ID: 1082897144

View in Genome Browser
Species Human (GRCh38)
Location 11:58204043-58204065
Sequence TACTCAGGAAAAGCACAAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082897140_1082897144 -1 Left 1082897140 11:58204021-58204043 CCAACCACAGTGACCACATACAT 0: 1
1: 0
2: 13
3: 25
4: 226
Right 1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1082897136_1082897144 19 Left 1082897136 11:58204001-58204023 CCACAATGATGAGCCCGTTCCCA 0: 2
1: 0
2: 0
3: 5
4: 88
Right 1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1082897138_1082897144 5 Left 1082897138 11:58204015-58204037 CCGTTCCCAACCACAGTGACCAC 0: 1
1: 0
2: 4
3: 32
4: 324
Right 1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1082897137_1082897144 6 Left 1082897137 11:58204014-58204036 CCCGTTCCCAACCACAGTGACCA 0: 1
1: 1
2: 1
3: 13
4: 213
Right 1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1082897141_1082897144 -5 Left 1082897141 11:58204025-58204047 CCACAGTGACCACATACATACTC 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG 0: 1
1: 0
2: 3
3: 26
4: 248
1082897139_1082897144 0 Left 1082897139 11:58204020-58204042 CCCAACCACAGTGACCACATACA 0: 1
1: 0
2: 4
3: 20
4: 237
Right 1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG 0: 1
1: 0
2: 3
3: 26
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082897144 Original CRISPR TACTCAGGAAAAGCACAAAG AGG Exonic
901241385 1:7695777-7695799 TACTTAGAAAAAGAAAAAAGTGG - Intronic
901938477 1:12644378-12644400 TTCTCAGGGTAAGCACAAAAAGG - Intergenic
902725536 1:18333430-18333452 GACCCAGGAAAAACACAAAATGG + Intronic
903512038 1:23883479-23883501 TACGAAGGAATACCACAAAGTGG + Intronic
904768204 1:32866588-32866610 AAATCAGGAAAAACACAGAGAGG - Intronic
905298946 1:36972903-36972925 CACTCAGGGAAAGCACATGGGGG + Intronic
906261708 1:44396705-44396727 ACCTCAGGAAAAACTCAAAGTGG + Intergenic
907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG + Intronic
908925139 1:69244902-69244924 TATTAAGAAAAAGCACAAACCGG - Intergenic
909357206 1:74723546-74723568 TACCCAGGAAAAGGAGAAAACGG - Intronic
909881753 1:80888765-80888787 TAGTCAAGGAAAGAACAAAGTGG + Intergenic
910272247 1:85409290-85409312 GACTCAAGAAAACCACATAGGGG - Intronic
910885150 1:91956319-91956341 AACTCAGGAAAAGCAGGCAGGGG - Intronic
912618209 1:111128461-111128483 AACTCAGAAAAAGAACTAAGTGG + Intronic
915687339 1:157646880-157646902 CATTCAGGAAATGCACACAGAGG - Intergenic
915868844 1:159535908-159535930 CAGTTAGGAAAACCACAAAGAGG + Exonic
917630843 1:176889908-176889930 CAGTCAGGCAAAGCATAAAGTGG - Intronic
918554967 1:185787843-185787865 TACTAAGGTAAAGCTCAGAGAGG + Intronic
919050847 1:192509527-192509549 TACTAAGGACAAGCACAAGCAGG + Intergenic
919296768 1:195711237-195711259 TACTCATGAAATGGATAAAGTGG - Intergenic
920452059 1:206066907-206066929 TACTGAGATTAAGCACAAAGTGG - Intronic
1063701675 10:8390460-8390482 TACTCAGCAACAGAAGAAAGTGG - Intergenic
1063888384 10:10602975-10602997 GGCCCAGGGAAAGCACAAAGAGG + Intergenic
