ID: 1082898143

View in Genome Browser
Species Human (GRCh38)
Location 11:58214861-58214883
Sequence TACCCAAGAAAAGCACAAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 313}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082898143_1082898145 -1 Left 1082898143 11:58214861-58214883 CCTCTTTGTGCTTTTCTTGGGTA 0: 1
1: 0
2: 3
3: 29
4: 313
Right 1082898145 11:58214883-58214905 ATGTACCTGGTCACTGTGATTGG 0: 1
1: 5
2: 12
3: 48
4: 190
1082898143_1082898148 5 Left 1082898143 11:58214861-58214883 CCTCTTTGTGCTTTTCTTGGGTA 0: 1
1: 0
2: 3
3: 29
4: 313
Right 1082898148 11:58214889-58214911 CTGGTCACTGTGATTGGGAACGG 0: 1
1: 0
2: 3
3: 25
4: 233
1082898143_1082898149 6 Left 1082898143 11:58214861-58214883 CCTCTTTGTGCTTTTCTTGGGTA 0: 1
1: 0
2: 3
3: 29
4: 313
Right 1082898149 11:58214890-58214912 TGGTCACTGTGATTGGGAACGGG 0: 1
1: 1
2: 0
3: 10
4: 141
1082898143_1082898146 0 Left 1082898143 11:58214861-58214883 CCTCTTTGTGCTTTTCTTGGGTA 0: 1
1: 0
2: 3
3: 29
4: 313
Right 1082898146 11:58214884-58214906 TGTACCTGGTCACTGTGATTGGG 0: 1
1: 1
2: 4
3: 22
4: 174
1082898143_1082898150 19 Left 1082898143 11:58214861-58214883 CCTCTTTGTGCTTTTCTTGGGTA 0: 1
1: 0
2: 3
3: 29
4: 313
Right 1082898150 11:58214903-58214925 TGGGAACGGGCTCATCATTGTGG 0: 2
1: 0
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082898143 Original CRISPR TACCCAAGAAAAGCACAAAG AGG (reversed) Exonic
902567946 1:17326666-17326688 TTCCCAAGCAAAGCACACACGGG - Intronic
902725536 1:18333430-18333452 GACCCAGGAAAAACACAAAATGG + Intronic
905077355 1:35284300-35284322 TACAAAAGAAAAACACAAATTGG - Intronic
905335145 1:37239891-37239913 GGCCAAAGAAAAACACAAAGAGG - Intergenic
905671820 1:39795993-39796015 TGCCTAAGAAAAGCACACATAGG + Intergenic
906584191 1:46961864-46961886 AACCTAAGACAGGCACAAAGAGG - Intergenic
907634561 1:56120736-56120758 AATCCAAGATAAGGACAAAGAGG + Intergenic
909357206 1:74723546-74723568 TACCCAGGAAAAGGAGAAAACGG - Intronic
909486969 1:76185237-76185259 TCCACAAGAAAAGCACAATAAGG - Intronic
909881753 1:80888765-80888787 TAGTCAAGGAAAGAACAAAGTGG + Intergenic
910272247 1:85409290-85409312 GACTCAAGAAAACCACATAGGGG - Intronic
912011709 1:104973862-104973884 TACCAAAGAAAAACACGAAAAGG - Intergenic
913406545 1:118499615-118499637 TACCCAAAAAAAGAATAAAAAGG + Intergenic
913461088 1:119086574-119086596 CACCCCAGTCAAGCACAAAGGGG + Intronic
913867522 1:123899207-123899229 TTCCAAAGAAGACCACAAAGGGG - Intergenic
915777349 1:158504554-158504576 ATCACAAGAACAGCACAAAGGGG + Intergenic
915867786 1:159523374-159523396 TAACCAAGAAAAGAACAGAGAGG - Intergenic
918026014 1:180746969-180746991 TAACCATAAAAATCACAAAGAGG - Intronic
921303749 1:213774698-213774720 TTCCCAAGCAAAGCATAAAAGGG - Intergenic
922856355 1:228778395-228778417 TTCCAAAGAAAAGCTAAAAGAGG + Intergenic
923128598 1:231055215-231055237 CACCTACGAAAAGCACAAAATGG - Intergenic
924696301 1:246403697-246403719 TACCACAGAATATCACAAAGTGG + Intronic
1063100175 10:2943569-2943591 AACCCAATAAAAGCAAACAGAGG + Intergenic
1063888384 10:10602975-10602997 GGCCCAGGGAAAGCACAAAGAGG + Intergenic
1064173345 10:13053266-13053288 TACGTAATAAAAGTACAAAGGGG + Intronic
1064239207 10:13610019-13610041 TCCCTAAGAAAAGCAAAAAAAGG - Exonic
