - Intronic
912648023 1:111413723-111413745 AAGTAACATAATAATAGGTATGG + Intergenic
914331518 1:146675045-146675067 CAGTAAGAGAAGAAAGAGAAAGG - Intergenic
914794949 1:150912370-150912392 CAGAAACAGAAGAACAACAAAGG - Intergenic
915048265 1:153038825-153038847 CAGTAACAGATGAATGGATAAGG - Intergenic
915105270 1:153531292-153531314 CAGTAACAGAAGAATGCACATGG + Intergenic
915678953 1:157561264-157561286 CAGAAACAGAAGAATATTGAGGG - Intergenic
916755683 1:167768069-167768091 CAGAAGCAGAAGAATAACAAGGG - Intronic
917153378 1:171968249-171968271 CAGTATCAGAAGAAAAAAAAAGG - Intronic
917590265 1:176469334-176469356 CAGAAACAGAAGAGAAAGCAAGG - Intronic
917730330 1:177868674-177868696 CAGGAACAGAAAACCAAGTACGG - Intergenic
918601464 1:186367829-186367851 CACTAACAGAAGAAAAATAAAGG + Intronic
918667108 1:187164907-187164929 CAGCAACAGAAGAATTAATTAGG - Intergenic
918977177 1:191504555-191504577 CTTTAACAGAAGTATTAGTAGGG + Intergenic
919000780 1:191828360-191828382 CAGGAACAGAATATTAAGGATGG - Intergenic
919347888 1:196409683-196409705 CATTAACAGATGAATAGATAAGG - Intronic
920424441 1:205862835-205862857 CAGTTACAGAAGCATAATCATGG - Intergenic
920584997 1:207150224-207150246 CAGCAACAGAAAAAGAAGAAAGG - Intergenic
921640805 1:217551178-217551200 CAGAAACAGAAAAAGATGTATGG + Intronic
924094737 1:240539473-240539495 TAATAACAGAAGAAAAATTAGGG - Intronic
924751672 1:246898337-246898359 CTGTAACAGATAAATTAGTAAGG + Intronic
924807278 1:247371587-247371609 CAGTAACAGAAGCACAAATACGG - Intergenic
1063419705 10:5901940-5901962 CAGTAACAGATGCAGAAGCATGG + Intronic
1063807662 10:9665632-9665654 CTGTAAAAGAATAAAAAGTATGG - Intergenic
1064515149 10:16139163-16139185 CATTAACAGGAGAAAAAGAAAGG - Intergenic
1064617896 10:17181560-17181582 CAGAAACAGGAGAACAAGGAGGG - Intronic
1064801730 10:19082733-19082755 CAGTAACAGAAGCAAATGTGTGG - Intronic
1064819430 10:19309402-19309424 CAGTTACAGAGGTATAAATATGG - Intronic
1065231527 10:23603532-23603554 CAGTAATAGAAAAACAAATAGGG + Intergenic
1066311035 10:34196924-34196946 CAGTATCAAAAGAATTAGCATGG - Intronic
1066679759 10:37926366-37926388 CAGTTACAGAAGGACAAATATGG + Intergenic
1067115017 10:43428782-43428804 AAATAACAGAATAATAAGCAAGG + Intergenic
1067822410 10:49541468-49541490 AAGTGACAGAATAACAAGTAGGG - Intergenic
1068318696 10:55381770-55381792 AAGTAAAAGAAGAAAAAGAAAGG + Intronic
1068554272 10:58440481-58440503 CAGGGACAGGAGAATAAGTAGGG - Intergenic
1068599797 10:58944642-58944664 CAGAAACAGAAGGAAGAGTATGG - Intergenic
1070388548 10:75948933-75948955 CAGTAACACAAGCATAAGACTGG + Intronic
1071287190 10:84159785-84159807 CATTAACAGATGAATAGATAAGG + Intergenic
1071664399 10:87540163-87540185 CTTTAACAGAAGAATAAGCTGGG - Intronic
1072184301 10:93020495-93020517 CAGAAACAGAAGAAAAACAATGG - Intronic
1072209668 10:93234915-93234937 CAGGAACAGAATATTAAGGATGG - Intergenic
1073557836 10:104470370-104470392 CAGAAAAAGAAGAACAAGTTGGG - Intergenic
1073567304 10:104546112-104546134 CAGAAACTGAAGAAAAAGTATGG - Intergenic
1074519723 10:114208118-114208140 GAGAAACTGAAAAATAAGTAGGG + Intronic
1075388279 10:122073514-122073536 CATTAAAAGAAGAATTGGTAAGG - Intronic
1079815807 11:25056504-25056526 GAGTAACAGAAGAGAAAGCATGG + Intronic
1080999293 11:37648017-37648039 CAGTAAGAGAAGAGTGGGTAAGG + Intergenic
1081243218 11:40732200-40732222 CATTATCAGAAAAAAAAGTATGG + Intronic
1081298328 11:41419652-41419674 AAGTACTAGAAGAATAATTAGGG - Intronic
1081407522 11:42715241-42715263 AAATAAAAGAAAAATAAGTAGGG + Intergenic
1082250208 11:49970263-49970285 CATATACAGAAGAATAAATATGG + Intergenic
