ID: 1082888912

View in Genome Browser
Species Human (GRCh38)
Location 11:58117673-58117695
Sequence CTGGAAATGGGTTGCTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082888912 Original CRISPR CTGGAAATGGGTTGCTTGGT AGG Intronic
901005048 1:6167517-6167539 CTGGAAATTGGTGGCATGGGAGG - Intronic
903254758 1:22088282-22088304 CTAGATATGGGTTGCTTTGAGGG + Intronic
903784236 1:25847132-25847154 CTGGAAATTGGTAGCTGAGTAGG - Intronic
911990435 1:104689498-104689520 TTGGAAATGGGGTCTTTGGTAGG + Intergenic
912843178 1:113057377-113057399 CTGGATTTGGGTTGCTCGGAAGG + Intergenic
914208046 1:145551978-145552000 CTGGAATTTTTTTGCTTGGTAGG + Intergenic
915521146 1:156444940-156444962 CTGGAAATGGATTGTTAGGAAGG - Intergenic
916269423 1:162923973-162923995 TTGTCAATGGGTTGCTTGGTTGG - Intergenic
920032206 1:203044249-203044271 CTGCAAATGTGCTGCTTAGTAGG + Intronic
921526809 1:216228227-216228249 ATGGAAATGGGTTGCTGGAGTGG + Intronic
922902002 1:229144469-229144491 TAGGAAATGGTTTGGTTGGTTGG + Intergenic
923592648 1:235333161-235333183 CTGGAAATAGGTTGCTTACATGG - Intronic
923647835 1:235842103-235842125 CTGGAAATGGGAGTTTTGGTGGG + Intronic
1064013380 10:11754414-11754436 CTGGAAATGTATTGGTTGGAGGG + Intronic
1064554128 10:16531706-16531728 CTGGAAATGGGTTTAGTGGAAGG + Intergenic
1065350796 10:24793987-24794009 CTGGAAATGGCTTCCTTCTTTGG + Intergenic
1067067924 10:43113963-43113985 CTTGAAATGTGTTCCTGGGTGGG - Intronic
1068773771 10:60850197-60850219 CTAGAAATGGGTTGGTAGATTGG + Intergenic
1070666678 10:78349986-78350008 CTGGACATGGGCTGCTTGAGGGG - Intergenic
1070901786 10:80036439-80036461 TTGGAAGTGAGTTCCTTGGTTGG - Intergenic
1071781581 10:88852142-88852164 CTGGAAAAGCGTTACTTGTTAGG - Intergenic
1073066531 10:100763057-100763079 CTGGGAATGGGTTGCTACCTTGG - Intronic
1073474354 10:103743096-103743118 CTGGACATGGGATCCTTGGCTGG - Intronic
1073528019 10:104204314-104204336 ATAGAAACGGGTTGGTTGGTTGG + Intronic
1074008845 10:109456648-109456670 CTGCAAATGGGTAGCTTTGCCGG + Intergenic
1074541157 10:114366272-114366294 CTGTAAAAGGCATGCTTGGTAGG + Intronic
1075282981 10:121156951-121156973 CTGGAAATGGAATTCTAGGTTGG - Intergenic
1075557549 10:123444385-123444407 CTGGAAAAGTCTTGCTTGGTTGG + Intergenic
1076619853 10:131780135-131780157 CTGGAACTTGGATGGTTGGTTGG - Intergenic
1078897021 11:15605756-15605778 TTGGAAATGGCTTGCTCAGTTGG - Intergenic
1079222654 11:18577190-18577212 CTGGAGGTTGGTTGGTTGGTTGG - Intronic
1080038597 11:27735370-27735392 ATGGAGCTGGGTTGCTTGGAGGG - Intergenic
1080268113 11:30422763-30422785 CTGGCAATAGGGTGCTTTGTGGG - Intronic
1080417759 11:32084778-32084800 CTGAAGATGTGTTGGTTGGTAGG - Intronic
1081770479 11:45647603-45647625 CTGGAAGTGGGTGGGTAGGTGGG + Intergenic
1082888912 11:58117673-58117695 CTGGAAATGGGTTGCTTGGTAGG + Intronic
1083486010 11:62983477-62983499 CTGGAAAGGGGTTGCTGGGCTGG + Intronic
