ID: 1082888877

View in Genome Browser
Species Human (GRCh38)
Location 11:58117340-58117362
Sequence ATACAGCAGTAGACAAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082888877_1082888882 29 Left 1082888877 11:58117340-58117362 CCATCCCTTGTCTACTGCTGTAT 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1082888882 11:58117392-58117414 GTACTTCCTTAATTGCAAAATGG 0: 1
1: 0
2: 0
3: 25
4: 270
1082888877_1082888881 4 Left 1082888877 11:58117340-58117362 CCATCCCTTGTCTACTGCTGTAT 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1082888881 11:58117367-58117389 CGAGTACTCTTTGACTCATGAGG 0: 1
1: 0
2: 1
3: 2
4: 52
1082888877_1082888883 30 Left 1082888877 11:58117340-58117362 CCATCCCTTGTCTACTGCTGTAT 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1082888883 11:58117393-58117415 TACTTCCTTAATTGCAAAATGGG 0: 1
1: 0
2: 3
3: 52
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082888877 Original CRISPR ATACAGCAGTAGACAAGGGA TGG (reversed) Intronic
900870901 1:5302072-5302094 AGAAAGAAGTAGAGAAGGGAAGG + Intergenic
901320326 1:8335988-8336010 AAACAGCAATAGACACGGGCAGG - Intronic
903024464 1:20417652-20417674 ATACGGCAGAAGGCAAGGGCTGG - Intergenic
904691436 1:32296113-32296135 ATACAGAGGTAGACAAGGCACGG - Intronic
905187690 1:36208359-36208381 CTAAAGCAGTAGTCAAGGGTGGG + Intergenic
905500867 1:38435250-38435272 ATATAGCATTAAACAAAGGATGG + Intergenic
905756106 1:40510442-40510464 ATAAAACAGTACACTAGGGATGG - Intronic
908380213 1:63590961-63590983 ATACAGCAGTAGAAAAGTACGGG + Intronic
910492978 1:87793687-87793709 ATACAGCTGTGGACAGGGGAAGG - Intergenic
911223057 1:95271434-95271456 ATACACCAAAAGAGAAGGGATGG + Intergenic
911979243 1:104545272-104545294 ATACACAAGTAGTCAAGGTAAGG - Intergenic
915149179 1:153816125-153816147 AAACAGCTGTAAAGAAGGGAGGG + Intronic
916822039 1:168409290-168409312 AAACAGCAGCATAAAAGGGAAGG + Intergenic
917000539 1:170353068-170353090 ATCCAGCAGCAGACAAAGAATGG - Intergenic
918334179 1:183491283-183491305 ATTCAGCAGTAAACAAAGGAAGG - Intronic
920172941 1:204082823-204082845 ATATCTGAGTAGACAAGGGATGG + Intronic
921068178 1:211637664-211637686 GTACTGCATTAGCCAAGGGAGGG - Intergenic
922467904 1:225856935-225856957 GTAGAGTAGTAGACAATGGAGGG + Exonic
924016556 1:239731594-239731616 AGAGAACAGTAGAGAAGGGAGGG + Intronic
924324014 1:242877336-242877358 ATGCAGCAGTAGATAATGAATGG - Intergenic
1063791215 10:9450216-9450238 ACATAGCAGCATACAAGGGAAGG - Intergenic
1063953305 10:11244004-11244026 AGACAGCAGGAGACGGGGGAGGG - Intronic
1068080246 10:52310564-52310586 ATACAGCAGTAGACTGGGCGCGG + Intergenic
1068732315 10:60373291-60373313 ATACTGCCTTAGCCAAGGGACGG - Intronic
1068861889 10:61855834-61855856 ATACAGTAGGAGACTAAGGAAGG + Intergenic
1069851481 10:71408265-71408287 ATACAGAAGTAGACAAAGCATGG + Intronic