1082887943 11:58108333-58108355 CAGTAACAGAAGAATAAGTAAGG + Intronic
1083482024 11:62955360-62955382 CACTACCATAAGAAAAAGTATGG + Intronic
1084511955 11:69611614-69611636 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1086129760 11:83389228-83389250 CAAGAACTGAAGAATAAATAAGG + Intergenic
1086533293 11:87812304-87812326 CAGTAACAGAAGAGTAAAGTTGG - Intergenic
1086626716 11:88964340-88964362 GAGTAACAGTAGAATAGGCAGGG + Intronic
1087627901 11:100617956-100617978 GGGTAAAAGAAGAATCAGTATGG - Intergenic
1087952840 11:104245478-104245500 CAGAAACAAAAGGATACGTATGG + Intergenic
1088678904 11:112222331-112222353 CAGGAAGAGAAGAAGAAGAAAGG - Intronic
1088686993 11:112292352-112292374 CAGAAACAAAAGAAAAAGGAAGG - Intergenic
1090886052 11:130877872-130877894 CAGTTCCAGAAGAAGAAGGAGGG - Exonic
1093020340 12:14197639-14197661 CTGGAATAGAAGAATAAGGAGGG + Intergenic
1093080163 12:14801820-14801842 TTGTAAAAGAAGAATAAGAAGGG + Intronic
1093767428 12:22981238-22981260 CAGTCACAGAAGTATAAATGTGG - Intergenic
1094034339 12:26051044-26051066 CAGAAACTAAAGAATAAATAAGG - Intronic
1094660368 12:32464577-32464599 TAATAATAGAAGAATAAGAATGG + Intronic
1095373853 12:41502818-41502840 AAGAAATAGAATAATAAGTAAGG + Intronic
1096439456 12:51627679-51627701 CAGAAACAGAAGAAAAAAGAGGG - Intronic
1097512310 12:60558954-60558976 CAGTAACAGAAAACCAAATATGG - Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1097616587 12:61891344-61891366 CAGAATCAGAAGAAAAAGAAGGG + Intronic
1097897328 12:64838365-64838387 CAAAAACAGAAGAAAAAGAAAGG - Intronic
1098095338 12:66948614-66948636 CAGGAACAGAGGAATAAATATGG + Intergenic
1098432625 12:70436398-70436420 CAGTAAAAGAAAAAAACGTAAGG + Intergenic
1098476979 12:70916302-70916324 TAGAAACAGAAGGATAAATATGG + Intronic
1098586656 12:72162421-72162443 CAGTCACATCAGAATTAGTATGG + Intronic
1099004526 12:77220213-77220235 CAGCAAGAGAAAAGTAAGTATGG + Intergenic
1099065688 12:77975731-77975753 AAGAAACATAAGAATAAGTATGG + Intronic
1099222618 12:79933904-79933926 TAGAAAGAGAAGAATAAATAGGG - Intronic
1099385892 12:82012720-82012742 GAGTAACAGAAGAATTAGAGAGG + Intergenic
1099692542 12:85977196-85977218 CATTCCCAGAAGAATATGTAAGG + Exonic
1099810566 12:87577250-87577272 CAGAAAAAGAAGACTAAGCAAGG + Intergenic
1100818514 12:98408920-98408942 AAGAAACAGAAGAACAAGGATGG + Intergenic
1104422647 12:128649984-128650006 CAGTAACAGACCAATAATTCTGG - Intronic
1104516846 12:129435062-129435084 CAGGAACAGAAGGACAAATACGG - Intronic
1105272516 13:18891703-18891725 CAGTTCCAGAAGAAGAAGGAGGG - Intergenic
1105336969 13:19481079-19481101 TATTTACAAAAGAATAAGTATGG + Intronic
1105822831 13:24095307-24095329 CAGTCACAAAAGGACAAGTACGG + Intronic
1107025757 13:35799628-35799650 GAGTATCAGAAGAATAACTCGGG + Intronic
1108133917 13:47334399-47334421 TAGTTACAGAAGTATAAGCAGGG - Intergenic
1108735153 13:53276020-53276042 CTGTAAGAATAGAATAAGTAGGG + Intergenic
1109074932 13:57822694-57822716 CAGTTACAGAAGAATGAGTGTGG + Intergenic
1109298804 13:60568460-60568482 CAGAATCAAAAGAATATGTAAGG + Intronic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109357559 13:61250085-61250107 AAATAACAGAAGAAAAACTAAGG + Intergenic
1109620880 13:64903044-64903066 CAGTAAAAAAAGAATAAAGAAGG + Intergenic
1110400493 13:75084651-75084673 CAGTAACAGAAGGAAATTTAGGG + Intergenic
1111183867 13:84703104-84703126 GAGTAACAGAAGAATGAACAAGG - Intergenic
1111211505 13:85085491-85085513 CTGGAACAGAGAAATAAGTAGGG - Intergenic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1114428666 14:22641781-22641803 CAGAAACAGAGGAAAAATTAAGG + Intergenic
