ID: 1082895032

View in Genome Browser
Species Human (GRCh38)
Location 11:58181005-58181027
Sequence AGCAAAGCTGACCCTACTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082895032 Original CRISPR AGCAAAGCTGACCCTACTCA AGG Exonic
902184175 1:14712694-14712716 ACCAAAGCTGAGCCTCCACAGGG + Intronic
905526068 1:38640913-38640935 AGCAAAGATCACCCTCATCAAGG + Intergenic
917606467 1:176635879-176635901 TGCAAAACTGATCCTATTCATGG + Intronic
920728629 1:208461750-208461772 AGGGAAGCTGACCCCACTCCTGG - Intergenic
922191479 1:223322778-223322800 TGAAAAGCTTACCCTAGTCAGGG - Intronic
923678923 1:236103290-236103312 AGCAAAGCTGCCGCTAAGCAGGG + Intergenic
1064832725 10:19489101-19489123 AGCAGAGCTGACCTTCCTCTTGG - Intronic
1068757698 10:60672828-60672850 GGAAAAGCTGACTCTACTCGAGG + Intronic
1069622829 10:69848317-69848339 AGCAAAGCTGCCACTTCCCAAGG + Intronic
1072232647 10:93426050-93426072 AGGTAAGCTGACCCTTCTGAAGG - Exonic
1073282009 10:102361353-102361375 AGAAGAGCTGTCCCTATTCATGG - Intronic
1075842462 10:125516641-125516663 AGGAAAACTGACCGTACTCAGGG - Intergenic
1076617939 10:131769094-131769116 TGCAAAGCTGAGCCCCCTCAGGG - Intergenic
1082895032 11:58181005-58181027 AGCAAAGCTGACCCTACTCAAGG + Exonic
1085980591 11:81719075-81719097 AGCAACTCTGAACCTACCCAGGG + Intergenic
1086960486 11:92975490-92975512 GGCAAAGCTGCCCCTCCTCCAGG + Intronic
1087181582 11:95147451-95147473 CTCAAAGCTGACCCTTGTCAAGG - Intergenic
1088158972 11:106844988-106845010 AGCAAAGATTAACCTACTGATGG - Intronic
1088540420 11:110908139-110908161 AGAAAATATGACCCTACTTAAGG + Intergenic
1088785826 11:113181053-113181075 AGCAATGCTGACTCTACTGCTGG + Intronic
1089347501 11:117799856-117799878 AGCAAAGCTGTTCCCATTCATGG - Intronic
1090023148 11:123145426-123145448 CGCAGAGCTGAACCCACTCATGG - Intronic
1092882663 12:12900105-12900127 AGCAGCGCTGACCCTAGACATGG - Intronic
1095231119 12:39741422-39741444 AGTAATACTGACCCTCCTCAGGG - Intronic
1098227046 12:68335054-68335076 AGGAAAACAGACCCTACACAAGG + Intergenic
1098901388 12:76115312-76115334 AGCAAAACTCTCCCTCCTCATGG + Intergenic
1099630531 12:85137314-85137336 AGGAAAGCTCATCCTACTCCAGG + Intronic
1108325344 13:49325439-49325461 ACCAAATCTAACCGTACTCATGG - Intronic
1114047123 14:18885067-18885089 AGGACAGCTGACTCTTCTCAGGG - Intergenic
1119426460 14:74538384-74538406 CGCAATGCCGACCCTTCTCAGGG - Intronic
1122256439 14:100480954-100480976 AGCAGAGCTGACCTTCCTCTTGG - Intronic
1122444882 14:101761375-101761397 AGCAGAGCTGAGCCGACTCAGGG - Intergenic
1126840271 15:52710805-52710827 AGCAATACAGACCCAACTCATGG - Intergenic
1133933335 16:10249925-10249947 AGAAAAGCTGACCCCACAGAAGG - Intergenic
1136316255 16:29456031-29456053 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1136430832 16:30195373-30195395 AGCAAAGCAGGCCCTGCTCAGGG + Intronic