1070374174 10:75813077-75813099 GAACAGCAGCAGACAAGTGAGGG + Intronic
1071130660 10:82389593-82389615 ATATGGCAGTAGACAAACGAGGG + Intronic
1072244633 10:93532124-93532146 ATACTAAAATAGACAAGGGATGG + Intergenic
1073127071 10:101157836-101157858 ATGCAGCAGGAGATAATGGAAGG - Intergenic
1073440495 10:103549775-103549797 AGACAACACTGGACAAGGGAGGG - Intronic
1073457539 10:103646727-103646749 ATACAGCAGGAGATAAAGGCTGG + Intronic
1074921445 10:118018137-118018159 ATAAAGCAGACCACAAGGGAGGG - Intronic
1075191747 10:120315728-120315750 ATAGATCAGGAGACCAGGGATGG - Intergenic
1076011097 10:126989156-126989178 TTAGAGCAGTGGACAAGAGAAGG + Intronic
1077558130 11:3237035-3237057 ATACAGTAGAGGAAAAGGGAGGG - Intergenic
1077919292 11:6631016-6631038 CTACAGCGGTAGCCAAGGGGAGG + Intronic
1079158752 11:17973538-17973560 AGGCAGCAGTAGGGAAGGGAAGG + Intronic
1079213530 11:18485559-18485581 TTGCAGCAGAAGACAAGAGAAGG - Intronic
1082888877 11:58117340-58117362 ATACAGCAGTAGACAAGGGATGG - Intronic
1089614261 11:119686401-119686423 ATGCAGCAGTGGACTAGGGAAGG - Intronic
1091517937 12:1204379-1204401 ATGCAGGATTAGAGAAGGGAAGG - Intronic
1091786222 12:3244756-3244778 GCTCAGCAGTAGAGAAGGGAGGG + Intronic
1095218466 12:39578617-39578639 ATCAAGCAGAAGACATGGGAAGG - Intronic
1095837490 12:46654484-46654506 ATAAAGCAGGAGAAAAGGGAAGG - Intergenic
1098226509 12:68330581-68330603 ATTCAGCAGGAGACAAGATAAGG - Intronic
1098583685 12:72131844-72131866 ATACATCATTAGCCAAGGCAAGG + Intronic
1099118753 12:78661511-78661533 ATTCAGCATTAGACAAGTGGTGG + Intergenic
1100485430 12:95021356-95021378 AGACAGCAGTAGGCCAGGCACGG + Exonic
1104501861 12:129293835-129293857 ACACAGCAGAAGGCAAGTGATGG - Intronic
1106609359 13:31263759-31263781 ACACATCTGTTGACAAGGGAAGG + Intronic
1108510880 13:51154764-51154786 ATAAAGCAGTAAACAATGCATGG + Intergenic
1112458384 13:99582306-99582328 ATACAGCAATAGATCAGGCATGG + Intergenic
1112855408 13:103763502-103763524 AGAAAGAAGTAGTCAAGGGAGGG - Intergenic
1113106132 13:106773399-106773421 GTTCAGCAGCAGACAAGTGAGGG - Intergenic
1116071664 14:40054412-40054434 ATACAGCAGTAAATAAGACAAGG - Intergenic
1117567484 14:57009830-57009852 ATACTGAAGTAGAGAAGGAAAGG + Intergenic
1117603670 14:57402348-57402370 ATACAGCAACAAACAAGAGAAGG - Intronic
1121630798 14:95420554-95420576 ATACAAGTGTTGACAAGGGATGG + Intronic
1124376256 15:29130839-29130861 TAACAGCAGTAGAAAAGGGTGGG + Intronic
1125284969 15:38082648-38082670 TCACAGCAGTAAACAAGGAATGG - Intergenic
1125397430 15:39264611-39264633 ATATGGCAGTGGACAAGGCAAGG - Intergenic
1131370969 15:91881532-91881554 AAATAGCAGAAGACAAGGGAAGG - Intronic
1133562137 16:6960182-6960204 ATTTAGCAGGAGACAAGAGAAGG + Intronic
1135433711 16:22410123-22410145 ATACAGCAGCACAAAAGGCATGG - Intronic
