ID: 1082896873

View in Genome Browser
Species Human (GRCh38)
Location 11:58201137-58201159
Sequence ACCCTCAAACTGATGGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082896873_1082896879 5 Left 1082896873 11:58201137-58201159 CCTACTACCATCAGTTTGAGGGT No data
Right 1082896879 11:58201165-58201187 TTTTAACACATGAATTTTGGGGG 0: 6
1: 140
2: 778
3: 2332
4: 4435
1082896873_1082896878 4 Left 1082896873 11:58201137-58201159 CCTACTACCATCAGTTTGAGGGT No data
Right 1082896878 11:58201164-58201186 ATTTTAACACATGAATTTTGGGG 0: 3
1: 90
2: 585
3: 1863
4: 4330
1082896873_1082896880 6 Left 1082896873 11:58201137-58201159 CCTACTACCATCAGTTTGAGGGT No data
Right 1082896880 11:58201166-58201188 TTTAACACATGAATTTTGGGGGG No data
1082896873_1082896877 3 Left 1082896873 11:58201137-58201159 CCTACTACCATCAGTTTGAGGGT No data
Right 1082896877 11:58201163-58201185 GATTTTAACACATGAATTTTGGG 0: 5
1: 83
2: 504
3: 1799
4: 3883
1082896873_1082896876 2 Left 1082896873 11:58201137-58201159 CCTACTACCATCAGTTTGAGGGT No data
Right 1082896876 11:58201162-58201184 GGATTTTAACACATGAATTTTGG 0: 7
1: 80
2: 578
3: 1656
4: 3622

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082896873 Original CRISPR ACCCTCAAACTGATGGTAGT AGG (reversed) Intergenic
No off target data available for this crispr