1065865623 10:29912757-29912779 TTCTCATGAAGAGCACCAAGTGG - Intergenic
1066164773 10:32774700-32774722 TAACCAGGAAAATCACAGAGTGG - Intronic
1066342925 10:34553493-34553515 TTCTCAGCAAAACCACACAGAGG + Intronic
1066571575 10:36778821-36778843 AACACAGGAGAGGCACAAAGTGG - Intergenic
1068711182 10:60135765-60135787 TACTAAAGAAAATCAGAAAGTGG + Intronic
1069322662 10:67191958-67191980 TATTCTGTAAAAGCACAATGGGG + Intronic
1070237710 10:74647285-74647307 TACTCAAGAACCACACAAAGAGG - Intronic
1072523438 10:96250297-96250319 TCCTCAGGAAAAGGAGAAAAGGG - Intronic
1075269823 10:121038913-121038935 AAATCAGGAAAAGCACAACCAGG - Intergenic
1075864521 10:125706101-125706123 CACTCAGGAAAGGCAGAATGTGG - Intergenic
1076356700 10:129858500-129858522 TCCTTAGGAAAAACACCAAGTGG + Intronic
1076448147 10:130532760-130532782 TATTGAGGAAAAACACACAGTGG - Intergenic
1077030586 11:464281-464303 GACTCAAGAAAAGCAAAACGGGG - Intronic
1078521843 11:12069878-12069900 TATTAAAGAAAAGGACAAAGTGG + Intergenic
1078824968 11:14920764-14920786 TAGTCAGGCAAAGGAAAAAGGGG - Intronic
1080439640 11:32280019-32280041 TACTCAGGGATAGCACAATGGGG + Intergenic
1081797215 11:45829008-45829030 TCCTAATGAAAAGCCCAAAGGGG + Intergenic
1082726229 11:56740253-56740275 CACCCAGGAACACCACAAAGAGG - Intergenic
1082868097 11:57918134-57918156 TGAGCAGGAAGAGCACAAAGAGG + Intergenic
1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG + Exonic
1082898143 11:58214861-58214883 TACCCAAGAAAAGCACAAAGAGG - Exonic
1085779695 11:79396968-79396990 TGCTCAGGAGAAACTCAAAGAGG - Intronic
1089487873 11:118861122-118861144 TTCTCAGGGCCAGCACAAAGTGG - Intergenic
1090144430 11:124305540-124305562 GACTCGGGAAAAGCAAAAGGGGG + Intergenic
1091548153 12:1518357-1518379 TACTGAGGGACAGCAGAAAGGGG + Intergenic
1092500751 12:9044362-9044384 TACTCAAAAAAAGTACAAACAGG + Intergenic
1092760882 12:11810142-11810164 TACTCAGGACCAGCTCACAGAGG - Intronic
1093839206 12:23875418-23875440 TAATCAGGAAAAACACAGTGGGG - Intronic
1095324046 12:40865762-40865784 TACTGAGAAGAAGCACAAAGTGG - Intronic
1096637680 12:52971435-52971457 TACTAAGGAAAACCACAGTGGGG - Intergenic
1097730017 12:63117969-63117991 TAATAAATAAAAGCACAAAGTGG + Intergenic
1097992081 12:65846250-65846272 TACTAAGGAAATGCTCAAAAGGG - Intronic
1098453552 12:70647168-70647190 TACTCAGGAAGAAAAAAAAGAGG + Intronic
1098600268 12:72323353-72323375 TTCTAAGGAACAACACAAAGTGG - Intronic
1098847851 12:75560250-75560272 TTCCCAGGAAAAGCACTGAGTGG + Intergenic
1098885913 12:75960810-75960832 TACTCAGAAGAAGCACCAAAAGG - Intergenic
1099868013 12:88308592-88308614 TACTAAGAAAAAGCAAAAATAGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1101883845 12:108644521-108644543 TATTCAGAAAAAGCAAACAGTGG + Intergenic
1102345991 12:112161774-112161796 TTCTGAGGAAAAGCCCACAGTGG - Exonic
1103033606 12:117638700-117638722 TAATCAGGAAATGCACATCGGGG + Intronic
1104537132 12:129628697-129628719 TACTAAGGAAAAGCACAGTGTGG + Intronic