1136919528 16:34252340-34252362 ATACTGCTGTATACAAGGAAAGG - Intergenic
1139190488 16:64857498-64857520 ATCCAGCAGCAGTCATGGGATGG - Intergenic
1139463304 16:67140101-67140123 ATAAATCAGAAGACAAGGTAGGG + Exonic
1140925134 16:79575307-79575329 AATCAGCAGTAGCCAAGGGTGGG - Intergenic
1141619190 16:85227852-85227874 ATACAGCAGTGAACAAGAGAGGG + Intergenic
1144625916 17:16844439-16844461 ATACAGCACGGGGCAAGGGAGGG - Intergenic
1144880517 17:18428281-18428303 ATACAGCACGGGGCAAGGGAGGG + Intergenic
1145151718 17:20516106-20516128 ATACAGCACGGGGCAAGGGAGGG - Intergenic
1146163089 17:30570387-30570409 ATACAGCACGGGGCAAGGGAGGG - Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147580066 17:41623137-41623159 ATACAGCACGGGGCAAGGGAGGG - Intronic
1148780643 17:50119440-50119462 AAACAGGAGCAGACAAGGCAGGG - Intronic
1150194521 17:63281802-63281824 ACACAGAAGTACACAAGGAAGGG + Intronic
1150895797 17:69209117-69209139 ATACAGAAGTAGACAAGGTTTGG + Intronic
1153516576 18:5908926-5908948 GTAGAGCAGAAGACAAGGAAAGG - Intergenic
1153638611 18:7135133-7135155 ATACTTCAGTTGAGAAGGGATGG + Intergenic
1153714211 18:7829837-7829859 ATACATAAGTAAACAAAGGAGGG - Intronic
1154437300 18:14356958-14356980 ATACAGCAGTAGACCTGGTCAGG + Intergenic
1156760337 18:40581591-40581613 ATACGGAAGTAGACAAAGGTAGG + Intergenic
1158669262 18:59460234-59460256 ATCCAGGAGGAGAGAAGGGAGGG - Intronic
1159907174 18:74104858-74104880 GTGCTGCAGTAGACATGGGATGG - Intronic
1161755361 19:6129520-6129542 ATAAAGCAGTAAACAAAAGAGGG + Intronic
1163082075 19:14951380-14951402 ATACAGGTGTAGACTAGGGCAGG + Intronic
1165370240 19:35400930-35400952 ATTCAGCGGTAGACAAGGCCTGG - Intergenic
1165708826 19:37995239-37995261 AGACAGCAAGAGACAGGGGATGG + Intronic
1167255788 19:48427769-48427791 ATACAGGAGTAGACCAAGGAGGG - Intronic
925016208 2:526037-526059 ACACAGCAGTGAACAAGGAACGG + Intergenic
925579952 2:5400266-5400288 TTACATCAGTAGACCAGTGAAGG - Intergenic
927922850 2:26986794-26986816 TCACAGCAGTAGACATGGTATGG + Intronic
927993541 2:27465569-27465591 ATACAGCAGAAGACTGGTGATGG + Intronic
929800179 2:45093032-45093054 ATACAGCAGTAGACAAAACAAGG - Intergenic
930644839 2:53894752-53894774 ATAAAGCAGTAGCCAACGGAGGG + Intronic
932403440 2:71497984-71498006 ATTTAGCAGGAGACAAGCGAAGG - Intronic
932824127 2:74924810-74924832 AAACAGCAGAAGCCAAGGTAAGG - Intergenic
933134812 2:78720009-78720031 CTACAGTAGTAGACTAGAGATGG - Intergenic
934015028 2:87871539-87871561 ATAGAGTAATAGAGAAGGGAGGG + Intergenic
935591855 2:104852411-104852433 ATACAGCGGGAGAGAAGGGCAGG + Intergenic
937920332 2:127124414-127124436 ATTCAGCAGGAGACAAGATAAGG - Intergenic
938236308 2:129709523-129709545 ATGCAGCAGCAGCCAAGGGCTGG + Intergenic
940122861 2:150287011-150287033 ATACAGCAGCAGAAGAGGCACGG + Intergenic
940378661 2:152987793-152987815 ATAGAGCAGTGGTAAAGGGAAGG - Intergenic
