ID: 1082902638

View in Genome Browser
Species Human (GRCh38)
Location 11:58272171-58272193
Sequence GTGGAGACACAGTTTTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082902638_1082902641 1 Left 1082902638 11:58272171-58272193 CCAAACTAAAACTGTGTCTCCAC No data
Right 1082902641 11:58272195-58272217 TGAAATCCCCTGTCACATGGAGG No data
1082902638_1082902640 -2 Left 1082902638 11:58272171-58272193 CCAAACTAAAACTGTGTCTCCAC No data
Right 1082902640 11:58272192-58272214 ACTTGAAATCCCCTGTCACATGG No data
1082902638_1082902642 2 Left 1082902638 11:58272171-58272193 CCAAACTAAAACTGTGTCTCCAC No data
Right 1082902642 11:58272196-58272218 GAAATCCCCTGTCACATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082902638 Original CRISPR GTGGAGACACAGTTTTAGTT TGG (reversed) Intergenic
No off target data available for this crispr