1065384395 10:25119887-25119909 CACACAAGCAAAGCACATAGCGG + Intergenic
1065444116 10:25780120-25780142 AACACAAGAACAGCACCAAGGGG + Intergenic
1066164773 10:32774700-32774722 TAACCAGGAAAATCACAGAGTGG - Intronic
1066705676 10:38175401-38175423 GTCCCAAGAAAAGCACAAGGTGG - Intergenic
1068020719 10:51580455-51580477 TACCGATTAAAAGTACAAAGTGG - Intronic
1068122595 10:52798534-52798556 TAACCAAGAAAAGAAGAAAAAGG - Intergenic
1068375064 10:56167038-56167060 TACCCAAGAAAAATAAAAATAGG - Intergenic
1068670878 10:59722287-59722309 AAGCAAAGAAAAGCATAAAGTGG - Intronic
1068711182 10:60135765-60135787 TACTAAAGAAAATCAGAAAGTGG + Intronic
1070237710 10:74647285-74647307 TACTCAAGAACCACACAAAGAGG - Intronic
1070491970 10:76985760-76985782 TACCCAAGAAAGGCACATTGTGG + Intronic
1070503985 10:77097135-77097157 TAGCCAAGAAAAGCACTACCAGG - Intronic
1070543039 10:77430965-77430987 TTCCCAAGAAAATCATGAAGAGG - Intronic
1071432172 10:85614813-85614835 AACCAAAGAAAACCACAATGGGG - Intronic
1073231871 10:101978495-101978517 TACAAAAGAAAAACACAAACAGG + Intronic
1074370395 10:112896014-112896036 TCCCCAAGACAAGCACAGAGAGG - Intergenic
1074887532 10:117705764-117705786 TTCCCAAAGAAAGCCCAAAGAGG + Intergenic
1075259959 10:120954725-120954747 TACCAAAGAAAAGTGCAATGTGG - Intergenic
1076653953 10:132008879-132008901 TACCAAAGGAAAGCTCATAGTGG + Intergenic
1077030586 11:464281-464303 GACTCAAGAAAAGCAAAACGGGG - Intronic
1078521843 11:12069878-12069900 TATTAAAGAAAAGGACAAAGTGG + Intergenic
1079270487 11:18980816-18980838 TAGCCAATAAAAGAACAGAGAGG - Intergenic
1079519868 11:21313917-21313939 ATCACAAGAACAGCACAAAGTGG - Intronic
1079622346 11:22569129-22569151 TGCCCAAAAAAAGAACAATGGGG + Intergenic
1082726229 11:56740253-56740275 CACCCAGGAACACCACAAAGAGG - Intergenic
1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG + Exonic
1082898143 11:58214861-58214883 TACCCAAGAAAAGCACAAAGAGG - Exonic
1082904159 11:58287862-58287884 TTCACAAGAACAGCACCAAGGGG - Intergenic
1085480349 11:76817279-76817301 TACACAAGCAAAGCCCAGAGGGG + Intergenic
1085743883 11:79098609-79098631 TACGGAAGAAAAGCAGACAGAGG + Intronic
1086502036 11:87463709-87463731 TACCCAAGATGAGCACAACCAGG + Intergenic
1087515999 11:99161984-99162006 TGAGCAAGATAAGCACAAAGAGG - Intronic
1088827079 11:113505036-113505058 TACCCAAGAGTAGAGCAAAGAGG + Intergenic
1090049280 11:123363041-123363063 AACGCAAGAAAAGGCCAAAGAGG + Intergenic
1090951448 11:131476930-131476952 TCCACAAGAATAGCCCAAAGAGG - Intronic
1091442798 12:524557-524579 AATCCAAGGAAAGCAGAAAGAGG - Intronic
1091944906 12:4530744-4530766 TAGACAAGAAAAGCAGAAACAGG + Intronic
1092500751 12:9044362-9044384 TACTCAAAAAAAGTACAAACAGG + Intergenic
1092662170 12:10750281-10750303 TACCCAAGAAATCCACAGGGTGG - Intergenic
1095909417 12:47410849-47410871 TAGAGAAGAAAAGCACAGAGAGG - Intergenic
1097030063 12:56083479-56083501 TACCCAAAAGAAGCACAGAGGGG + Intronic
1097074635 12:56383764-56383786 TTTCCAAGAAATGCCCAAAGTGG - Intergenic
1097429821 12:59491122-59491144 TACCCAAGATAAAAATAAAGTGG - Intergenic
1097730017 12:63117969-63117991 TAATAAATAAAAGCACAAAGTGG + Intergenic
1098847851 12:75560250-75560272 TTCCCAGGAAAAGCACTGAGTGG + Intergenic