1116245480 14:42406369-42406391 CATTAACATACAAATAAGTAGGG + Intergenic
1116416187 14:44680565-44680587 CAGAGACAGAAGGATGAGTAAGG - Intergenic
1120801436 14:88693152-88693174 CTTTAACAGAAGAAAAAGTCTGG + Intronic
1122184839 14:99983875-99983897 CAGTTACAGAAGAGGAAATATGG - Intronic
1122188009 14:100016691-100016713 CAGAAACAGAAACATAAGTGAGG - Intronic
1126790209 15:52214109-52214131 CAGTGACAGAAGCAGAAGGAGGG + Intronic
1127560398 15:60130677-60130699 CAGAAACAGAATAAGCAGTAGGG + Intergenic
1127636870 15:60879336-60879358 CAGTAACATGAGAATAATTATGG + Intronic
1127729894 15:61790035-61790057 CATTCACAGAAGAATCAGCAGGG - Intergenic
1128283643 15:66417941-66417963 CTTTAACAGAACCATAAGTACGG - Intronic
1130351090 15:83092374-83092396 GAGAAACAGCAGAATTAGTAAGG + Intergenic
1131607824 15:93927524-93927546 CAGTAACAGAAGGACAAATACGG - Intergenic
1132308863 15:100841284-100841306 AAGTAACAGATAAATAAGTGAGG + Intergenic
1133489284 16:6251337-6251359 CTGTAACAGGAGAATAATAATGG - Intronic
1133958092 16:10464801-10464823 CAGCAACAAAAGAATGAGTAGGG - Intronic
1134469488 16:14510821-14510843 GCGTAACAGAAGAGTAAGTTTGG - Intronic
1135472622 16:22745026-22745048 CAGTAACAGAAAACCCAGTAGGG - Intergenic
1136076604 16:27821529-27821551 CAGAAACAGAAAAAGAAATATGG - Intronic
1137827770 16:51514336-51514358 CCATCACAGAAGATTAAGTAGGG + Intergenic
1137927998 16:52559826-52559848 AAATTACAAAAGAATAAGTAGGG - Intergenic
1138213989 16:55186986-55187008 CAAAAACTGAAGAATAAGCAGGG + Intergenic
1138403626 16:56770148-56770170 CAGGAAGAGAAGACTAAGCAGGG + Intronic
1139033742 16:62917569-62917591 AAGAAACAGAAGAGGAAGTAGGG + Intergenic
1140002036 16:71035855-71035877 CAGTAAGAGAAGAAAGAGAAAGG + Intronic
1140597830 16:76436880-76436902 CAGGAACAGAATATTAAGGATGG - Intronic
1140603676 16:76508085-76508107 CAGGAACACAAGAATAAATGAGG - Intronic
1147125839 17:38367672-38367694 AAGTAACAGAATAATAATTCTGG - Intronic
1149021858 17:51976863-51976885 CAGTATCAGAAGCAAAAGAAGGG + Intronic
1149171499 17:53817197-53817219 CAGTAACATAAGAATAACCTGGG + Intergenic
1149677945 17:58483389-58483411 CCTTAACAGAAGAATAAATAAGG - Intronic
1150912489 17:69403022-69403044 CAGAACCAAAAGAATAAATAAGG + Intergenic
1151027284 17:70693319-70693341 GAGGAACAGAAAAATAACTATGG - Intergenic
1153589990 18:6663697-6663719 CAGAAACAGAAGAAGAAAAAAGG - Intergenic
1154464295 18:14629285-14629307 CAGTTCCAGAAGAAGAAGGAGGG - Intergenic
1154999645 18:21673967-21673989 CTGCAACAAGAGAATAAGTAGGG + Intronic
1155985590 18:32227431-32227453 TAGTGACAGAAGAATAATTGTGG + Intronic
1156123681 18:33877116-33877138 AAGTAACAGATTAATCAGTATGG - Intronic
1156221553 18:35057692-35057714 GAGTACCAGAAGAATAGGGAAGG + Intronic
1156235530 18:35200036-35200058 AAGTAACAGAAGAATAAACCTGG + Intergenic
1156285576 18:35691773-35691795 CAGTAACTAAAAAATAAGGATGG - Intronic
1156865128 18:41880513-41880535 CAGGAACAAAAGAATGAGAAAGG - Intergenic
1157151248 18:45220961-45220983 CCTTAACAGAAGAAGAAGTTTGG - Intronic
1157489816 18:48115168-48115190 CAGTCACAAAAGAACAAATATGG - Intronic
1157666931 18:49495162-49495184 CAGCAACAGAAAAAGAAGAAAGG - Intergenic
1159265382 18:66072831-66072853 CAGAAACAGAAGGAGAAGCAAGG + Intergenic
1160111940 18:76041346-76041368 CAGTAAGAGCAGAATTAATATGG + Intergenic
1161350372 19:3787779-3787801 GGGTAACAGAAGATTAAATATGG - Intronic
1162056382 19:8066460-8066482 CAGAAACAGAAGACCAAATACGG + Intronic
1163427780 19:17248455-17248477 CAGAAACAGAACAAGAAGTATGG - Intronic
1166583921 19:43928511-43928533 CAGTTACAGAAGATCAAGGATGG + Intronic
925218619 2:2119654-2119676 TAGCAAGGGAAGAATAAGTAAGG - Intronic