940915674 2:159252534-159252556 AGACAGCAGCTGACCAGGGAGGG + Intronic
942952843 2:181741023-181741045 ATACAACAGAAGACAATGGCTGG + Intergenic
942994695 2:182246843-182246865 ATACAGCAGTGTACAACAGAAGG - Intronic
943484157 2:188458151-188458173 ATTCAGCATAAGAGAAGGGAAGG - Intronic
944482307 2:200170490-200170512 TTACAGCACAAGACAAAGGACGG - Intergenic
945765345 2:213969547-213969569 ACACAGCAGAAGGCAAGGAAGGG - Intronic
946037653 2:216756515-216756537 ACACAGCAGAGGATAAGGGATGG + Intergenic
947100543 2:226616568-226616590 ATACAGCAGAAGAAGAGGCAAGG - Intergenic
947415833 2:229894598-229894620 AGACAGCAGGAGAGAAGAGAAGG + Intronic
1168984002 20:2032055-2032077 AAACAGCAGGAGAGAAGGCAGGG - Intergenic
1169219886 20:3815949-3815971 ATCCAGCGGCAGACAGGGGAAGG - Intergenic
1169662291 20:7993263-7993285 AGACAGAAATAGACTAGGGATGG - Intronic
1170457130 20:16543758-16543780 ATGCAGCACTTGACAAGAGATGG + Intronic
1171332691 20:24355606-24355628 ATTTAGCAATAGACAAGAGATGG - Intergenic
1171353344 20:24522555-24522577 ATACAACAGTAACCAAGGGAAGG - Intronic
1174112456 20:48205862-48205884 ACAGAGGAGGAGACAAGGGAAGG - Intergenic
1176839753 21:13828680-13828702 ATACAGCAGTAGACCTGGTCAGG - Intergenic
1176975153 21:15312528-15312550 ATACTGCAATAGAGAAGGGAAGG + Intergenic
1177663412 21:24119136-24119158 ATAAAGCAAAAGACAACGGATGG + Intergenic
1178855187 21:36244872-36244894 AGACAAAAGTAGACAAAGGAAGG - Intronic
1180099121 21:45576145-45576167 ACGCAGCTGTAGACAAGGGCAGG - Intergenic
1181868927 22:25882495-25882517 ACACAGCAATTGAGAAGGGATGG + Intronic
1182636550 22:31732108-31732130 ATACACAAGTACACATGGGAAGG - Intronic
1184505954 22:44902519-44902541 ATACAGCAGAAGACACGGTAAGG - Intronic
1184842186 22:47058531-47058553 AGAGAAGAGTAGACAAGGGAGGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
953373500 3:42409336-42409358 ATACATCAGTATAAAAGGGCAGG - Intronic
954688584 3:52383900-52383922 GTACAGCAGTTGACCAGGGAGGG - Exonic
954775064 3:53009498-53009520 ATACAGGAGAATACAAGGGTGGG + Intronic
954862044 3:53698706-53698728 AAAGAGCAGAAAACAAGGGATGG - Intronic
954889274 3:53909572-53909594 ATAGAGCAGTCAACAAGTGAAGG + Intergenic
955497542 3:59550566-59550588 ATACTGTAGTGGACAGGGGAAGG + Intergenic
956093422 3:65691630-65691652 ATACAGCAGTAGACTAGAATAGG - Intronic
956370229 3:68550938-68550960 ATAAAGCAGTAGATAAGCAATGG + Intergenic
956721658 3:72123299-72123321 ATACGGCAGAAGAAAGGGGATGG + Intergenic
958060452 3:88473470-88473492 ACATAGCAGCAGACAAGAGAAGG - Intergenic
958468952 3:94494428-94494450 ATACAGCAATAGACAATCTATGG + Intergenic
958636512 3:96753392-96753414 ATGCAGCAGCAGGCAAGGGCGGG + Intergenic
959414927 3:106072409-106072431 ATACAGCAGCCCAAAAGGGAGGG - Intergenic
960285865 3:115827860-115827882 TCACAGCAGTATACAAGGGGAGG + Intronic
