ID: 1082898634

View in Genome Browser
Species Human (GRCh38)
Location 11:58220899-58220921
Sequence CCTCCAGCAGATAGTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082898634_1082898641 6 Left 1082898634 11:58220899-58220921 CCATAAGGACTATCTGCTGGAGG No data
Right 1082898641 11:58220928-58220950 GCCTGGTATGTGAGTGTGGAAGG No data
1082898634_1082898640 2 Left 1082898634 11:58220899-58220921 CCATAAGGACTATCTGCTGGAGG No data
Right 1082898640 11:58220924-58220946 TGGGGCCTGGTATGTGAGTGTGG No data
1082898634_1082898643 13 Left 1082898634 11:58220899-58220921 CCATAAGGACTATCTGCTGGAGG No data
Right 1082898643 11:58220935-58220957 ATGTGAGTGTGGAAGGTAGTTGG No data
1082898634_1082898644 30 Left 1082898634 11:58220899-58220921 CCATAAGGACTATCTGCTGGAGG No data
Right 1082898644 11:58220952-58220974 AGTTGGCAATTTAGATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082898634 Original CRISPR CCTCCAGCAGATAGTCCTTA TGG (reversed) Intergenic
No off target data available for this crispr