1104764972 12:131324178-131324200 TATTCAGGAAATGCATAAAAGGG - Intergenic
1106771763 13:32968221-32968243 AACACAAGAAAAGAACAAAGAGG - Intergenic
1107480441 13:40781597-40781619 TAATCAAGAAAAGCACAAAAAGG - Intergenic
1109507044 13:63316140-63316162 TACTCAGGAAGTTCACAGAGTGG - Intergenic
1109736233 13:66487775-66487797 AACTCAGGAAAAGTAAAAAGTGG - Intronic
1110664563 13:78101676-78101698 TCCTCAGTAAAAACACAAAAAGG - Intergenic
1111301505 13:86356426-86356448 GACTCAGGGAAAGCACAAAGTGG + Intergenic
1117102744 14:52367018-52367040 TGATCAGGAAAGGGACAAAGTGG + Intergenic
1117282094 14:54251483-54251505 TACTCTGGAAAAGCAAACAGTGG + Intergenic
1117403316 14:55377531-55377553 ACTTCAGGAAAAGCACAAAAAGG + Intronic
1117675235 14:58149051-58149073 TGGTCATGAAAAGGACAAAGTGG - Intronic
1124008539 15:25814530-25814552 TACTGAGGAAAAGGGCAAATGGG - Intronic
1126230532 15:46318155-46318177 TACTGATGAAAAGCACAGGGCGG - Intergenic
1126898845 15:53290254-53290276 TTATCAGGAAAAGCACAAATTGG + Intergenic
1126952316 15:53894418-53894440 TAATCAGGAAAGGGATAAAGGGG - Intergenic
1127026267 15:54810508-54810530 TACTGAAGAAAAAAACAAAGGGG + Intergenic
1127050671 15:55080356-55080378 TACTCAAAAAAATCACAAAAAGG + Intergenic
1127128982 15:55842287-55842309 TACTCAGGGAAAACACAACTAGG + Intronic
1127192859 15:56550160-56550182 TCTTCAGGAAATGCACAAGGAGG - Intergenic
1127526455 15:59797143-59797165 TACTTATGAAAAGGACAAAATGG + Intergenic
1130627671 15:85532492-85532514 TAATCAGGCAGAGCACAAAGTGG + Intronic
1131157242 15:90082656-90082678 TACTCAGGAAAAGCAAGCGGGGG + Intergenic
1132861187 16:2072609-2072631 CACTTAGGAAAAGCACAGATGGG - Intronic
1133065571 16:3204324-3204346 TGCTGAGGAAGAACACAAAGAGG - Exonic
1133067043 16:3215688-3215710 TGCTGAGGAAGAACACAAAGAGG - Intergenic
1133363922 16:5196101-5196123 TGCTCATGTGAAGCACAAAGGGG - Intergenic
1135611495 16:23871516-23871538 TAGTCAGGGAAGGCTCAAAGAGG - Intronic
1135723477 16:24836408-24836430 TACTGAGAAAAAGCACAAACAGG - Intergenic
1137833107 16:51563285-51563307 GACCCACGAAAAGCACACAGTGG - Intergenic
1138044388 16:53705690-53705712 TATTAAAGATAAGCACAAAGAGG + Intronic
1138077970 16:54061550-54061572 TCATCAGGATAAGAACAAAGCGG + Intronic
1138335469 16:56249513-56249535 TGATCAGGGAAAGCACCAAGGGG + Intronic
1140051416 16:71484587-71484609 ACCTCAGGAAAAACAGAAAGCGG + Exonic
1141434197 16:83989948-83989970 TACTAAGGAAAATGACAAAACGG - Intronic
1142268052 16:89073811-89073833 TACTCAGGAAAGGCAGCAACAGG - Intergenic
1142501084 17:333513-333535 TACTGTGGGAAAGCACAAGGTGG - Intronic
1142698406 17:1645765-1645787 TCCTCAGGAAAAGCCCTGAGAGG - Intergenic
1145118814 17:20237105-20237127 TTCTGAGGAAAAGTAAAAAGAGG - Intronic
1146745744 17:35327898-35327920 TAATAAAAAAAAGCACAAAGAGG - Intergenic
1147968823 17:44208725-44208747 TACTCAACCAAAGCACAGAGGGG + Intronic
1149283462 17:55133537-55133559 TACGCAGGAAAAGAACAGAAAGG + Intronic
1150990508 17:70252243-70252265 AAGTGAGGAAAACCACAAAGGGG - Intergenic
1151801249 17:76381251-76381273 TTCTCGGGAAAAGAAAAAAGGGG + Intronic
