ID: 1082898643

View in Genome Browser
Species Human (GRCh38)
Location 11:58220935-58220957
Sequence ATGTGAGTGTGGAAGGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082898634_1082898643 13 Left 1082898634 11:58220899-58220921 CCATAAGGACTATCTGCTGGAGG No data
Right 1082898643 11:58220935-58220957 ATGTGAGTGTGGAAGGTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082898643 Original CRISPR ATGTGAGTGTGGAAGGTAGT TGG Intergenic
No off target data available for this crispr