ID: 1082901517

View in Genome Browser
Species Human (GRCh38)
Location 11:58258512-58258534
Sequence GTGGGTACACAAAGGCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082901517_1082901523 18 Left 1082901517 11:58258512-58258534 CCTGTATGCCTTTGTGTACCCAC No data
Right 1082901523 11:58258553-58258575 AAGTAAGATTACATGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082901517 Original CRISPR GTGGGTACACAAAGGCATAC AGG (reversed) Intergenic
No off target data available for this crispr