1153458615 18:5308840-5308862 AACTCAGGAAAAACAGAAACTGG + Intergenic
1153464831 18:5377875-5377897 GACTCAGGAAAAGCAGAGAAAGG + Intergenic
1155045666 18:22100953-22100975 TACTGAGGAAAAGATCATAGAGG + Intergenic
1155355148 18:24944692-24944714 AAATGAGGAAAAGCAAAAAGTGG + Intergenic
1156117619 18:33805131-33805153 TAATCAGGAAAAGTACCAGGTGG + Intergenic
1156240198 18:35246548-35246570 TACTCAGGAAATACGAAAAGTGG + Exonic
1157157606 18:45282897-45282919 AACTCAGTACAATCACAAAGGGG - Intronic
1159687144 18:71436575-71436597 TACTCAGGAAAGGCTCTTAGGGG + Intergenic
1159885975 18:73907267-73907289 AACTGAGAAAAAGCACAATGAGG + Intergenic
1160090574 18:75823108-75823130 TCCTCAGGAAAGGGAGAAAGGGG - Intergenic
1162801535 19:13113493-13113515 TACTTAGGAAAAGCACCATGTGG + Intronic
925717555 2:6798254-6798276 TCCCCAGGAAAAGCAAAATGAGG + Intergenic
926882644 2:17564251-17564273 GACTCAAGGAAGGCACAAAGTGG - Intronic
927424392 2:22964995-22965017 TACTCAGCAAAAGCAAATAAAGG - Intergenic
928540395 2:32278561-32278583 TACTCAGAAAAAGGACAGATTGG + Intronic
928718936 2:34096929-34096951 TACCCAGGTCAAGAACAAAGTGG - Intergenic
929299266 2:40283590-40283612 AACAAAGGCAAAGCACAAAGAGG + Intronic
929453399 2:42050761-42050783 TACCCAGGAAAAGTGAAAAGTGG + Intronic
930202754 2:48560605-48560627 TTCTCAGGAGCAGCACGAAGAGG - Intronic
931906043 2:66845169-66845191 TACTCAGGGTAAGCAGAAGGAGG + Intergenic
932505819 2:72230627-72230649 TACTAAGGAAAAGAAGAAATAGG + Intronic
933865329 2:86510778-86510800 CACCCAGGAAAATCACAAATGGG + Intronic
933993863 2:87653219-87653241 TCCTCAGGAGGAACACAAAGTGG + Intergenic
936300000 2:111297664-111297686 TCCTCAGGAGGAACACAAAGTGG - Intergenic
936909288 2:117574141-117574163 GCCTCAGGAAATGTACAAAGGGG + Intergenic
937195059 2:120146993-120147015 TACTCAGCAAAAGTACTAATTGG + Intronic
937499153 2:122459573-122459595 GAAGCATGAAAAGCACAAAGAGG + Intergenic
937708509 2:124949984-124950006 TATTCAGGAAATGGACAAATTGG + Intergenic
938777943 2:134558626-134558648 TACCTTGGAAATGCACAAAGAGG + Intronic
940215368 2:151297984-151298006 TCCTCAGGAAAAGCACACCAGGG - Intergenic
943292332 2:186090089-186090111 TACTCAGGAAAAGACTAAAAAGG + Intergenic
943790340 2:191924417-191924439 TAATCAGGAAAATCACGAAGAGG - Intergenic
944424843 2:199569700-199569722 TACCCTGGAAAAGAACAAATAGG + Intergenic
1169584976 20:7071368-7071390 TACTAAGGAAAATAACACAGTGG - Intergenic
1171025109 20:21623303-21623325 TACTCAGGAACAGGAAGAAGAGG + Intergenic
1172792194 20:37513456-37513478 TGCTCAGGAAAAGTACTGAGAGG + Intronic
1174224676 20:48987581-48987603 TTCTCAGGAACAGGACAAGGTGG + Intronic
1174703521 20:52633487-52633509 TACCAAGGAAAATCAGAAAGAGG - Intergenic
1177631671 21:23736465-23736487 GACTCATGACAAGCACAAGGTGG + Intergenic
1178496792 21:33093134-33093156 CACTCAGGAAACGCACCAACTGG + Intergenic
1179088119 21:38238334-38238356 TACTCAGGAAAGGCAGCCAGTGG + Intronic
1182432136 22:30305614-30305636 TTCTCAGGAACAGGACACAGTGG + Intronic