960750102 3:120939458-120939480 TTCCAGTAGTAGACAGGGGAGGG - Intronic
962444789 3:135454770-135454792 ATATAGCAGTAGAAAAATGAAGG + Intergenic
964194562 3:154047663-154047685 CTCTAGCAGTAGAAAAGGGAAGG - Intergenic
965185637 3:165459353-165459375 ATACAGCAGAAGACAGGAGATGG + Intergenic
965843813 3:172938464-172938486 ATACAGCACTATACAAGGTTGGG + Intronic
971019387 4:22518225-22518247 ATATAGCAGCAGAAAAGGGCTGG - Intergenic
971662868 4:29442496-29442518 ATACAGGAGCAGACAACAGATGG - Intergenic
971888957 4:32492470-32492492 ATAAAGCAGCAAACAAGGGAGGG + Intergenic
972482136 4:39507039-39507061 TTTCAGCAGTAGATATGGGAGGG - Intronic
975937216 4:79596503-79596525 AAACAGCAGTTGACTAGTGAAGG + Intergenic
977780826 4:100978691-100978713 ATACACAAGTAGAGTAGGGAGGG - Intergenic
978668922 4:111222689-111222711 TTACAGCAGTAATCAAAGGAAGG + Intergenic
980841791 4:138270624-138270646 AAACTGCTGTAGACAAGGGGTGG + Intergenic
982166242 4:152616091-152616113 CTACAGAAGTATACAAGGAAAGG + Intergenic
982363849 4:154553342-154553364 ATGCAGCAGAAGACAAGAAACGG - Intergenic
984416135 4:179460043-179460065 ATATGGCAGCAGACAAGAGAAGG - Intergenic
985192460 4:187390699-187390721 ATAATTCAGTAGAGAAGGGAAGG + Intergenic
987275712 5:16360239-16360261 ATAGAAGAGTAGACAAGGTATGG + Intergenic
987535161 5:19177334-19177356 ATACAGAAGTGAACAAGAGATGG + Intergenic
987815344 5:22893709-22893731 TTACATCAGTATACAAGGCAAGG + Intergenic
988313579 5:29593974-29593996 ATTTAGCAGGAGACAAGAGAAGG + Intergenic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
990924994 5:61010895-61010917 AGCCAGCAGGAGAAAAGGGAAGG - Intronic
991545462 5:67777231-67777253 GTACTGCAGTAAACATGGGAGGG + Intergenic
991651725 5:68862459-68862481 AAACAGCAGTAGAAAGAGGATGG - Intergenic
992004736 5:72466273-72466295 AAACAGCCATAGAGAAGGGATGG - Intronic
993092816 5:83447898-83447920 ATACAGCATTAGATATGGGTAGG + Intergenic
993770878 5:91924902-91924924 ATAAAGCGGTAGAGAGGGGATGG + Intergenic
995451275 5:112303852-112303874 AGACAGCAGCAGATAAGGGAGGG + Intronic
995990807 5:118237054-118237076 ATACAGAAGTAGACAATACAAGG + Intergenic
997586532 5:135046997-135047019 ATCCAACAGGAGGCAAGGGAGGG - Intronic
1004231639 6:13839060-13839082 ATTCAGCAGTAGACCAGGGTAGG - Intergenic
1007687148 6:43673697-43673719 ACACAGCAGCAGACAAAGCATGG + Intronic
1008094574 6:47326620-47326642 ATGCTGCAGTAAACATGGGAGGG - Intergenic
1008119711 6:47597956-47597978 ATGCAGCAGTAGTCAAGGAATGG + Intronic
1008229850 6:48972504-48972526 ATACAGCAATGAACATGGGAGGG - Intergenic
1010551506 6:77228573-77228595 TTCCAGCAGCAGAGAAGGGATGG - Intergenic
1010642174 6:78342058-78342080 ATACAGTGGTAGACAACGTAAGG - Intergenic
1011316453 6:86036963-86036985 ATACAGCAGTAGACACTGTCAGG + Intergenic
1012155388 6:95813256-95813278 ATACTCCAGGAGACCAGGGAAGG + Intergenic