1091298643 11:134490541-134490563 TTGGAAATGGGGTGTTTGGGAGG - Intergenic
1098561495 12:71878104-71878126 CTGGAAATGGTAAGCTTGGATGG + Intronic
1100223219 12:92529687-92529709 CTGGATGTGGGCTGCTGGGTTGG + Intergenic
1100394741 12:94174797-94174819 TTGGAAGTGGGTTCATTGGTTGG + Intronic
1101521546 12:105486813-105486835 CTGGTAATGGTTTGCTTGTAAGG + Intergenic
1101709777 12:107254487-107254509 CTGGAATTGTGTTGTTTGTTTGG + Intergenic
1103618002 12:122167305-122167327 CTGGGTAAGGGTTGTTTGGTGGG - Intergenic
1103676787 12:122662255-122662277 CTGGAGGTGGGTGGCTGGGTTGG - Intergenic
1104062649 12:125281313-125281335 TGGGATGTGGGTTGCTTGGTAGG + Intronic
1104364031 12:128160817-128160839 CTGGAATTGGGTTCCTGGGGAGG - Intergenic
1105806979 13:23958310-23958332 CTGGAGAAGATTTGCTTGGTGGG - Intergenic
1106287948 13:28334639-28334661 CTGGAAATATTTTGCCTGGTAGG - Intronic
1106659466 13:31783740-31783762 GTGGACTTGGGTTGCATGGTGGG + Intronic
1107011034 13:35671350-35671372 CTGGAAATGGGATGCAGGTTAGG - Exonic
1108740726 13:53335511-53335533 CTGGAAATAGGTAGCTTTCTAGG + Intergenic
1110017440 13:70425559-70425581 TTGGAAATGCTTTTCTTGGTAGG - Intergenic
1110392146 13:74986337-74986359 CTTTAAAGGGGTTGCTTTGTAGG - Intergenic
1111237290 13:85426225-85426247 CTGGAAATGGATTGTATGGTTGG + Intergenic
1111850185 13:93563342-93563364 AAGGATATGGGTTGCTTGGTTGG - Intronic
1115925111 14:38424513-38424535 CTGGGACTGGGTTGCTTCATTGG - Intergenic
1117043873 14:51792624-51792646 CTGGAAATGGATAGGTAGGTAGG + Intergenic
1118264303 14:64279816-64279838 TTGGAAGTGGGTTGGGTGGTGGG - Intronic
1120512009 14:85426620-85426642 CAGGAAATTGGATGCTTGGCTGG - Intergenic
1121023080 14:90593674-90593696 GTGGGAAGGGGTTGATTGGTTGG - Intronic
1121640861 14:95484039-95484061 CTGGAAATGGGTTTTATGGTTGG - Intergenic
1121791693 14:96704128-96704150 CAGGGAATGGGTTGCATGGTGGG + Intergenic
1121793765 14:96719169-96719191 CTGAAAATGGGATTCTTGGCTGG - Intergenic
1123894847 15:24818427-24818449 CTGGTTATAGGTTGCTTAGTAGG - Intergenic
1124999037 15:34752797-34752819 CTGGAAATTGGGTTCCTGGTTGG - Exonic
1125242012 15:37586718-37586740 CTACAAATGCGTTGCTTGGCTGG - Intergenic
1127875211 15:63106136-63106158 CTGACCATGGCTTGCTTGGTTGG - Intergenic
1128420250 15:67485104-67485126 CTGGAAATAGAATGCTTGGTAGG - Intronic
1129549783 15:76435745-76435767 CTGGATATAGGATTCTTGGTTGG + Intronic
1129853640 15:78810117-78810139 CTGGATTAGGGTTGCTTGCTGGG - Intronic
1131028104 15:89162404-89162426 CTGGAAGAGGCTTACTTGGTTGG - Intronic
1132316306 15:100892922-100892944 CTGGAAGAGGGTTACATGGTGGG - Intronic
1133597897 16:7310613-7310635 CTGGTAATGGGTAGATTGGCAGG - Intronic
1133854088 16:9533505-9533527 CTTGAAAAGGCTTGCTTGTTTGG + Intergenic
1135235641 16:20753171-20753193 CTGGAAAAGGCTGGCTGGGTGGG + Intronic
1136141488 16:28291952-28291974 CTGGAAATAGGATGCATGGATGG + Intergenic