925819593 2:7786990-7787012 CAGTAACAAAAGAGTAGGTAGGG + Intergenic
929132119 2:38586934-38586956 CAGGAAATGAAGAATAAGAAAGG + Intronic
929721438 2:44372792-44372814 CAGTAACAGAAGGCAAAGAAAGG + Exonic
930225921 2:48793026-48793048 GAATAACAGCAGAATCAGTATGG - Intergenic
930970483 2:57389186-57389208 CATCAACAGATGAATAAATAAGG + Intergenic
932035244 2:68239040-68239062 AAGTAACAGAAAAAGATGTAAGG + Intronic
932145851 2:69316030-69316052 AAGTAACAGAAGAAAAAAAATGG - Intergenic
932361841 2:71115479-71115501 CACTAACAGAAGGATAAATATGG - Intronic
933229394 2:79788844-79788866 CATTTACAGGAGACTAAGTATGG - Intronic
933371803 2:81424318-81424340 GAGTAAAGGAAGAATCAGTAAGG - Intergenic
933642565 2:84779396-84779418 CAGTAACAAAGGACAAAGTAGGG - Intronic
933819944 2:86101883-86101905 CAGTCACAAAAGGACAAGTACGG - Intronic
934677867 2:96262487-96262509 CTATCACAGAAGAATCAGTAAGG - Intronic
936837622 2:116727087-116727109 CAGTAAGAGAAGAAAAGGGAAGG + Intergenic
937344715 2:121118249-121118271 CAGTTACAGAGCAGTAAGTATGG + Intergenic
937786292 2:125903421-125903443 CAGTGAAAGAAGAGGAAGTAAGG + Intergenic
940148832 2:150577216-150577238 AAGAAAAAGAAAAATAAGTAGGG + Intergenic
942181611 2:173385882-173385904 AAGAAACAGATGCATAAGTAGGG + Intergenic
942982911 2:182103921-182103943 CAGTAACAGGAGAATCACTGAGG + Intronic
943289205 2:186046898-186046920 CAATAACAGAAGTATATGTAGGG - Intergenic
943438543 2:187897869-187897891 CACTAACAAAAGATTAAATATGG - Intergenic
943586405 2:189746009-189746031 TAGTAACATAAGAAAAAATAAGG + Intronic
944291286 2:198008588-198008610 CATCAACAGATGAATAAGTAAGG - Intronic
944619282 2:201497338-201497360 AAGGAACAAAAGAATAGGTATGG - Intronic
945165628 2:206940323-206940345 CAGTAACTGAGGAAAATGTAAGG + Intronic
945531706 2:210962573-210962595 CAGAAACATAAAAATGAGTAAGG - Intergenic
945787120 2:214254661-214254683 TAGAAACAAAAGATTAAGTAAGG - Intronic
946110964 2:217416757-217416779 CAGTCACTAAAGAAAAAGTATGG + Intronic
948819470 2:240532510-240532532 CAGAAACACAAGAAGGAGTAAGG + Intronic
1168969930 20:1924069-1924091 CAGTAACAGAAGAAGCAGCCAGG + Intronic
1171060837 20:21957530-21957552 GAGTAACAGAAGAAGATGTCTGG - Intergenic
1171341938 20:24436590-24436612 TAGTAACAGAAGTATAAAGAAGG - Intergenic
1173079576 20:39852871-39852893 CAGTGACAGAAGCATAATTTTGG + Intergenic
1174419034 20:50387460-50387482 CAGAAACAGATGAAAAAATACGG - Intergenic
1174778365 20:53366057-53366079 CAGTGTCAGAAGAAAAAGAAGGG + Intronic
1175241436 20:57552421-57552443 CAGTAACAGCATCAGAAGTAAGG - Intergenic
1175531744 20:59678067-59678089 CAGGAACAGAAGAAAATGTATGG - Intronic
1176424287 21:6538434-6538456 CAGTCACAGACGCACAAGTACGG + Intergenic
1176736591 21:10554091-10554113 TATTTACAAAAGAATAAGTATGG - Intronic
1176810242 21:13529104-13529126 CAGTTCCAGAAGAAGAAGGAGGG + Intergenic
1178112103 21:29378897-29378919 CAGTAACTGACCAATCAGTATGG + Intronic
1178268090 21:31163918-31163940 TAGAAAAAGATGAATAAGTATGG + Intronic
1178303947 21:31474849-31474871 CAGGAACTGAAGAATAATAAAGG - Intronic
1178428905 21:32502098-32502120 AAGAAAAAGAAGAAAAAGTAAGG - Intronic
1179699780 21:43146749-43146771 CAGTCACAGACGCACAAGTACGG + Intergenic
1180570096 22:16706943-16706965 TAGAAACAGAAGAAAAATTATGG + Intergenic
1180587129 22:16902745-16902767 CAGGAACAGAATATTAAGTTTGG - Intergenic
1181377507 22:22471701-22471723 TAGAAAAAGAAGAGTAAGTATGG + Intergenic
1182128138 22:27831215-27831237 CAGACACAGAAAGATAAGTACGG + Intergenic
1182230985 22:28837376-28837398 CAGGAACAGAAGTATATGGAAGG - Intergenic
1182847365 22:33442666-33442688 AAGTAAAAGAAGAACAAGTATGG - Intronic