1012727404 6:102831908-102831930 ATATAGAGGTTGACAAGGGATGG + Intergenic
1012865494 6:104613433-104613455 ATACGGCAATGAACAAGGGAGGG - Intergenic
1012978894 6:105809485-105809507 CTACAGCAGGAGAAAAGTGAGGG - Intergenic
1013617147 6:111854179-111854201 ACACACCGGTAGACAAGGTATGG - Intronic
1014258301 6:119186340-119186362 ATAAAGCATGAGACAAGGGTTGG + Intronic
1015501514 6:133938489-133938511 AGACATCAGAAGACAATGGAGGG - Intergenic
1017902199 6:158727880-158727902 TGACATCAGTAGACAAGGGGAGG + Intronic
1018082847 6:160273539-160273561 ATACAGAAATAAACAAGGCATGG + Intronic
1018553304 6:165023918-165023940 ATTCAGCAGTTGTCAAGGGTTGG + Intergenic
1018712437 6:166506508-166506530 ACACAGCAGGAGGCAAAGGAAGG + Intronic
1019407077 7:889452-889474 AGACAGCAGGAGACAAAGCAAGG + Intronic
1019858748 7:3636650-3636672 ATGCTGCAGTAGACGTGGGAGGG + Intronic
1020203930 7:6101203-6101225 CCACAGCAGCAGACAAGGGATGG + Intergenic
1020916318 7:14198285-14198307 ATACAGCAGTTGTCAAGGTATGG + Intronic
1021658303 7:22893726-22893748 AGACAGAAGCAGGCAAGGGATGG - Intergenic
1022389539 7:29931369-29931391 ATACAGCAGTGAACAAAGAAGGG + Intronic
1024778395 7:52816308-52816330 AGACAGCAGTGGAGAAGGGTGGG - Intergenic
1025796825 7:64745940-64745962 ATTCAGCAGGAGACAAGATAAGG - Intergenic
1026648639 7:72195003-72195025 ATACAGCTGGAGACAAGGGGAGG - Intronic
1027730908 7:81871380-81871402 ATTCTGAAGTAGAAAAGGGATGG + Intergenic
1027833048 7:83205121-83205143 ATACAGCAGCAGAAAAAGGTAGG - Intergenic
1027912974 7:84277108-84277130 ATACAACTGTAGACATGAGAGGG - Intronic
1029097639 7:98101604-98101626 ATACAGAATTAGACCAGGAAAGG - Intergenic
1031320602 7:120322416-120322438 AAAGAGCAGTAGACAAAGAAAGG - Intronic
1031909259 7:127497316-127497338 ATACTGCAGTAAATATGGGAGGG - Intergenic
1032115224 7:129111088-129111110 CTACAGCAGAGGACTAGGGAGGG + Intergenic
1032388948 7:131543424-131543446 AAAGAGCAGGGGACAAGGGATGG - Intronic
1033326670 7:140384801-140384823 CTACAACAGTAGTCAAGGTAGGG + Intronic
1034408880 7:150926437-150926459 ATGCTGGAGCAGACAAGGGAGGG + Intergenic
1034907157 7:154959850-154959872 ATACAGTAATAGCCAAGGTAAGG + Intronic
1035587502 8:787192-787214 ATACAGCAGTCTTCAAAGGAAGG - Intergenic
1035849462 8:2900849-2900871 ATAAAGCAGAAGTCAAGTGAGGG + Intergenic
1039055692 8:33534577-33534599 ACACAGCAGCAGATCAGGGAGGG - Intergenic
1039165519 8:34675310-34675332 ATCCAGCAGGAGGCTAGGGAAGG - Intergenic
1039234659 8:35488606-35488628 ATACAGCATTAAACCAAGGAGGG + Intronic
1040684567 8:49856496-49856518 ATTCAACAGTTGTCAAGGGATGG - Intergenic
1040839538 8:51770563-51770585 AGACAGCAGGAGACATGGAAAGG - Intronic
1042418790 8:68560368-68560390 AAACAGCACAAGACAATGGAAGG - Intronic
1042857728 8:73285172-73285194 ACACAGGGGTAGGCAAGGGAAGG + Intergenic
