ID: 1082914851

View in Genome Browser
Species Human (GRCh38)
Location 11:58422140-58422162
Sequence ATGTAATACCTGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082914851_1082914853 23 Left 1082914851 11:58422140-58422162 CCTTCCTCATTCAGGTATTACAT 0: 1
1: 0
2: 2
3: 17
4: 190
Right 1082914853 11:58422186-58422208 TAAAAAATTGACTTCTAAAGAGG 0: 1
1: 0
2: 5
3: 40
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082914851 Original CRISPR ATGTAATACCTGAATGAGGA AGG (reversed) Intergenic
900797472 1:4717441-4717463 AGGTAAACCCTGAATGATGATGG - Intronic
901108872 1:6779436-6779458 ATGTAATAGCTGGATGATGAGGG + Intergenic
905155429 1:35974983-35975005 GTGTAATATATGATTGAGGAGGG + Intronic
908686421 1:66725184-66725206 ATTTAACACCTGAGTGAGGGAGG + Intronic
909120219 1:71593814-71593836 AGGTTAGACCTAAATGAGGAAGG - Intronic
910080395 1:83334744-83334766 AAGAAATACATGTATGAGGAGGG + Intergenic
910602442 1:89046403-89046425 ATGAAATGCCTGAAGAAGGAAGG + Intergenic
910638431 1:89434826-89434848 ATGAAATGCCTGAAGAAGGAAGG - Intergenic
911559255 1:99383922-99383944 ATGTATTACTTGAATAAGGAGGG - Intergenic
915170767 1:153975712-153975734 ATGGAATATCTGAAAGAAGAGGG - Intronic
918427235 1:184423232-184423254 GTGAAGTTCCTGAATGAGGAAGG - Intronic
918574372 1:186038815-186038837 ATGTAATAACTGAAAGAAGAAGG - Exonic
921587390 1:216964270-216964292 ATGTAAAAACTGCATGTGGAAGG + Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
923600859 1:235401633-235401655 ATTTAATACTTGAATAAGGAGGG + Intronic
924446236 1:244134473-244134495 ATGCATTGCCTGAATGAGGGGGG + Intergenic
1065001229 10:21339268-21339290 TTACAATACCTGAGTGAGGAAGG - Intergenic
1065902212 10:30218629-30218651 ATGTAATAACTGATTGAGGCAGG + Intergenic
1067918221 10:50423550-50423572 ATTTATTACCTGGTTGAGGATGG - Intronic
1068895268 10:62191921-62191943 ATGTAACACGTGTATGAAGAGGG - Intronic
1070268905 10:74932721-74932743 ATGTACCACCTGAATGAGGATGG + Intronic
1071346433 10:84698348-84698370 ATCTAATACTTGAATTTGGAAGG + Intergenic
1075780995 10:125017054-125017076 ATGCAATCCCTTAATGAGGCAGG + Intronic
1076260907 10:129065246-129065268 ATCTAATATCTACATGAGGAAGG + Intergenic
1077717609 11:4597698-4597720 ATGCAATACCTGAATGTTAAGGG - Intergenic
1077864826 11:6213486-6213508 ACGTAATACCAGAAGGAGCAAGG - Intronic
1078246596 11:9578541-9578563 ATGCAATACCTGAAAAATGAAGG - Intronic
1078603494 11:12754763-12754785 AAGGAAAACCTGAATCAGGATGG - Intronic
1079261848 11:18889897-18889919 ATGTAATACCACAAGGATGAGGG + Intergenic
1082211074 11:49502124-49502146 TTGGAAAACCTGAATGAAGAAGG + Intergenic
1082647280 11:55743279-55743301 ATGTAAAACATGAAGGAGAAAGG + Intergenic
1082908630 11:58343553-58343575 ATGTAATACCTGAATAAAAATGG - Intergenic
1082914851 11:58422140-58422162 ATGTAATACCTGAATGAGGAAGG - Intergenic
1083783259 11:64929058-64929080 ATGTAATACGTTACTGAGAAAGG - Intronic
1086638570 11:89122916-89122938 TTGGAAAACCTGAATGAAGAAGG - Intergenic
1086668111 11:89510195-89510217 CTGTAAGATCTGAATGAGCAGGG - Intergenic
1087296648 11:96384880-96384902 ATGAAATATCTGAGTGAAGATGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088241528 11:107778252-107778274 ATGTAATAGCTGATTGAGTGAGG + Intergenic
1089434400 11:118451996-118452018 ATGTAATACATGAATCAGGAGGG + Intronic
1094765060 12:33584899-33584921 ATGTGATTCCTGATTGAGCAAGG + Intergenic
1095106119 12:38234728-38234750 ATGTAATATCTGAATGAGCTGGG + Intergenic
1098403322 12:70097267-70097289 TTGAAATAACTGAATGAGAAGGG - Intergenic
1098472344 12:70859840-70859862 CTGTAATACCTGTTTGGGGAGGG - Intronic
1101134004 12:101720763-101720785 ATTTAATACTTGCATGAGCAAGG - Intronic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1102945614 12:116985340-116985362 ATGTTATCCCCCAATGAGGAGGG + Exonic
1104111201 12:125706394-125706416 ATACAATAGCTGAATGCGGAAGG + Intergenic