1182909378 22:33968648-33968670 CATTTACAGATGAATAAATAGGG + Intergenic
1183532545 22:38368582-38368604 TATTTACAAAAGAATAAGTATGG + Intronic
1183822125 22:40354902-40354924 CAATAATAAGAGAATAAGTAAGG + Intronic
949905284 3:8853643-8853665 CAGCAACAGAAAAATAATTCGGG + Intronic
952073262 3:29665219-29665241 AAGTAACAGTAAAATTAGTAAGG - Intronic
953172270 3:40517939-40517961 GACAAACTGAAGAATAAGTAGGG - Exonic
955462538 3:59200234-59200256 CATTAACAGAGGAATGTGTAAGG - Intergenic
955755413 3:62220528-62220550 CTGGAACAGAAGAATAAGGAAGG + Intronic
957108477 3:75922846-75922868 TAGAAACAGAAGAAAAATTATGG - Intronic
958458058 3:94358223-94358245 CAGAAAGAGAAGAATAAGGAGGG - Intergenic
958813013 3:98884298-98884320 CAGTAACACAAAAATATATAAGG + Intronic
959490682 3:106984931-106984953 CAGGAAGAGAAAAATAAGTTAGG - Intergenic
959633624 3:108536678-108536700 CAGTGACAAAAGAGTAAGTGGGG + Intergenic
959733521 3:109631218-109631240 CAGTAACTAAAGAACAAATAAGG + Intergenic
960971767 3:123144982-123145004 AATTCACAGAAGCATAAGTATGG - Intronic
962153318 3:132916347-132916369 GAATAACAGAAGAAGAAGAAAGG - Intergenic
964177654 3:153844285-153844307 CAGTAAGAGAAGATAAAGGAAGG + Intergenic
964531273 3:157670771-157670793 AAGAAACAAAAGAAGAAGTAAGG - Intronic
965164686 3:165181775-165181797 CAGAAACAGAAGTAGAAGCAGGG + Intergenic
965857546 3:173106415-173106437 CTGTAACTAAAGAATAAATAAGG + Intronic
966690961 3:182740942-182740964 CTGTAACAGTAGAATGAGCAAGG - Intergenic
967086182 3:186097235-186097257 CAGTACCAGAAGTTTGAGTACGG + Intronic
967646972 3:191936982-191937004 AAGTAACAGGAGAAAAAATAAGG + Intergenic
970710465 4:18856146-18856168 CAGTAGTAGATGAAGAAGTAAGG + Intergenic
970821321 4:20218543-20218565 CAGTAACATATGAATGAATAAGG - Intergenic
971741558 4:30527571-30527593 CAGTAACAGCAGAATATGACTGG + Intergenic
972205958 4:36773175-36773197 CATTAGCAGAAGAACAATTAGGG - Intergenic
972885315 4:43478143-43478165 CCTAAACAGAAAAATAAGTAAGG - Intergenic
973064479 4:45771301-45771323 CAGTAATAGACAAAAAAGTAGGG + Intergenic
973999928 4:56501820-56501842 CAGCAACAGAAAAAGAAGAAAGG + Exonic
974382189 4:61155159-61155181 CAGTAAAAGAACAAAAAGAAAGG + Intergenic
974479877 4:62429519-62429541 CAATAACAGCAGCATTAGTAGGG + Intergenic
974579977 4:63784868-63784890 CAGTAACTGAAGAATTCATATGG + Intergenic
975115749 4:70678726-70678748 CAGGGACACAATAATAAGTAAGG + Intronic
976295675 4:83468878-83468900 CAGTAACAGGAGTATGAGGAAGG + Intronic
976320919 4:83714287-83714309 CAGAAAGAGAAGAAAAGGTAGGG + Intergenic
976545892 4:86335533-86335555 GAGTAAGAGAAGAAGAAGAAGGG - Intronic
979099418 4:116597371-116597393 GAGTAATTGAAGAATAACTAGGG - Intergenic
979103193 4:116649487-116649509 GAGAAACAGAATATTAAGTATGG + Intergenic
979786612 4:124722761-124722783 CAGAAACAGAAAATAAAGTATGG + Intergenic
980154274 4:129085758-129085780 CAGGAACAGAAAACCAAGTACGG + Intronic
980957311 4:139442864-139442886 CAGGAACAGAATATTAAGGATGG + Intergenic
981005274 4:139867950-139867972 CAATTCCAGAAGAATAATTATGG - Intronic
981854793 4:149275566-149275588 CAGTAACAGAAGATGAAACATGG - Intergenic
982849379 4:160293465-160293487 CACTATCAGGAGAATAAGCATGG + Intergenic
983390026 4:167118345-167118367 CAGTAACCGAAAGAAAAGTAAGG - Intronic
983461005 4:168026264-168026286 AAGTAAAAGCAGCATAAGTAAGG + Intergenic
983530012 4:168800867-168800889 CATCAACAGTAGAACAAGTAAGG + Intronic
983942051 4:173544403-173544425 GAGTAACATAAGAAGAAGCAAGG + Intergenic
984419767 4:179506010-179506032 CAATAAGAGAAGAATATGCAAGG - Intergenic
986937497 5:12907618-12907640 CAGTAGCAGAACAATAAATGTGG - Intergenic
987363291 5:17125859-17125881 CAGTAATACAAAAATAAATAAGG - Intronic