1099166442 12:79312730-79312752 TACACAATAAAAGAAAAAAGTGG - Intronic
1099879944 12:88455719-88455741 TACCCAAGAAGACCACCTAGAGG + Intergenic
1101486761 12:105171885-105171907 TGCCCAAGAAAACCACATGGGGG + Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102147523 12:110666116-110666138 TACCAAAGAAAAGATCAATGAGG + Intronic
1102385078 12:112502049-112502071 TGCCCAAAAAAAGAAAAAAGAGG - Intronic
1102603251 12:114049360-114049382 AACCCAAGAAAAGGAGAAACCGG + Intergenic
1103053597 12:117801663-117801685 ATCCCAAGAACAGCACCAAGAGG + Intronic
1104311733 12:127659241-127659263 TACCAAAAAAAAGCACACTGGGG + Intergenic
1104524520 12:129506583-129506605 AACCAAAGAAAAACATAAAGTGG + Intronic
1106134246 13:26962336-26962358 TGCCCAAGCAAAGGATAAAGTGG - Intergenic
1106771763 13:32968221-32968243 AACACAAGAAAAGAACAAAGAGG - Intergenic
1107480441 13:40781597-40781619 TAATCAAGAAAAGCACAAAAAGG - Intergenic
1108545916 13:51493282-51493304 TACCCAAAATAAACAGAAAGAGG + Intergenic
1109681630 13:65758738-65758760 CACCCAAGAAAACCACCTAGAGG + Intergenic
1110756002 13:79174903-79174925 TAGCCAAGAAAAGAAGAGAGAGG + Intergenic
1111301505 13:86356426-86356448 GACTCAGGGAAAGCACAAAGTGG + Intergenic
1112977037 13:105332838-105332860 GCCCCAAGAAAAGGGCAAAGAGG - Intergenic
1113845973 13:113391844-113391866 TGTCCAAGAAAAGCTCAAGGAGG - Intergenic
1113989414 13:114348724-114348746 GACCCAAGAAGAGAACAGAGAGG + Intergenic
1115238483 14:31231708-31231730 AACCAAAGAGAAGCACAGAGGGG - Intergenic
1115378917 14:32711304-32711326 AACCAAAGAAAATCAGAAAGTGG + Intronic
1115539624 14:34408075-34408097 CACCCAACTGAAGCACAAAGAGG + Intronic
1116364387 14:44041275-44041297 TACCCAACAAATCCACAGAGTGG + Intergenic
1117119910 14:52555462-52555484 TCCCCCAGGTAAGCACAAAGTGG + Intronic
1117381431 14:55167588-55167610 TACCCAAGAAAAGAGGAGAGTGG - Intronic
1117688272 14:58278177-58278199 TAACAAAGAAAATAACAAAGAGG + Intronic
1118833238 14:69455205-69455227 TATCCAAGAAACACACAAATAGG + Intronic
1119627829 14:76196882-76196904 TTCCAAACAGAAGCACAAAGAGG - Intronic
1119643165 14:76329800-76329822 TTTCCAATCAAAGCACAAAGCGG + Intronic
1119668605 14:76501597-76501619 CACCAAAGAAAAGCACTATGTGG + Exonic
1120078908 14:80192492-80192514 TAACCAAGAAAAAAACAGAGAGG + Intergenic
1127026267 15:54810508-54810530 TACTGAAGAAAAAAACAAAGGGG + Intergenic
1127050671 15:55080356-55080378 TACTCAAAAAAATCACAAAAAGG + Intergenic
1130788145 15:87123108-87123130 TACCCAAGCAAGGCCCAAAGGGG - Intergenic
1131430475 15:92384277-92384299 TAAAGAAGAAAAGAACAAAGTGG + Intergenic
1133046390 16:3090590-3090612 TAAACAAGAAGAGCCCAAAGGGG - Exonic
1133149424 16:3816484-3816506 AACCCAAGAACAATACAAAGAGG + Intronic
1137833107 16:51563285-51563307 GACCCACGAAAAGCACACAGTGG - Intergenic
1138044388 16:53705690-53705712 TATTAAAGATAAGCACAAAGAGG + Intronic
1139101581 16:63773539-63773561 TACCAAAGAAACACACAAACAGG + Intergenic
1140217506 16:73020315-73020337 TGCCCAAGGAAACCACGAAGAGG + Intronic
1140552229 16:75879259-75879281 TACCAAAGTAAACTACAAAGAGG + Intergenic
1141225387 16:82110196-82110218 AGCACAAGAAAAGCACAAGGAGG + Intergenic
1143990007 17:10949956-10949978 TAACCAAGAAAAACAGAAAGGGG - Intergenic
1144504125 17:15815733-15815755 CACCCAAGCAAGGCACAGAGGGG - Intergenic
