ID: 1082898037

View in Genome Browser
Species Human (GRCh38)
Location 11:58213888-58213910
Sequence ACAGCCTATCAGGGCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082898037_1082898043 1 Left 1082898037 11:58213888-58213910 CCTCCTCTGCCCTGATAGGCTGT No data
Right 1082898043 11:58213912-58213934 TCTGGATTGGAATCTCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082898037 Original CRISPR ACAGCCTATCAGGGCAGAGG AGG (reversed) Intergenic
No off target data available for this crispr