1138450503 16:57091377-57091399 CTGGAGTTGGGTTGATAGGTTGG + Intergenic
1138628652 16:58274882-58274904 CTACAAGTGGGTTGCTGGGTGGG + Intronic
1143410583 17:6706114-6706136 CTGGAAATGGCTAGCTAGATTGG + Intronic
1144820681 17:18071507-18071529 CTAGAAATGGGTTGTTGGTTTGG + Intergenic
1148015761 17:44521108-44521130 GTGGACATGGGTTACCTGGTTGG - Intergenic
1152944297 17:83190754-83190776 CAGGAACTGGGGGGCTTGGTGGG - Intergenic
1155557889 18:27042045-27042067 CTGGAGATGGATTGCCTGGGAGG + Intronic
1155646375 18:28083176-28083198 CTGAAAATGAGTTTCTTGGGGGG - Intronic
1157501921 18:48196775-48196797 CTTGAGATTGGTTGGTTGGTCGG - Intronic
1160451719 18:78971026-78971048 CTGGGGATGGGTGGCTTGGAGGG - Intergenic
1161317705 19:3625901-3625923 CTGGAGATGGGGCACTTGGTCGG - Intronic
1162131458 19:8528602-8528624 ATGGGAATGTGTTGGTTGGTTGG + Intronic
1162822960 19:13234611-13234633 CTGGAAATGGGTGTCGTGGGGGG - Intronic
1163084340 19:14968609-14968631 TAGGAAAAGGGATGCTTGGTGGG - Intronic
1166334752 19:42099014-42099036 CTGGAAATGTGGTGCTTTCTGGG + Intronic
1168209424 19:54879515-54879537 CTGGGAATGAGATTCTTGGTTGG + Intronic
927130034 2:20051316-20051338 CTGGAAACGGGGTGTTGGGTGGG - Intronic
927288753 2:21383807-21383829 CTCCACATGGGTTGCCTGGTAGG - Intergenic
929877468 2:45808627-45808649 CTGGCACTGGGTTGGGTGGTGGG + Intronic
931249055 2:60514305-60514327 CCAGAAATGGGTTGCCTGGTAGG - Intronic
936056796 2:109267850-109267872 CTGGACAGAGGTTGCTTGGGAGG + Intronic
936056942 2:109268490-109268512 CTGGACAGAGGTTGCTTGGGAGG - Intronic
936076131 2:109402932-109402954 GTGGAGATGGGCTGCTTGCTGGG + Intronic
939368871 2:141271611-141271633 CTGGAAATAAGATTCTTGGTTGG - Intronic
939656201 2:144828528-144828550 CTGGAAATGAGATGCTTTATGGG + Intergenic
939932841 2:148255492-148255514 CTGGCAATGGGGTGCTTGGAGGG + Intronic
940911802 2:159216011-159216033 CTGCAAGTGGGTTGCTGGGTGGG + Intronic
942980526 2:182075311-182075333 TTGGAAATGAGTTGCCTTGTGGG - Intronic
944471473 2:200057483-200057505 CTGGATATGAGATTCTTGGTTGG - Intergenic
945118654 2:206435872-206435894 CTGGAAATGGATTACATGGCAGG + Intergenic
948564532 2:238875534-238875556 CTGGCATTGGTTTGCTTTGTTGG + Intronic
1172745547 20:37205072-37205094 CAGGAAATGGGTTGCTAGTGAGG + Intronic
1173111182 20:40192060-40192082 CTGGAACTGGGTTTGTTGGAGGG + Intergenic
1173448798 20:43143952-43143974 TTGGCAATGGGTTCCTTGGAAGG - Intronic
1174659013 20:52194426-52194448 CTGGAAATGTGTGTCTTGGAAGG - Intronic
1175157701 20:56983022-56983044 CTGGAGGTGGGTTTTTTGGTGGG - Intergenic
1177480595 21:21682061-21682083 CTGGAAATGAAATTCTTGGTTGG + Intergenic
1177774990 21:25558028-25558050 CTGTAAATGGGTTGCTGCTTTGG - Intergenic
1178358980 21:31932455-31932477 AGGGGAAGGGGTTGCTTGGTAGG + Intronic
1183589369 22:38770803-38770825 ACGGAAATGGGTGGCTTGGAAGG - Intronic
1184665335 22:45986031-45986053 CTGGAAAGGGCTTGCGTGATGGG - Intergenic