1144633869 17:16891362-16891384 CACCCAAGGAAGGCACAGAGGGG - Intergenic
1144819136 17:18059185-18059207 TACCCACCAAAAGCACAGCGAGG - Intronic
1145112201 17:20173853-20173875 GAGCCAAGTAAAGAACAAAGGGG - Intronic
1145167985 17:20631240-20631262 CACCCAAGCAAGGCACAGAGGGG - Intergenic
1146745744 17:35327898-35327920 TAATAAAAAAAAGCACAAAGAGG - Intergenic
1147968823 17:44208725-44208747 TACTCAACCAAAGCACAGAGGGG + Intronic
1148241169 17:46000271-46000293 AAACAGAGAAAAGCACAAAGGGG - Intronic
1149682554 17:58516267-58516289 GACCCAAGAAAAGCAAGAAGAGG + Intronic
1149834457 17:59900231-59900253 TACACAACAAAAACACATAGGGG - Intronic
1150102195 17:62433437-62433459 AAAAAAAGAAAAGCACAAAGAGG + Intronic
1150623652 17:66826728-66826750 TACCCAAGAGAAGTACAAACGGG + Intergenic
1152735895 17:81996633-81996655 CACCCGAGAAAGGAACAAAGGGG - Exonic
1153079149 18:1200521-1200543 CACCCCAAAAAAGCACAAGGAGG - Intergenic
1154217594 18:12426743-12426765 TACCATAGAAAAGGACAAATAGG - Intronic
1154971050 18:21410243-21410265 GGCCCAAGAAAATCATAAAGTGG - Intronic
1156251154 18:35353491-35353513 ATCACAAGAAAAGCACCAAGGGG - Intergenic
1156413947 18:36867177-36867199 ATCACAAGAATAGCACAAAGAGG - Intronic
1157383621 18:47244763-47244785 TAACTAAGAAAAACACAAATGGG - Intronic
1161930363 19:7335676-7335698 GTCACAAGAATAGCACAAAGGGG + Intergenic
1162108872 19:8389495-8389517 TAACAAAGAATAGCAGAAAGTGG + Intronic
1162704408 19:12544624-12544646 TACACAAGGAATGCACAGAGAGG + Intronic
1163411933 19:17160368-17160390 CACCCAAGAAATGCAAAACGAGG + Intronic
1164058475 19:21643859-21643881 CACCCATGAAAAGAACAAACAGG - Intergenic
1164068225 19:21740033-21740055 CACCCATGAAAAGAACAAACAGG + Intronic
1164132097 19:22373109-22373131 TACCTCAAAAAAGCAGAAAGTGG + Intergenic
1165510504 19:36264138-36264160 TACCCCAGAAAAGCAGAGAAGGG + Intergenic
1167844961 19:52154705-52154727 ATCCCAAGAAGAGCAAAAAGCGG + Intronic
925684509 2:6457920-6457942 TAACCAAGAACAGCACCAAAGGG + Intergenic
925717555 2:6798254-6798276 TCCCCAGGAAAAGCAAAATGAGG + Intergenic
925755032 2:7125034-7125056 GAAACAAGAAATGCACAAAGTGG + Intergenic
926464296 2:13168726-13168748 TGCCCAAGAAAATCACAGAAGGG + Intergenic
926711465 2:15885405-15885427 TGCCCATGTAAAGCACAAAATGG - Intergenic
926829580 2:16947035-16947057 TACACAAAAAAATAACAAAGAGG + Intergenic
926882644 2:17564251-17564273 GACTCAAGGAAGGCACAAAGTGG - Intronic
928718936 2:34096929-34096951 TACCCAGGTCAAGAACAAAGTGG - Intergenic
929453399 2:42050761-42050783 TACCCAGGAAAAGTGAAAAGTGG + Intronic
929479938 2:42296059-42296081 TACCGTAGAAAAGGGCAAAGAGG - Intronic
929833394 2:45369743-45369765 TACCCAAGAAAAGGAACCAGGGG + Intergenic
930643007 2:53873639-53873661 TACCAAAGAAAAACAAAAAAAGG + Intronic
930747441 2:54899528-54899550 TACCACAAAAAAGCACAAATAGG - Intronic
930907389 2:56588383-56588405 TAACCAAGAAAAGATCAAAAAGG - Intergenic
933390619 2:81662056-81662078 TCCCCAAAAAAGGCACAAAGAGG - Intergenic
933595302 2:84277552-84277574 TACCCAAGAACAGAAGAGAGAGG + Intergenic
933865329 2:86510778-86510800 CACCCAGGAAAATCACAAATGGG + Intronic
934926513 2:98385423-98385445 AAAACAAGAAAAGCACACAGGGG + Intronic
936840858 2:116766640-116766662 TACCAAAGAAGAAAACAAAGTGG - Intergenic