987509180 5:18814331-18814353 CAGTATCAGAAGAATAGCTCAGG + Intergenic
988017436 5:25577413-25577435 GAGGAACAGAAAAATAAATATGG - Intergenic
988169574 5:27636072-27636094 GAGCAACAGAAGAGTAAGAATGG - Intergenic
988264769 5:28933782-28933804 CAATAGCAGAAGAATCATTAAGG + Intergenic
989424070 5:41275381-41275403 GTGTCACAGAAGAATAAGCAGGG - Intergenic
989592449 5:43124226-43124248 CAGTAGCAGAAGAAAAAGCATGG - Intronic
989948500 5:50268930-50268952 CAGTAACAGAAGAAGAAGAAAGG + Intergenic
990213450 5:53505517-53505539 AAGGAACAAAAGAATATGTAGGG + Intergenic
990454922 5:55975696-55975718 AACTAAGAGAAGAATCAGTAGGG + Intronic
992028569 5:72696808-72696830 GTGTAAAAGATGAATAAGTAAGG + Intergenic
992252845 5:74892894-74892916 GAGTAAAAGAAGAATAATTCTGG - Intergenic
992332827 5:75735089-75735111 CAGTGACACAAGAATGAGGACGG - Intergenic
992370829 5:76142556-76142578 CAGTAACAGATGGCTAAGCAAGG - Intronic
992469378 5:77041622-77041644 CAATAGAAGAAGAATATGTAGGG + Intronic
993159800 5:84275177-84275199 GCTTAACAGAAGAATAACTATGG - Intronic
993765390 5:91849932-91849954 CAATGACAGAAGGATAAGAAAGG - Intergenic
993862651 5:93155370-93155392 CAATAAGAAAAGAATAAGAAAGG + Intergenic
994251663 5:97542987-97543009 AAGTTACAGATGAAGAAGTAAGG + Intergenic
994435373 5:99723659-99723681 TAGTAACAGAAGATGAAATATGG + Intergenic
995788901 5:115862076-115862098 CAGTCACAGAAGGATAATTACGG - Intronic
997126647 5:131233854-131233876 CAATAAAAGCAGAAAAAGTATGG - Intergenic
998153931 5:139773582-139773604 CAGTCACAGAAGGACAAATATGG - Intergenic
998787098 5:145724530-145724552 GAATAACAAAAGTATAAGTATGG - Intronic
1000828252 5:166072966-166072988 CAATAAAAGAAGAAAAAGAAAGG + Intergenic
1000923696 5:167168617-167168639 CAGTAACTGTAAAATAAGTCTGG - Intergenic
1001005328 5:168044773-168044795 CAGTAGCAGAATAAGAAATAGGG + Intronic
1001743462 5:174072007-174072029 CACTAACAGGAGAAGAAGCAGGG + Intronic
1003305930 6:4928761-4928783 CAGAAACAGAAAAAAAAGCAAGG - Intronic
1003751257 6:9059576-9059598 CAACAACAGAAGCATCAGTATGG - Intergenic
1003933331 6:10950324-10950346 AAGGGTCAGAAGAATAAGTACGG - Intronic
1004554521 6:16682565-16682587 CACTAATAGAAGAAAAAGAAAGG + Intronic
1005370366 6:25125813-25125835 CTGTAACAGAAGATTAAACATGG + Intergenic
1006343983 6:33465089-33465111 CATTAACAGATGAATATTTAGGG - Intergenic
1006978033 6:38122060-38122082 CAGTAACAGATAAATAAATGGGG - Intronic
1008757220 6:54810667-54810689 CAGTCACAAAAGAACAAATATGG - Intergenic
1009568544 6:65348116-65348138 CACCAACAGATGAATGAGTAAGG - Intronic
1010118866 6:72349301-72349323 AATTAAGAGAAAAATAAGTATGG - Intronic
1010484198 6:76390372-76390394 CAGTAACAACAGAATAAGAATGG - Intergenic
1010977161 6:82328811-82328833 CAGTAACTGAAGAATAGTTGTGG + Intergenic
1011233152 6:85186758-85186780 CAGTAGCATAAAAATCAGTAAGG + Intergenic
1011898998 6:92268800-92268822 CAGGAACAGAACAATGATTACGG + Intergenic
1013948911 6:115755597-115755619 CAGCAACAGAAATACAAGTATGG + Intergenic
1014256507 6:119165452-119165474 CACTAACAGAACAAAAAGGAAGG + Intergenic
1015355319 6:132271148-132271170 CAGGAACACAGGAATAAGAAAGG - Intergenic
1017748726 6:157470275-157470297 CAAAAACAGGAGAATAATTAAGG + Intronic
1017843003 6:158237355-158237377 CAGCAACAGAAAAAGAAGAAAGG - Intronic
1017974492 6:159344437-159344459 CATCAACAGATGAATAAATAAGG + Intergenic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1020177548 7:5895154-5895176 CAGTAACAGTAGAGTAACCAGGG - Intergenic
1020827139 7:13043211-13043233 TAGTAACATTAGTATAAGTAAGG - Intergenic
1020889370 7:13859617-13859639 CAGTAATAGAAGAGAAAGTGGGG - Intergenic