1182972656 22:34592379-34592401 TACTGAGGACAAGCACAATTAGG + Intergenic
949163555 3:910506-910528 CACCCAGGAAAAGGGCAAAGAGG + Intergenic
951076815 3:18403899-18403921 TAGTCAGGACATGCACAAAGGGG - Intronic
951765520 3:26194156-26194178 TACTCAGGATTAGCTCAAAAGGG + Intergenic
952266135 3:31788398-31788420 GAATCAGGAAAAGGACTAAGTGG - Intronic
952823170 3:37502569-37502591 AACTAAGGAAAAACACAAACTGG - Intronic
953121375 3:40045846-40045868 TAGTAAGGAAAAACAGAAAGGGG + Intronic
953133996 3:40167152-40167174 TCCTCAGGACAAGCAAAATGAGG + Exonic
953362115 3:42306683-42306705 AAGTGAGGAAAACCACAAAGGGG - Intergenic
955087716 3:55719584-55719606 TACTTGCCAAAAGCACAAAGAGG + Intronic
956288808 3:67639758-67639780 TTCTCAGGAAAAACTCAAAGGGG - Intronic
957310703 3:78515114-78515136 TACTCAGCAAAATGATAAAGAGG - Intergenic
957812749 3:85247745-85247767 GACACAGGAAGAGCATAAAGTGG - Intronic
958035489 3:88165472-88165494 TAGTGAAGAAAAGTACAAAGTGG + Intronic
958859268 3:99425838-99425860 TAGGCAGGAAAAGAAAAAAGAGG - Intergenic
959011522 3:101082746-101082768 TACTCAAGTAAAGAACAATGAGG + Intergenic
959656555 3:108812365-108812387 TACTCAGGAAAAAAAAAAAAAGG - Intergenic
959825224 3:110786345-110786367 TCCTCAGAAAAAGAACAAAGTGG - Intergenic
960040567 3:113146302-113146324 AACTCAGGCAAAGCTCCAAGAGG - Intergenic
960121679 3:113953676-113953698 TATTCAGAAAAAGCACAAAGAGG - Intronic
960812580 3:121638512-121638534 TACTCAGGAAAATCATGAAGGGG + Intronic
960900739 3:122551779-122551801 TACTTAGGAAAAGGCCAACGAGG + Intronic
960979498 3:123209266-123209288 TAATCAGTAGAAGCAGAAAGTGG - Exonic
962934900 3:140071292-140071314 TAGTCAGTAAAATCACAAAAAGG + Intronic
963806452 3:149727779-149727801 TATTCCAGAAAACCACAAAGAGG - Intronic
964061098 3:152523955-152523977 TACTCTGGACAGGAACAAAGAGG + Intergenic
964162937 3:153667842-153667864 TACTGAAGAAACGCACAAAGAGG - Intergenic
964537772 3:157743526-157743548 TAATCAGGAAACCCACAGAGTGG - Intergenic
965802504 3:172508997-172509019 GCCTCAGGAAAATTACAAAGTGG - Intronic
967829516 3:193906833-193906855 TACTCAGGAAGAAAAAAAAGAGG - Intergenic
969117582 4:4881287-4881309 AACTCAGGAAATGGGCAAAGGGG - Intergenic
971835741 4:31760695-31760717 TACCCAGGACAGGCACAATGTGG + Intergenic
971966838 4:33570024-33570046 TACTTAGGAAGAGTAGAAAGAGG + Intergenic
972400319 4:38695891-38695913 TACTCAGAAAATTTACAAAGAGG + Intronic
974710840 4:65592553-65592575 TACACAAGGAAAGCACAAAGTGG + Intronic
974740975 4:66007473-66007495 TACTAAGTATAAGCAGAAAGAGG - Intergenic
976391704 4:84512259-84512281 TATTTAGGAACAGCAAAAAGGGG + Intergenic
979643485 4:123037968-123037990 AACTGAGGCAAAGTACAAAGAGG - Intronic
980481423 4:133393027-133393049 GACACAGGATAAGCACAAAAGGG - Intergenic
981012813 4:139943286-139943308 TTGACAGGAAAAGAACAAAGAGG + Intronic
982322092 4:154087797-154087819 TACACAGGAAAATGACAAAATGG - Intergenic
982988459 4:162240043-162240065 TATTCAGCACAAGCACAAAGAGG - Intergenic
983381399 4:166999062-166999084 TACTAGGGGAAAGCACAAATGGG - Intronic
