ID: 1082908630

View in Genome Browser
Species Human (GRCh38)
Location 11:58343553-58343575
Sequence ATGTAATACCTGAATAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082908630_1082908634 30 Left 1082908630 11:58343553-58343575 CCATTTTTATTCAGGTATTACAT No data
Right 1082908634 11:58343606-58343628 AACAGACTTTTGAAGAGGTAAGG No data
1082908630_1082908633 25 Left 1082908630 11:58343553-58343575 CCATTTTTATTCAGGTATTACAT No data
Right 1082908633 11:58343601-58343623 TAGACAACAGACTTTTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082908630 Original CRISPR ATGTAATACCTGAATAAAAA TGG (reversed) Intergenic
No off target data available for this crispr