937197524 2:120172840-120172862 TTGCCAAGAAAAACACAAACAGG + Intronic
937453900 2:122025083-122025105 CACCCAAGACCAGCAAAAAGGGG - Intergenic
937499153 2:122459573-122459595 GAAGCATGAAAAGCACAAAGAGG + Intergenic
937509417 2:122577324-122577346 TACCAAAGAAAGGCAGAAACTGG + Intergenic
938420950 2:131146277-131146299 TGCCCAACAAAAGCCCAAAAAGG - Intronic
938777943 2:134558626-134558648 TACCTTGGAAATGCACAAAGAGG + Intronic
939478840 2:142721792-142721814 AATACAAGGAAAGCACAAAGTGG + Intergenic
942989125 2:182178319-182178341 TCCCTAAGAGAAGCAAAAAGGGG + Intronic
943451214 2:188044590-188044612 TACCCAAGACTAGGAAAAAGAGG + Intergenic
944133989 2:196378067-196378089 AACCCAAGGAAAGGCCAAAGAGG - Intronic
944424843 2:199569700-199569722 TACCCTGGAAAAGAACAAATAGG + Intergenic
944820822 2:203429200-203429222 GACCTAAGAAAAGCACGAAGTGG - Exonic
945362829 2:208912225-208912247 AAGCAAAGAAAAGCATAAAGTGG + Intergenic
945381563 2:209146925-209146947 TACCCAAGCAAGGCACAGATTGG - Intergenic
946246399 2:218390299-218390321 TACCCAAGGGAAGTACAGAGTGG + Intronic
946472938 2:219979607-219979629 TTCCCAAGAAAATAACTAAGAGG + Intergenic
947805225 2:232961949-232961971 CCCCCAAGAAAAGGATAAAGCGG + Intronic
1170982921 20:21231682-21231704 CCCCAAAGAAAAGCAGAAAGTGG + Intronic
1173638934 20:44585497-44585519 CACCTAAGAAAGGCACAGAGAGG + Intronic
1173690712 20:44959194-44959216 TAGCCAAGAAAAGGAAAAAAAGG + Intronic
1174441034 20:50553915-50553937 TACCCAAGGGAAGTACAGAGAGG + Intronic
1174703521 20:52633487-52633509 TACCAAGGAAAATCAGAAAGAGG - Intergenic
1175156220 20:56973288-56973310 AAACCAAGAAAAGCCCAAAATGG - Intergenic
1176410046 21:6444628-6444650 CACCCAAGAAAAGTGAAAAGAGG + Intergenic
1177402698 21:20626073-20626095 TACACAAGGAAAAGACAAAGAGG + Intergenic
1177621086 21:23594120-23594142 TACCAAAGAAAAAAAGAAAGGGG + Intergenic
1179403670 21:41107996-41108018 TAGCCAAGGAAAGCACACACAGG - Intergenic
1179685539 21:43052950-43052972 CACCCAAGAAAAGTGAAAAGAGG + Intergenic
1181659254 22:24329881-24329903 TACCTCTGAAAAGCACAAAAAGG - Intronic
949163555 3:910506-910528 CACCCAGGAAAAGGGCAAAGAGG + Intergenic
949870459 3:8583664-8583686 TTCCCAAGAAAACCACAATAAGG + Intergenic
950483600 3:13259809-13259831 CACCCAAGAAAAGGTCAACGGGG + Intergenic
951481942 3:23170405-23170427 TACCCAAGAAAGCCACCCAGGGG + Intergenic
951719222 3:25679911-25679933 TACCCAAATCAAGCACAAAATGG - Intergenic
951795738 3:26536435-26536457 TACCCAATAAAAGGACCCAGGGG + Intergenic
954043380 3:47907633-47907655 TTCCAAAGAAATGCAGAAAGAGG - Intronic
954821753 3:53335632-53335654 TATCCAAAAAAAGGACAAAATGG - Intronic
955135307 3:56211826-56211848 AACCAAACAAAAACACAAAGTGG + Intronic
957027529 3:75200037-75200059 GACCTAAAAAAAGAACAAAGAGG - Intergenic
958035489 3:88165472-88165494 TAGTGAAGAAAAGTACAAAGTGG + Intronic
958509863 3:95034091-95034113 TAACCAAGAAAAGAAGAGAGAGG - Intergenic
958827141 3:99044191-99044213 TAACCAAGAAAATAAGAAAGAGG + Intergenic
959011522 3:101082746-101082768 TACTCAAGTAAAGAACAATGAGG + Intergenic
960121679 3:113953676-113953698 TATTCAGAAAAAGCACAAAGAGG - Intronic
960411135 3:117326195-117326217 TACAGAAGATAAGAACAAAGAGG - Intergenic
961906084 3:130264315-130264337 GACCCAAGGCCAGCACAAAGAGG - Intergenic