1144328801 17:14206423-14206445 AGCAAAGAAGCCCCTACACACGG - Intronic
1146635665 17:34502559-34502581 AGGAAGCTTGACCCTACTCAAGG - Intergenic
1147688046 17:42299066-42299088 AGCACAGCAGTCCCTCCTCAGGG - Intronic
1149293818 17:55242521-55242543 AGCAAAGTTGCCCATCCTCACGG - Intergenic
1151625417 17:75272608-75272630 AGCAAGGCTGACCCAGCTCTGGG + Intergenic
1153097780 18:1427805-1427827 TGCAAAGCTGGCCCTGCACAGGG - Intergenic
1154018957 18:10645696-10645718 TTCAAAGATGACCCTACTTATGG + Intergenic
1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG + Intergenic
1158538823 18:58333816-58333838 AGCAAAGAGAACCCTCCTCAAGG + Exonic
1160157832 18:76446958-76446980 AGCAAAGCTGCCTCTGCCCAGGG + Intronic
1160203068 18:76810972-76810994 TGCAAAGTGGTCCCTACTCAAGG + Intronic
1164062666 19:21689232-21689254 AGCACAGCTGCCCTTATTCAAGG - Intergenic
928698511 2:33874921-33874943 AAGAAAACTGACCCTACTCATGG - Intergenic
928727942 2:34196805-34196827 AGCAAAGCACACAGTACTCAAGG - Intergenic
930186840 2:48419620-48419642 TGTAAAGCTGACCCTAGCCAGGG - Intergenic
931772748 2:65512778-65512800 AGCAGAGCTGACACTACACAGGG + Intergenic
934986403 2:98889525-98889547 AGCAAAGCTGACAAAACTGAAGG + Intronic
937240077 2:120454436-120454458 AGCAAACCTGACCATACTGAGGG + Intergenic
938971822 2:136439715-136439737 AGCAGAGATGCCCTTACTCAAGG - Intergenic
941855941 2:170231076-170231098 AACACAGCTGACCCTGCTCAAGG + Intronic
945665551 2:212736979-212737001 ACCAAAGGTAACCCCACTCAGGG - Intergenic
946994542 2:225376417-225376439 AGCAAGGTTGTCTCTACTCAAGG - Intergenic
947752668 2:232540902-232540924 AGCAGAGCAGACCCTACGCCAGG + Intronic
948280216 2:236741073-236741095 AGGAAAGCCCACCCCACTCAGGG + Intergenic
1168859557 20:1036356-1036378 AGCAAAGCTCCCCCTGGTCATGG - Intergenic
1169513360 20:6290228-6290250 AGCAAAGCTCCCACTACTGAAGG - Intergenic
1175506765 20:59491731-59491753 AGCCATGCTGTCCCTAGTCAAGG + Intergenic
1180465656 22:15607718-15607740 AGGACAGCTGACTCTTCTCAGGG - Intergenic
1182716277 22:32358284-32358306 AGCAAAGCAGATCCTCCCCATGG - Exonic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
950177458 3:10885260-10885282 AACAAAGTTGAGCCTACACAAGG - Intronic
951602410 3:24390983-24391005 AGCAAAGCTGAATCTTTTCAGGG + Intronic
952968292 3:38634481-38634503 GGCAAAGCTGACCCTCGTGAGGG - Intronic
954904597 3:54049527-54049549 AGCATAGCTCACTCTCCTCATGG - Intergenic
959781045 3:110233840-110233862 AGCAAATCTTACCTTACTCAAGG - Intergenic
962848742 3:139292020-139292042 AGCAAAGCTGGGGTTACTCAAGG - Intronic
963816897 3:149840986-149841008 AGCGAAGCTGGAGCTACTCACGG - Intronic
964832460 3:160899534-160899556 ACCAAAGCTGTACTTACTCAAGG - Intronic
967545290 3:190718741-190718763 GACAAATCTGAGCCTACTCAAGG - Intergenic