1184878085 22:47288246-47288268 ATGGATATGGGTTGATTGGATGG - Intergenic
950424583 3:12918199-12918221 CTGAAAAGGGGTGACTTGGTGGG + Intronic
952773465 3:37022601-37022623 CTGGAAATGGTTTGGCTGGTGGG + Intronic
954364050 3:50137098-50137120 CTGGGAATGGGGTGCCTGCTGGG - Intergenic
954720261 3:52555553-52555575 CTGGACTTGGTTGGCTTGGTTGG - Intronic
956382215 3:68676385-68676407 ATGGAAATGGGTGACTTGGTTGG - Intergenic
956693943 3:71902798-71902820 TTGGGAATGGTTTGCGTGGTAGG + Intergenic
957696640 3:83648417-83648439 CTGGATATGCAGTGCTTGGTTGG + Intergenic
958520303 3:95177236-95177258 CTGCAAAGGGGTTGCATGCTTGG + Intergenic
959592162 3:108092256-108092278 GTGGCAATGGGATGCTTGGGAGG - Intergenic
959861580 3:111222131-111222153 TTGGAAATGGGATGCTGGGGGGG + Intronic
961104966 3:124233104-124233126 CTGGCAAAGGGTGGCTTGGAGGG - Intronic
961852507 3:129835415-129835437 TTGGTGATGGGTTGCTAGGTGGG - Intronic
962242935 3:133766611-133766633 CTGGAACTGGGTTGCTGAGTTGG + Intronic
965589863 3:170352106-170352128 CTGAAAATGTGTTACTTGGAAGG - Intergenic
966382325 3:179356235-179356257 CTGGAAATGGGTGGGTGGGAAGG - Intronic
968580716 4:1392542-1392564 CTGGATATGGCTGACTTGGTTGG + Exonic
971500235 4:27311222-27311244 CTGCAAATGGGTTTCTTGTAGGG + Intergenic
973848857 4:54941184-54941206 CAGGAAATGGGTGGGTGGGTAGG - Intergenic
974850771 4:67402974-67402996 CAGGAAATGGGTTCCTGGGTAGG + Intergenic
975726621 4:77298101-77298123 CTGGAATTTGGTTGGTTGGTAGG + Intronic
977511496 4:97968300-97968322 CTGGAAATTTTTTGGTTGGTAGG - Intronic
978385873 4:108175086-108175108 CAGGAAATGGCTCCCTTGGTGGG - Intergenic
979727013 4:123974361-123974383 TTGGCTATGGGTTGCTTTGTAGG + Intergenic
982958146 4:161797939-161797961 ATGTAAATGTTTTGCTTGGTGGG - Intronic
985020497 4:185684026-185684048 TTGGTGATGGGTTGGTTGGTGGG - Intronic
990167951 5:53016355-53016377 CTGGAAATGAAATTCTTGGTTGG + Intronic
991989739 5:72325797-72325819 CTGGAAAGCAGATGCTTGGTTGG + Intronic
993005808 5:82426901-82426923 CTGGAAAGGCATTGCTGGGTGGG + Intergenic
993901998 5:93590607-93590629 GTGGAAATGTGTTGCATGGGAGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995963957 5:117881572-117881594 CTGGCAATGTGCTGCTTGGAAGG + Intergenic
998182986 5:139958289-139958311 CTGGGAATGGGCTGCTGTGTGGG + Intronic
999718285 5:154379642-154379664 CTGGAATTGTGTTGGTAGGTTGG + Intronic
1000193044 5:158931144-158931166 CTAGAAATGGGCAGCTTAGTGGG - Intronic
1000220307 5:159208811-159208833 CTAGAAATGGGATGCTGGGGAGG + Intronic
1002766057 6:239909-239931 TTGGAATTGGGTTGATTGATAGG + Intergenic
1007621809 6:43220084-43220106 TGGGAAATGGGTTGCCTGGGTGG - Intronic
1007968505 6:46026781-46026803 CTGGAAATGGGGTGAGGGGTGGG - Intronic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1008463761 6:51806440-51806462 CTGGCAATGGCAGGCTTGGTAGG + Intronic
1008949829 6:57144630-57144652 TTAGAAATGTGTTGCTTGGCTGG + Intronic