961970871 3:130965795-130965817 TACCTAAGATAAGGACTAAGAGG - Intronic
962658263 3:137571647-137571669 TACCCAAGAAGTGCACAGAGAGG + Intergenic
963806452 3:149727779-149727801 TATTCCAGAAAACCACAAAGAGG - Intronic
964162937 3:153667842-153667864 TACTGAAGAAACGCACAAAGAGG - Intergenic
966065455 3:175816099-175816121 TACCCCAGAAGAGCACAAAATGG - Intergenic
966191545 3:177276302-177276324 TACCCAACAAAAACACAGGGAGG - Intergenic
967327104 3:188251982-188252004 TAACCAAGAAAACCTCCAAGAGG - Intronic
969504143 4:7573778-7573800 TACCCTAAAGATGCACAAAGGGG - Intronic
970233184 4:13932171-13932193 GAGCCAACAAAAGCTCAAAGAGG + Intergenic
970284183 4:14491006-14491028 AAACCAAGAAAATCACAAATAGG + Intergenic
971835741 4:31760695-31760717 TACCCAGGACAGGCACAATGTGG + Intergenic
972570221 4:40303822-40303844 AACACAAGAAAATCACAAATTGG - Intergenic
974225259 4:59034066-59034088 AACCAAAGAAAAGTAAAAAGTGG + Intergenic
974710840 4:65592553-65592575 TACACAAGGAAAGCACAAAGTGG + Intronic
975213371 4:71726850-71726872 TACCTAAGAAAAATTCAAAGAGG - Intergenic
975516661 4:75255318-75255340 TACCGAAGAAAGGCAGCAAGAGG - Intergenic
976070853 4:81237810-81237832 CAAACAAGAAAAGGACAAAGTGG - Intergenic
978087646 4:104673502-104673524 TAACCAAGAAAAGAAGAGAGAGG - Intergenic
978107773 4:104925115-104925137 GACCCAAGAAAAGAAGAGAGAGG - Intergenic
978252844 4:106653776-106653798 TAACCAAGAAAAGAAGAGAGAGG - Intergenic
979509161 4:121531775-121531797 TACACAAGCAAAGAACAAAAAGG - Intergenic
981139307 4:141249877-141249899 TAACCAAGGAAAGAAGAAAGAGG - Intergenic
981964700 4:150585460-150585482 TACCTTAGAAAAACAGAAAGAGG - Intronic
982068806 4:151676951-151676973 TAACCAATTAGAGCACAAAGTGG + Intronic
982356533 4:154475229-154475251 AACCCAACAAAATCAGAAAGGGG + Intronic
983323413 4:166224612-166224634 TACACAAAAAAAGGACAAATAGG + Intergenic
983429991 4:167636601-167636623 TAACCAAGAAAAAAAGAAAGGGG - Intergenic
983830821 4:172325821-172325843 TACCCAAAGAAAGCAGAAAAGGG + Intronic
984841797 4:184075479-184075501 TAAACAAGAAAAGAGCAAAGTGG - Intergenic
985169913 4:187137925-187137947 TCCCAAAGAGAAGCCCAAAGAGG + Intergenic
985262701 4:188129420-188129442 TCCCTAAGAAAAGCAAAAAGTGG + Intergenic
985839392 5:2294765-2294787 TAACCAAGCACAGCACACAGAGG - Intergenic
985889238 5:2702667-2702689 GACCCAAGCAAAGCACAAGGGGG - Intergenic
986537269 5:8803436-8803458 TAACCAAGAAAAGAAGAGAGAGG - Intergenic
987572908 5:19687896-19687918 TACCCATGAACAGTACCAAGAGG + Intronic
987964932 5:24860282-24860304 TATCAAAGAAGAGCACAATGTGG + Intergenic
989724522 5:44572386-44572408 TAACCAAGAAAAACACCTAGAGG + Intergenic
991190487 5:63867581-63867603 CACTGAAGAAGAGCACAAAGTGG - Intergenic
992134399 5:73728940-73728962 TAACAAAGAAAAGCAGAAAATGG + Intronic
994532753 5:100989010-100989032 TCCCCAAGAAAAGCAGAGAAGGG + Intergenic
994563175 5:101403715-101403737 TACCCAATAAATAAACAAAGAGG + Intergenic
996443575 5:123518432-123518454 CAGCCAAGAAAATCACAGAGGGG - Intronic
996509071 5:124298865-124298887 TTCACAAGAAAAGCACCAAGAGG + Intergenic
997196448 5:131983469-131983491 TCCCCATGAAAAGAACAATGTGG + Intronic
1000268862 5:159663881-159663903 AACCCAAGAAGAGAGCAAAGTGG + Intergenic
1000742728 5:164989983-164990005 TGCCCAAGGAAAGCACAATGGGG - Intergenic