1043865655 8:85372308-85372330 ATACAGCAGAAAACAAGTGTTGG + Intronic
1044143416 8:88683317-88683339 ATACAGAAATAGAATAGGGAAGG - Intergenic
1044470891 8:92565818-92565840 AATCAGCAGGAGACAAGAGATGG + Intergenic
1045643841 8:104281252-104281274 ATACAGCAGTAGGCAAGCTGTGG - Intergenic
1045936487 8:107685437-107685459 AAACACCAGGAAACAAGGGAAGG + Intergenic
1047005709 8:120617910-120617932 ATACAGCAGCAAACGAGTGAAGG + Intronic
1048103976 8:131387365-131387387 ATACAGAAGTGAACAAGGAATGG - Intergenic
1048470579 8:134700694-134700716 ATACAGCAGGGGGCAAGGCAGGG - Intronic
1049248638 8:141576443-141576465 ATTCAGCAGTGAACAAGAGAAGG + Intergenic
1050037953 9:1457237-1457259 ATACAACAATAGAGAAGGGGAGG + Intergenic
1050205938 9:3196271-3196293 ATAAAGCAGAACAAAAGGGATGG + Intergenic
1050805142 9:9667490-9667512 ATACAGCAGTAAAAACGGTAAGG + Intronic
1052676653 9:31634168-31634190 ACACAGCAGTTCACAAGGTATGG - Intergenic
1053407314 9:37888324-37888346 ATACTTCAGTTGAGAAGGGATGG - Exonic
1056308867 9:85319971-85319993 ATATAGCAGGAGACAAGATAAGG - Intergenic
1056380424 9:86052735-86052757 TTTCAGCAGCAGACATGGGAGGG - Intronic
1056549155 9:87636964-87636986 ATACAGCAGTAGCCAATAGCTGG + Intronic
1059287252 9:113185148-113185170 ATACAGCAGTAAACAAAACACGG + Intronic
1059671623 9:116497577-116497599 ATCCAGCAGTAGAAAAAGGAAGG - Intronic
1059820542 9:117967624-117967646 ATACAGCAGTAGGTAAAGGAGGG - Intergenic
1060230436 9:121821619-121821641 ATACAGATGGAGACAAGGAAAGG + Intergenic
1061045498 9:128162871-128162893 ATCCAGGAGGAGAGAAGGGAAGG + Intronic
1061181121 9:129025844-129025866 AGACTGCAGTGGACATGGGATGG - Intronic
1062173491 9:135148249-135148271 GGACAGCAGGGGACAAGGGAGGG + Intergenic
1185793050 X:2942218-2942240 ATTTAGCAGGAGACAAGGTAAGG + Intronic
1186878479 X:13840454-13840476 ATACACCAGTCAACAAGTGAGGG - Intronic
1188742628 X:33804910-33804932 GTGCTGCAGTAAACAAGGGAGGG + Intergenic
1189552889 X:42112013-42112035 AAACAGTAGTAGAGAATGGATGG + Intergenic
1189822278 X:44881586-44881608 ATACAGAAGTAAACAAATGATGG - Intronic
1191141612 X:57121169-57121191 ATCCAGCAGGAGACATGGGGTGG - Intronic
1191143253 X:57137136-57137158 ATCCAGCAGGAGACATGGGGTGG - Intronic
1193264498 X:79452773-79452795 ATTCAGCAGGAGACAAGATAAGG - Intergenic
1194810912 X:98386322-98386344 ATACAGCACCATACAAGGGCAGG + Intergenic
1196158690 X:112458750-112458772 TTACAGCTGTAGACAAATGAGGG - Intergenic
1197292033 X:124670360-124670382 AAACAGCAGAAGAGAAGGTAAGG + Intronic
1197415578 X:126167679-126167701 ATACAGCACTAAACATGGGTAGG - Intergenic
1199129451 X:144166972-144166994 ATAGAGTAATAGAGAAGGGAGGG - Intergenic
1199288744 X:146082886-146082908 ATTCAGCAGGAGAGATGGGATGG - Intergenic
1199768255 X:150956340-150956362 ATGCAGCCGCAGACCAGGGAAGG - Intergenic
1201225198 Y:11811783-11811805 ATAGTGCAGTAGAAAAGGCATGG - Intergenic