983714401 4:170760405-170760427 TCTTCAGGAGAAGCACAAAGAGG - Intergenic
984007785 4:174334375-174334397 TACTCTGGCCAGGCACAAAGTGG + Intergenic
987038554 5:14040814-14040836 TACTCAGGATAAGAATAAGGAGG + Intergenic
987470264 5:18319353-18319375 TAATCAGGAAAGGCTCACAGTGG + Intergenic
988293370 5:29320155-29320177 GACACAGAAAAAGCACAGAGTGG + Intergenic
989071162 5:37513217-37513239 TACTAAGGTAAAGAACAATGTGG + Intronic
991190487 5:63867581-63867603 CACTGAAGAAGAGCACAAAGTGG - Intergenic
993508194 5:88737096-88737118 TATTCAGGAAAGGCACTAAAAGG + Intronic
994493896 5:100485789-100485811 TTCTCAGGAAAACATCAAAGAGG + Intergenic
995231201 5:109765816-109765838 AACTCAGGAAAAGACCAAAGAGG - Intronic
996509071 5:124298865-124298887 TTCACAAGAAAAGCACCAAGAGG + Intergenic
1000060220 5:157648666-157648688 GATTAAGGAAAAGCACAGAGAGG - Exonic
1001438125 5:171716308-171716330 TCCTCAGGAAAACCACAACTGGG - Intergenic
1001746701 5:174098150-174098172 TGCTGAGGAAAGGCACACAGGGG + Intronic
1003060284 6:2857572-2857594 TTCTCAGGGAAAGCAAGAAGGGG - Intergenic
1004430818 6:15541148-15541170 GACTATGAAAAAGCACAAAGCGG + Intronic
1005087871 6:22025520-22025542 AGCTCAGGGAAATCACAAAGAGG - Intergenic
1005450736 6:25969483-25969505 GATTGAGGAAAAGCACAATGAGG + Intronic
1006655060 6:35583980-35584002 TTCCCAGGAGAAGCACAAGGGGG + Intronic
1009788844 6:68373414-68373436 TAATCAGGAAACATACAAAGGGG - Intergenic
1010515452 6:76768473-76768495 CACTCAGGAAACACACAGAGGGG - Intergenic
1011966428 6:93163426-93163448 CACACAGGAAAAACACAAATAGG - Intergenic
1014270916 6:119335003-119335025 TCCTCAGGAAAACCATAGAGAGG - Intronic
1014671548 6:124311142-124311164 TACTCAGTGAAAGCAGAAAGAGG + Intronic
1014801256 6:125780418-125780440 GACTCAGAACAAGAACAAAGTGG - Intergenic
1015160493 6:130147637-130147659 TACTTAGGAAATACACAATGAGG - Intronic
1015339430 6:132080808-132080830 GACTCAGCAAAAGAACAAATAGG - Intergenic
1015464761 6:133536381-133536403 TACTGATGAAAAGCTCATAGAGG - Intergenic
1015703695 6:136064213-136064235 TATAAAGGAAAAGCACAAACAGG + Intronic
1015749352 6:136544594-136544616 AGCTCAGAAAAACCACAAAGGGG - Intronic
1015763754 6:136693353-136693375 AATTCTGGAAAAGCACAAGGTGG - Intronic
1015827752 6:137333393-137333415 TACACAGGAAAAGAAGCAAGTGG + Intergenic
1017828821 6:158105722-158105744 TACTAAGAGAAAGCACAAAATGG - Intergenic
1019571740 7:1716052-1716074 CACTGAGGAAGAGCACAGAGAGG - Intronic
1021377012 7:19920896-19920918 TACTCAGTAGAAGCACCAGGGGG - Intergenic
1023421671 7:39986539-39986561 TAGAAAGGAAAAGCACAGAGAGG - Intronic
1023900279 7:44471573-44471595 TGCACAGGAAAGGCACATAGAGG + Intronic
1024046314 7:45587935-45587957 TCCTTTGGAAAAGCACAAAATGG - Intronic
1026164983 7:67901552-67901574 AACACAGGAAAACCCCAAAGTGG + Intergenic
1027654717 7:80916318-80916340 TGCTGAGGATTAGCACAAAGGGG + Intronic
1028440278 7:90851748-90851770 TATTCAAGAAAATGACAAAGGGG - Intronic
1030879040 7:114853338-114853360 TATCCAGGAAAAGCACTAGGAGG + Intergenic
1031374614 7:121008940-121008962 TACTGAAGAAAAGCACCCAGTGG - Intronic