1001846531 5:174926853-174926875 TTCCCCAGAAAAATACAAAGTGG + Intergenic
1004286294 6:14323862-14323884 TAGACAAGAAAAGCTCCAAGAGG - Intergenic
1004950682 6:20667744-20667766 TACCCCAGAAAAGTACACACAGG - Intronic
1005591685 6:27335366-27335388 TAACCAAAAAAGACACAAAGAGG + Intergenic
1006613884 6:35311923-35311945 GACCAAAAAAAAGCCCAAAGGGG - Intronic
1006655060 6:35583980-35584002 TTCCCAGGAGAAGCACAAGGGGG + Intronic
1007537282 6:42604160-42604182 TACACTAGAAAAGCACAGTGTGG - Intronic
1007956141 6:45919434-45919456 TACCCAAGCAAAGCACCACACGG + Intronic
1008352498 6:50508771-50508793 TGGCCAAGCAAAACACAAAGTGG + Intergenic
1009285931 6:61817267-61817289 GACACAAGAAAATCATAAAGTGG - Intronic
1010155545 6:72788019-72788041 TACCCAAGAAAAGCAGCAATTGG - Intronic
1011373213 6:86662626-86662648 TAACCAAGAAAAGAATAGAGAGG - Intergenic
1011808931 6:91107305-91107327 TATCTAAGAAAAGCTCAAAAGGG - Intergenic
1016496811 6:144672547-144672569 TAACCAAGAAAAGAAGAGAGAGG - Intronic
1016559646 6:145380956-145380978 TACCCAAGAGAAGCAAAACATGG + Intergenic
1017127723 6:151081314-151081336 GTCCCAAGAAAACCATAAAGGGG + Intronic
1017210849 6:151854366-151854388 TACCTGAGAAAAGAACATAGTGG + Intronic
1019231544 6:170569113-170569135 TACATAAGAAAAGCAGAATGTGG - Intronic
1019701836 7:2477911-2477933 TCCCCCAGAAGAGCACAGAGAGG + Intergenic
1022399092 7:30018951-30018973 AACCAAAGAAAAGTAGAAAGAGG + Intronic
1023692905 7:42810591-42810613 AAGCCAACAAAAACACAAAGTGG + Intergenic
1025568333 7:62519290-62519312 TACCAAAGAAGACCTCAAAGAGG - Intergenic
1027641952 7:80746267-80746289 TGCACAAAAAAAGCACAAAAAGG + Intronic
1028285481 7:88991752-88991774 AAGCCAAGAAAAAAACAAAGTGG + Intronic
1028440278 7:90851748-90851770 TATTCAAGAAAATGACAAAGGGG - Intronic
1028646760 7:93107015-93107037 TACCCAACAACACAACAAAGAGG - Intronic
1028655417 7:93200201-93200223 GACCGAAAAAAATCACAAAGTGG - Intronic
1029066739 7:97857222-97857244 TAGCCAAGGAAAGCAGAATGAGG - Intronic
1029224022 7:99012015-99012037 TAACCAAGAACAGCCCACAGGGG - Intronic
1030879040 7:114853338-114853360 TATCCAGGAAAAGCACTAGGAGG + Intergenic
1031374614 7:121008940-121008962 TACTGAAGAAAAGCACCCAGTGG - Intronic
1032031342 7:128486297-128486319 AAAAAAAGAAAAGCACAAAGAGG + Intronic
1032863307 7:135902190-135902212 TACCCCAGGACAGCCCAAAGAGG + Intergenic
1033031411 7:137830994-137831016 TAAACAAGAAAATCACAAAAAGG + Intronic
1033667249 7:143453128-143453150 TAGCCAAGAACTGCAGAAAGAGG - Intergenic
1033676176 7:143541981-143542003 TCCCCCAGAAAAGCAGAAAAGGG + Intergenic
1033695657 7:143787458-143787480 TCCCCCAGAAAAGCAGAAAAGGG - Intergenic
1034293918 7:149954759-149954781 CTCCCAGGAAAAGTACAAAGAGG - Intergenic
1034812150 7:154142100-154142122 CTCCCAGGAAAAGTACAAAGAGG + Intronic
1035478185 7:159158614-159158636 TAGCCTAGAAAAGCACAGAGTGG + Intergenic
1035714352 8:1742570-1742592 TACCAAAGAAAAGATCAAAATGG - Intergenic
1036523021 8:9509844-9509866 AACCCAAGAGAAGCACATATAGG - Intergenic
1037252291 8:16910387-16910409 TACCCAAGACAGACACATAGAGG + Intergenic
1037531695 8:19782169-19782191 TCCCCAAGAAAAATACATAGTGG + Intergenic
1037580664 8:20244321-20244343 ACCCCTAGAAAAGCACAAGGCGG - Intergenic
1038218118 8:25581679-25581701 TTCCCAAGAGGAGCACAAAGGGG - Intergenic