1021252096 7:18342278-18342300 CAGAAACCGAAGAATAAGTGAGG - Intronic
1021860846 7:24904743-24904765 CAGTCACAGAAGGACAAATACGG + Intronic
1022273197 7:28830323-28830345 CAATAAAACAAGAATTAGTAGGG - Intergenic
1022544156 7:31169765-31169787 TAGTTGCAGAAGAATAAGTCAGG - Intergenic
1023456138 7:40340591-40340613 AAGTAAAAGAAGCAAAAGTAGGG + Intronic
1023774512 7:43591665-43591687 GAGCAACAGATGAATAAGTATGG + Intronic
1024864643 7:53891258-53891280 CAGTGACAAAAGGATAAATAGGG + Intergenic
1025062396 7:55821652-55821674 CATCAACAGAAGAATAGGTAAGG - Intronic
1025251979 7:57357541-57357563 CAGAAACAGATGAAAAAATACGG + Intergenic
1025618026 7:63141101-63141123 CATCAACAGAAGAATAGGTAAGG - Intergenic
1026070997 7:67119489-67119511 CAGTAACCGAAGACTCAGAAGGG - Intronic
1026705904 7:72692809-72692831 CAGTAACCGAAGACTCAGAAGGG + Intronic
1028509313 7:91605459-91605481 CTGTAACAGAAGATGAAGCATGG - Intergenic
1028855551 7:95588624-95588646 CAGTAACATTAGAATAAGTTAGG + Intronic
1029081291 7:97975847-97975869 CAGTAACAGTAGAGTAACCATGG + Intergenic
1029923596 7:104292402-104292424 CAGGAGCAGGAGAATAAGGAGGG - Intergenic
1030043744 7:105475939-105475961 CAGTAACAAAAGAACAAATATGG - Intronic
1030512458 7:110500467-110500489 CAGTAACAAAAAGATAAATATGG - Intergenic
1030955931 7:115852184-115852206 CAGAAACAGAAGAAAAAATAGGG + Intergenic
1031629165 7:124025479-124025501 CAGAAACAAAAGAATAATTAAGG - Intergenic
1032955244 7:136962826-136962848 CACTCACAGAAAAATAATTAAGG + Intronic
1033798620 7:144875941-144875963 CAGGAACAGAAAAACAAATATGG - Intergenic
1034063415 7:148113865-148113887 CAGTAACAGAATAATGAGGCAGG - Intronic
1035143594 7:156789164-156789186 CACTAACAGTAGAAAAAGTTAGG - Intronic
1036170816 8:6482593-6482615 AAGTCCCAGAAGAATAAGTTGGG - Intronic
1036393749 8:8348725-8348747 CAGTTACAGAAGGATGAGAAGGG - Intronic
1037084935 8:14836800-14836822 CATTAAGAGAAAAATAATTATGG - Intronic
1037356661 8:18027463-18027485 CAGTAAAAAAAGAATAGGTGAGG - Intronic
1039023233 8:33229964-33229986 AAATAAAAGAAGAAGAAGTAGGG + Intergenic
1039329188 8:36518070-36518092 CAATCACAGAAGAGCAAGTAAGG + Intergenic
1040790081 8:51218215-51218237 CAGTAAAAGAAGACAAAGAAGGG + Intergenic
1040969854 8:53123912-53123934 CAGTCAGAGAAGAACAAATATGG - Intergenic
1041220219 8:55643479-55643501 CAGTAACAAAAAAAAAAGCATGG - Intergenic
1041328103 8:56691049-56691071 AAGTAGAAGAATAATAAGTATGG + Intergenic
1042398779 8:68321558-68321580 CAGTAAAAGAAGAATGAGTGTGG + Intronic
1042953739 8:74226540-74226562 CACTATCACAAGAATAAGCATGG + Intergenic
1043417500 8:80066118-80066140 CAGACACAGAAGAAAAAGGAAGG + Intronic
1043531091 8:81150810-81150832 CAGTAACAGCTGAATAAGGTGGG - Intergenic
1043630615 8:82326889-82326911 CAATAACAGAAGAATAAACGTGG - Intergenic
1044071466 8:87765828-87765850 CAGTTCCAGAAGGAAAAGTAAGG - Intergenic
1044334220 8:90959246-90959268 CAGAAACAGAAGAACAGGTTTGG - Exonic
1044560989 8:93612012-93612034 CAGTAACACAACAAGTAGTAAGG - Intergenic
1044655832 8:94547443-94547465 CAGGGATAGAAGAATAAGGAAGG - Intronic
1045142076 8:99297765-99297787 CAGGTACAGAAGAAAATGTATGG - Intronic
1045367055 8:101486070-101486092 CAGTGATAGAAGAGTAAGGAAGG - Intergenic
1045622859 8:104003090-104003112 AAGTACTAGAAAAATAAGTAGGG - Intronic
1045919727 8:107515153-107515175 CAGTTTCAGAAGAATAATAAGGG + Intergenic
1046160890 8:110362842-110362864 CAGTAACAGACAAACAAGCAAGG - Intergenic
1046452000 8:114405675-114405697 CAGGCACAGAAGGATAACTATGG + Intergenic
1046586183 8:116150874-116150896 GAGGAACAGAATACTAAGTATGG - Intergenic
1047018907 8:120753632-120753654 CAGTAAGGGGAGAATAAGCAAGG + Intronic