1033428385 7:141265996-141266018 CACTCAGGACAAGCTCACAGGGG - Intronic
1033928447 7:146493271-146493293 TATTCAGGAAGAGCAAAAATGGG - Intronic
1034293918 7:149954759-149954781 CTCCCAGGAAAAGTACAAAGAGG - Intergenic
1034501270 7:151452391-151452413 TCATCAGGAAAAGCAAAGAGAGG - Intergenic
1034812150 7:154142100-154142122 CTCCCAGGAAAAGTACAAAGAGG + Intronic
1036074602 8:5481803-5481825 TAGTGAGGAAGAGCACAGAGTGG - Intergenic
1037459942 8:19098715-19098737 TACTCAGGAAAAAAAGAAAGAGG - Intergenic
1038467314 8:27775978-27776000 TACCCAGGAAAAGCCCCAGGGGG + Intronic
1041214143 8:55583122-55583144 TACTCAGGCAGAGCTCAAGGAGG - Intergenic
1042786791 8:72556716-72556738 TAGTCAGGGAAAGAACAAAAAGG + Intronic
1045355171 8:101380491-101380513 CACTCATCTAAAGCACAAAGAGG - Intergenic
1047461873 8:125073137-125073159 GACTCAGGTAATGCACAAAAGGG - Exonic
1048872847 8:138813121-138813143 GACTCAGGAAGACCCCAAAGAGG - Intronic
1050268520 9:3916967-3916989 TATTCAGCAAGGGCACAAAGAGG + Intronic
1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG + Exonic
1050965309 9:11794276-11794298 TGCTCAGGCACAGAACAAAGAGG - Intergenic
1055185655 9:73450306-73450328 TATTCAGGAGAGGCACAAAAAGG - Intergenic
1055644663 9:78351634-78351656 TACTGAGCAAACGCACCAAGAGG + Intergenic
1056456618 9:86766651-86766673 TACCCAAGAAAAGCGCAAGGGGG - Intergenic
1056707233 9:88961573-88961595 TAAAAAGGAAAAGTACAAAGAGG - Intergenic
1056852853 9:90098568-90098590 TTCTCAGCAACAGCACAGAGAGG - Intergenic
1058132644 9:101270137-101270159 TGCTCAGGAAGAGAAGAAAGAGG - Intronic
1061643252 9:131976977-131976999 TAAACAGGAAAAGCACTAATTGG + Intronic
1185535362 X:857193-857215 TACCCAGGAAAAGCAAAAACTGG + Intergenic
1185996383 X:4954572-4954594 TACTGAAGAAAATCACAAACTGG - Intergenic
1186878415 X:13839883-13839905 TATTCTGAAAAAGAACAAAGAGG + Intronic
1186951181 X:14627202-14627224 TATTCTGGAAAAGGAAAAAGAGG - Intronic
1187356561 X:18578700-18578722 TCCTGAGGAAAAGCACTTAGAGG - Intronic
1188580327 X:31703799-31703821 TTCTCCAGAAAAGCAAAAAGAGG + Intronic
1189145992 X:38655275-38655297 CATTTTGGAAAAGCACAAAGAGG - Intronic
1189986417 X:46557532-46557554 TAGAGAGGAAAAGCACAATGTGG + Intergenic
1190724022 X:53175004-53175026 TACAAAGGAAAACCACAAAATGG + Intergenic
1192286430 X:69742985-69743007 TAATCAGGTAAAGAAAAAAGAGG - Intronic
1193351092 X:80465293-80465315 TCCTCAGCAAAAGCAAAAAATGG + Intergenic
1193375946 X:80761471-80761493 TACTGAGGAAAGGCAAAAAGTGG + Intronic
1193879453 X:86903305-86903327 TACTCCTGAAAAGCATTAAGAGG - Intergenic
1194539251 X:95150225-95150247 TACTCAGGAAAACTAAAAGGAGG - Intergenic
1194917304 X:99722137-99722159 AACTCTGGAAAAGGGCAAAGTGG + Intergenic
1195561145 X:106285295-106285317 TTCTCAGGAAAAGCAAATAGTGG + Intergenic
1195906655 X:109850986-109851008 AACACAAAAAAAGCACAAAGAGG + Intergenic
1197650382 X:129057552-129057574 AACTCAGGAGAGGAACAAAGAGG + Intergenic
1197743355 X:129913112-129913134 TAAAGAGGAGAAGCACAAAGAGG - Intronic