969835898 4:9841259-9841281 AACAAAGCTGATCCAACACAAGG - Intronic
974493260 4:62594325-62594347 ATAAAAGCTCACCCTACTCCGGG + Intergenic
976458023 4:85272545-85272567 AACAAAGCTGACAATAATCAAGG + Intergenic
979045756 4:115861071-115861093 AGGAAAGCTTACCCAACTCTTGG - Intergenic
980006592 4:127549822-127549844 AGAAGAGCTGACTATACTCAGGG - Intergenic
986079261 5:4372622-4372644 AGCAGAACTGACCATCCTCATGG - Intergenic
989124881 5:38042797-38042819 GGCAAAGCTGAACTTACTAAAGG + Intergenic
998441924 5:142169813-142169835 AGCAGAGCGGGCCCTTCTCAGGG - Intergenic
999582228 5:153051485-153051507 ATCAGAGCTGACCCTTCTCCTGG + Intergenic
1001215933 5:169855745-169855767 AGGAAAGCTGCTCCTACTCTTGG + Intronic
1006436551 6:34028773-34028795 ACCACAGCTGGCCCTTCTCAGGG + Intronic
1009593474 6:65705321-65705343 AGCATAGCTTAACGTACTCAGGG + Intronic
1009915840 6:69994882-69994904 AGCATATCTGACCCTGCCCACGG + Intronic
1011402457 6:86978546-86978568 ACCAAAGCTGACTCTACTTCTGG + Intronic
1013582073 6:111545483-111545505 AGCCAAGCTGACCCTCTTCAGGG + Intergenic
1015380108 6:132557548-132557570 AACAAAGCTGACCACATTCAAGG + Intergenic
1022067508 7:26874637-26874659 ACGAAAGCTGACCCTTCTGATGG - Intronic
1024105605 7:46081855-46081877 AGCAAAGCTGCCAGTCCTCATGG - Intergenic
1024482120 7:49874730-49874752 AGCAAAGGTGCCCCAACTCAAGG - Intronic
1028357590 7:89927976-89927998 AGCAAAGCTGACTAGGCTCATGG + Intergenic
1034548504 7:151805100-151805122 AGCACAGCTGCCCCAACTCAAGG - Intronic
1036205393 8:6802031-6802053 AGCAAGCTTGACCCTCCTCAGGG + Intergenic
1042318578 8:67451096-67451118 AGTGGAGCTGACCCTGCTCAGGG + Intronic
1042670105 8:71252645-71252667 AGGAAAGATGACCCAACTCTAGG + Intronic
1044181245 8:89198054-89198076 AGGAAAGCTAACCCCAATCATGG - Intergenic
1045282090 8:100758108-100758130 AGCCCAGCTTCCCCTACTCATGG + Intergenic
1045499245 8:102732266-102732288 AGCAAGGCAGACCCTGCTGAGGG - Intergenic
1048847965 8:138617418-138617440 CCCAGAGCTGAACCTACTCAGGG - Intronic
1050647060 9:7731646-7731668 AGCACAGCTGATCCAACTCAAGG + Intergenic
1052414904 9:28165755-28165777 ACCAAATCTTACCCTACTAAAGG + Intronic
1053376352 9:37609849-37609871 AGGAAAGCCAAGCCTACTCAGGG + Intronic
1053510794 9:38686493-38686515 ATCAAAACTGAACCTTCTCATGG - Intergenic
1054947573 9:70812106-70812128 AGCAGAGCTGTTCATACTCATGG - Intronic
1055742790 9:79408085-79408107 AGCAAATCTGGGCCTACTCAGGG + Intergenic
1056272672 9:84961977-84961999 AGCAAAGAAGACCCCACTCCTGG - Intronic
1057230629 9:93319447-93319469 AGCAGAGCTGACCGTGCTCGGGG - Intronic
1058781836 9:108345097-108345119 AGCAAATATAACCCTAGTCAGGG + Intergenic
1060169794 9:121452303-121452325 GGCAAAGCTGCCCTGACTCAGGG - Intergenic
1197653120 X:129086880-129086902 AGCCATGCAGACCCTAATCAGGG + Intergenic