1038228131 8:25675412-25675434 TACCAGAAGAAAGCACAAAGAGG - Intergenic
1038467314 8:27775978-27776000 TACCCAGGAAAAGCCCCAGGGGG + Intronic
1042066635 8:64884133-64884155 GACCCATGAAAACCACAAAAAGG - Intergenic
1043085417 8:75826098-75826120 GTCACAAGAACAGCACAAAGGGG - Intergenic
1043202824 8:77392488-77392510 TACCAAACATAACCACAAAGTGG + Intergenic
1045945573 8:107791449-107791471 TAACCAAAAAAAAGACAAAGAGG + Intergenic
1046430498 8:114119698-114119720 TACCCAAAAGAGGCAGAAAGTGG + Intergenic
1046639878 8:116717622-116717644 AAGCCAACAAAAACACAAAGTGG + Intronic
1046870806 8:119204174-119204196 TTCCTAAGAAAAATACAAAGGGG + Intronic
1047087835 8:121538790-121538812 TACACAAGAAAAGGAGAAATGGG - Intergenic
1047294964 8:123562531-123562553 TACCCAAGAAAAGCCTAGTGAGG - Intergenic
1047503400 8:125459813-125459835 CACCCAAGCAAAGCACACAGAGG - Intergenic
1047616737 8:126568832-126568854 TCTCCAAGAGAAGCAAAAAGAGG + Intergenic
1048764453 8:137829628-137829650 TCCCCCAGAAAAGCAGAAAAGGG + Intergenic
1049881597 8:145068200-145068222 TACCCTAGCAAAGGAAAAAGGGG - Intergenic
1050364831 9:4864374-4864396 TGGCCAAGAAAAGTACAAAAAGG - Intronic
1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG + Exonic
1050620970 9:7451558-7451580 GACCCAAGGGAAGCACTAAGTGG - Intergenic
1052253815 9:26429955-26429977 TAACCAAGAAAAGAAGAGAGAGG + Intergenic
1053279831 9:36812811-36812833 TGGCCAAGCAAAGCACTAAGTGG + Intergenic
1053441516 9:38120305-38120327 TACACAAGACAAGCAGAAACGGG - Intergenic
1056456618 9:86766651-86766673 TACCCAAGAAAAGCGCAAGGGGG - Intergenic
1056582435 9:87901704-87901726 TAACCAAGAAAAGAAGACAGAGG + Intergenic
1056667003 9:88589135-88589157 TACCCAAGAACATCACACAAAGG + Intergenic
1060056117 9:120414532-120414554 TACAGAAGAAAAGAAAAAAGTGG + Intronic
1185535362 X:857193-857215 TACCCAGGAAAAGCAAAAACTGG + Intergenic
1185996383 X:4954572-4954594 TACTGAAGAAAATCACAAACTGG - Intergenic
1186166493 X:6832142-6832164 TACCAAAGAAAAGAGAAAAGAGG + Intergenic
1188580327 X:31703799-31703821 TTCTCCAGAAAAGCAAAAAGAGG + Intronic
1191769070 X:64735598-64735620 GACGCAAGAACAGCACCAAGGGG + Intergenic
1191897922 X:66013327-66013349 TTTCCAATAACAGCACAAAGGGG - Intergenic
1192064766 X:67871236-67871258 TAGACAAGAAAAGCAAAAATAGG - Intergenic
1192537671 X:71942105-71942127 TAACCAAGAAACTCAGAAAGAGG - Intergenic
1193671547 X:84392691-84392713 TAGCCAAGAAAAAAATAAAGAGG - Intronic
1195062503 X:101209894-101209916 GACCCAAGAAAAGGAAATAGTGG - Intergenic
1195428852 X:104765448-104765470 ATACCAAGAAAAGCACAAAGTGG - Intronic
1195906655 X:109850986-109851008 AACACAAAAAAAGCACAAAGAGG + Intergenic
1196642528 X:118079133-118079155 TTCAAAAGAAAAGCACAAATAGG + Intronic
1197154855 X:123259202-123259224 TCCCCAAGAAAAGGAGAAAAGGG + Intronic
1198122494 X:133607881-133607903 TGGCCAAGCAAAGCACCAAGTGG + Intronic
1198543380 X:137664654-137664676 TAACCATGAAAAGCTGAAAGTGG - Intergenic
1199825627 X:151496733-151496755 AACCCAAGGAAAGTACAAAAAGG - Intergenic
1200659388 Y:5942078-5942100 TGCCCCAGAAAAGCACAGAAGGG - Intergenic
1201755380 Y:17481228-17481250 TACCAAAGAAAAAGAAAAAGAGG - Intergenic
1201846172 Y:18424757-18424779 TACCAAAGAAAAAGAAAAAGAGG + Intergenic