1010774238 6:79866957-79866979 ATGGAAATGGGTTGTTTCTTAGG - Intergenic
1011648704 6:89485431-89485453 CTGGACCTGGGTTTTTTGGTTGG + Intronic
1014169891 6:118267097-118267119 CTGGGAATGGGCTGCATGGTGGG + Exonic
1016761616 6:147743945-147743967 CTTGAAATGGCTTTCTGGGTGGG + Intergenic
1019620416 7:1989051-1989073 TTGTAAATGGGTTGTTTTGTTGG - Intronic
1019667239 7:2257959-2257981 CTGGTAATGGGTGGGCTGGTGGG - Intronic
1021371336 7:19851734-19851756 CTGGAAACTTGTTGCTTGGTTGG + Intergenic
1021929220 7:25562726-25562748 CTGGGAGTGGGGTGCTTGGTGGG + Intergenic
1022779420 7:33563316-33563338 CTGGAAATGGGTTTATTGTTAGG + Intronic
1025717094 7:63969533-63969555 CTGGATATGGTATTCTTGGTTGG - Intergenic
1026068198 7:67094366-67094388 CCGGTAATGGGTTGCTAGGTTGG + Intronic
1027871532 7:83714030-83714052 CTGGAAATTTTTTGGTTGGTAGG + Intergenic
1028975831 7:96913056-96913078 TTGGAAATGTGTTGATTTGTTGG + Intergenic
1031377501 7:121045445-121045467 CTGAAAATGACTTGATTGGTGGG + Intronic
1032553455 7:132807024-132807046 AAGGAAATGGTTTGCTGGGTGGG + Intronic
1032817610 7:135493166-135493188 CAGGAAAATGGTTGGTTGGTTGG + Intronic
1035238965 7:157517700-157517722 CTGGCACTGGGTTCCTTGTTAGG - Intergenic
1039800507 8:40950574-40950596 CTGGATATGGGATGATAGGTAGG + Intergenic
1042752052 8:72168951-72168973 CTGGAAATGAAATTCTTGGTTGG + Intergenic
1043688398 8:83117334-83117356 CTGGACTTTGGTTGGTTGGTAGG + Intergenic
1044865642 8:96568542-96568564 CTGGAAATGGAGCTCTTGGTTGG + Intronic
1045108927 8:98920954-98920976 CTTGAAATAAGTTGGTTGGTTGG + Intronic
1045124779 8:99077498-99077520 CTGGAAATAGTTTTCTTGGTGGG + Intronic
1045396804 8:101768866-101768888 CTGTGAATGGGTTGCTTTGCAGG + Intronic
1048021177 8:130540621-130540643 CAGGAAGTGGGGTGCCTGGTTGG + Intergenic
1053474433 9:38371879-38371901 CTGGAAATGGGCTTCTTTCTTGG + Intergenic
1055453764 9:76454491-76454513 CTGGAAAAGGGCTTCTTGGGAGG + Intronic
1056314995 9:85379803-85379825 CTGGAGATGGTTTGCTTGATCGG - Intergenic
1057068822 9:92078349-92078371 ATGCAAATGGGTTGTTTGCTTGG - Intronic
1057283762 9:93731079-93731101 CAGGGAATGGGTTCCTGGGTGGG + Intergenic
1061934938 9:133852216-133852238 AGGGAGATGGGTGGCTTGGTGGG + Intronic
1061996059 9:134186630-134186652 CTGGAAGTGCGTTTCGTGGTAGG + Intergenic
1187487195 X:19715833-19715855 CTGGAAATGTGTTCCTGGGTTGG + Intronic
1188719755 X:33508118-33508140 CTGGACTTTGGTTGGTTGGTAGG - Intergenic
1191182875 X:57581303-57581325 CTGGACATAGGTGGCTTGTTTGG + Intergenic
1191729996 X:64323153-64323175 CTGGAATTGGTATGCCTGGTTGG - Intronic
1192636833 X:72827829-72827851 CTGGACATGTTTTGGTTGGTAGG + Intronic
1192644881 X:72892985-72893007 CTGGACATGTTTTGGTTGGTAGG - Intronic
1192831322 X:74753677-74753699 GAGGAAATGTGTTGCTTGGGTGG - Intronic
1199710909 X:150468409-150468431 CTGGAAAGGGGTTATTTGGGGGG + Intronic
1199751415 X:150823249-150823271 CTGAAACTGGGTTGGTTGGTTGG + Intronic