1047871397 8:129086489-129086511 TAGAAACAGAAGAAAAAGAAAGG + Intergenic
1048915636 8:139180315-139180337 CAACAACAGATGAATAAATATGG - Intergenic
1048916614 8:139190185-139190207 CAGGAGCAAAAGAACAAGTATGG + Intergenic
1050631622 9:7565024-7565046 CAGTAATAAAAGAATAATAATGG - Intergenic
1050739629 9:8804978-8805000 CTGTAACAGAGGAAAAAGAAGGG + Intronic
1051177511 9:14375815-14375837 TAATAACAGAAGAGCAAGTATGG + Intronic
1051231416 9:14959200-14959222 CAATCACAGAAGAAACAGTATGG + Intergenic
1051516713 9:17937922-17937944 AAGTAACAGAAGTATGAGGAGGG + Intergenic
1051676575 9:19564277-19564299 CACTAAGTGAAGAATGAGTAGGG - Intronic
1051677133 9:19569827-19569849 CAGAAACAGAAAAATCAGTATGG - Intronic
1052469176 9:28871898-28871920 AAGTAACAGAAGATAAAATAAGG - Intergenic
1055678330 9:78688891-78688913 AATAAACAGAAGAATAAGTCTGG - Intergenic
1055801742 9:80044855-80044877 GAGTATCAGAAGAATGAGTGTGG - Intergenic
1056115820 9:83440407-83440429 AAGTGACAGAAGAAGAATTAGGG - Intronic
1056940005 9:90946957-90946979 CATTACCAGAAGCAGAAGTATGG - Intergenic
1058231462 9:102431557-102431579 CACAAACAGAAGAATAAAAATGG - Intergenic
1060136250 9:121157868-121157890 AACTGACAGAAGAGTAAGTAAGG + Exonic
1060532892 9:124358714-124358736 CGGGAACAGGGGAATAAGTATGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1061570116 9:131472829-131472851 CAGAAAGAGAAGAATAAGAATGG - Intronic
1061577570 9:131516981-131517003 CAGTAACAGAAGACTTTTTATGG - Intronic
1061786868 9:133034299-133034321 CAGTCAAACAAGTATAAGTATGG - Intronic
1186545001 X:10440258-10440280 GAGAAACAGAAGAAGAAGAAAGG - Intergenic
1187796519 X:23009625-23009647 AAGTAAAAGATGAATAAATATGG + Intergenic
1188011819 X:25064404-25064426 CAGTAACCAAATAATAAATAAGG - Intergenic
1188590776 X:31831999-31832021 CAATAACACCAGAATAAGTTGGG - Intronic
1188732470 X:33667653-33667675 AAGTAACAGAAAAATAAGGATGG - Intergenic
1191169531 X:57428684-57428706 CATACACAGAAGAATAAATATGG + Intronic
1192131001 X:68549933-68549955 CAGAAACAGAAAAACAAATATGG + Intergenic
1193233898 X:79083348-79083370 CAGAAACAAAAGGATAAGTGGGG - Intergenic
1193251326 X:79294069-79294091 CAGAAACAGAAAAAAAAGAAAGG + Intergenic
1193495363 X:82204437-82204459 CAGGAACAGAAAACTAAATACGG - Intergenic
1194174686 X:90631063-90631085 GAGGAACAGAATATTAAGTATGG + Intergenic
1194617106 X:96118533-96118555 GAGTAAAAAAAGACTAAGTAGGG + Intergenic
1194706611 X:97182542-97182564 CAGTAACCTAATAATAAGTGGGG - Intronic
1194915182 X:99698124-99698146 CAGTAACAGAAGATTAGTTCTGG - Intergenic
1195011970 X:100741432-100741454 CAGAAGCAGTAGAACAAGTAGGG + Intergenic
1195165570 X:102216082-102216104 GACTAACAGAAGGATTAGTAAGG - Intronic
1195193288 X:102471009-102471031 GACTAACAGAAGGATTAGTAAGG + Intronic
1196719298 X:118839186-118839208 CAAAAACAGAAGAATAAGGCAGG - Intergenic
1197793312 X:130277086-130277108 CAGTGACAGGAGAAAAGGTAAGG + Intergenic
1200520898 Y:4208783-4208805 GAGGAACAGAATATTAAGTATGG + Intergenic
1201530011 Y:14981213-14981235 GAGTAACAGAATATTAAGAATGG - Intergenic
1201618015 Y:15923351-15923373 CAGGAACAGAAAATCAAGTATGG - Intergenic
1201694614 Y:16811294-16811316 CAAAAACAAAAGAAAAAGTAAGG - Intergenic
1201886680 Y:18891764-18891786 CAGTAGTAGAAAAATAAGTCAGG - Intergenic
1201983737 Y:19938302-19938324 AAATAACAGAAAAATAAATAAGG + Intergenic
1202098894 Y:21284790-21284812 CAGTCACAGATGAATAAATAAGG - Intergenic
1202306126 Y:23472812-23472834 TAGTAACAGAGGAATAACCAAGG - Intergenic
1202564683 Y:26197777-26197799 TAGTAACAGAGGAATAACCAAGG + Intergenic
1202594860 Y:26527286-26527308 TATTTACAAAAGAATAAGTATGG - Intergenic