1104143318 12:126008853-126008875 ATGAATTACTTGATTGAGGAGGG + Intergenic
1104414876 12:128589711-128589733 ATTTGATACCTGAAAGAGGCTGG + Intronic
1104621970 12:130321053-130321075 GTGTAATACCATAATGAAGAAGG - Intergenic
1106095177 13:26637183-26637205 ATGTAATGCCTGCAGGGGGAGGG + Intronic
1106855667 13:33849210-33849232 ATGCAAGACCTGAAGCAGGAAGG + Intronic
1107370988 13:39747443-39747465 ATGTATTACATGAATGAAGGAGG - Intronic
1108896778 13:55339064-55339086 CTGTTATGCCTGAATGAAGAAGG - Intergenic
1108965808 13:56299934-56299956 ATATAATGCCTGAATCAAGAAGG - Intergenic
1109783109 13:67139014-67139036 AGATAATACCTGTATCAGGAAGG + Intronic
1111868856 13:93804818-93804840 ATGTAATAGCTGCATGACGTTGG + Intronic
1112219139 13:97470400-97470422 AAATAATAGCTGAATGAGCATGG - Intergenic
1112931361 13:104742908-104742930 ATTTATTACCAGTATGAGGAAGG + Intergenic
1113073446 13:106445186-106445208 ATTTAATTTGTGAATGAGGATGG - Intergenic
1114892645 14:26944698-26944720 CTGTAATACCTGAATAGTGATGG + Intergenic
1120142939 14:80948678-80948700 ATGTAACAAATGAATGAGAATGG - Intronic
1121751904 14:96363912-96363934 AAACAATACCTGAATGAGGCGGG - Exonic
1124915684 15:33970567-33970589 CTGTAATACCATAATAAGGAGGG - Intronic
1125101855 15:35922909-35922931 ATGCAATAACTGAATGATTAGGG + Intergenic
1126098179 15:45103996-45104018 ATGTATGACCTGGATGAGAATGG - Exonic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1127951967 15:63816801-63816823 ATCTAACACATGAATGAAGAAGG + Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134809472 16:17154986-17155008 ATGAAATACCAGAATGGGAAGGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1151419864 17:73990176-73990198 ATGGAACACCTGACTGGGGAAGG + Intergenic
1151444844 17:74156484-74156506 ATGAAATGCCTGGATGAGGTGGG + Intergenic
1153457968 18:5299243-5299265 ATTTAAGACCTGAAAGATGAGGG + Intergenic
1153505932 18:5797954-5797976 ATGTAATAACTGATTGATAATGG - Intergenic
1155720744 18:29008726-29008748 ATGTTATACCAGAGTGAGGCTGG + Intergenic
1156652161 18:39237251-39237273 GTGGCATACCTGAATGAGAAAGG + Intergenic
1161291552 19:3496450-3496472 ATTTATCACCTGAGTGAGGAAGG + Intronic
1162686443 19:12388903-12388925 ATGGAATACCTCAAAGAGAAGGG + Intronic
1162690763 19:12428412-12428434 ATGGAATACCTCAAAGAGAAGGG + Intronic
1166441549 19:42819691-42819713 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166460982 19:42987983-42988005 AAGGAATACCTGAGTGAGGCTGG - Intronic
1166478271 19:43147963-43147985 AAGGAATACCTGAGTGAGGCTGG - Intronic
1168432424 19:56291846-56291868 ATGTAATGCCATGATGAGGATGG + Intronic
925697135 2:6592545-6592567 ATGTATGACCTGAGTGAGGGAGG + Intergenic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
930896879 2:56456777-56456799 AAGTAATTCCTGAATCATGAGGG + Intergenic
933995240 2:87663343-87663365 ATGTAATAGGTGAATCAGGCAGG + Intergenic
935222679 2:101028463-101028485 TTGTGGTACCCGAATGAGGATGG - Intronic
936298620 2:111287570-111287592 ATGTAATAGGTGAATCAGGCAGG - Intergenic
936642315 2:114328501-114328523 ATCTAATAACTGATTGAAGAGGG - Intergenic
938027179 2:127959884-127959906 ATGTAATAACTGAAATAAGACGG + Intronic
938744226 2:134261710-134261732 ATGTAAGTTCTGAAAGAGGAGGG + Intronic
939717950 2:145609363-145609385 ATGTGATACCTGGAGGTGGATGG + Intergenic
942520998 2:176803941-176803963 AGCTAATAAATGAATGAGGATGG + Intergenic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
945496394 2:210511759-210511781 ATACAATTCCTGAATGAGGGAGG + Intronic
1169835385 20:9872371-9872393 ATTTATTAACTGTATGAGGAAGG - Intergenic
1169995578 20:11552607-11552629 ATGTGATACCTGAATGAAATGGG - Intergenic
1172964161 20:38821448-38821470 ATTTAAGACCTGAATGAGAAGGG + Intronic
1174234683 20:49079728-49079750 ATGTAAAATCTGTATGTGGAAGG - Intronic
1174254445 20:49243778-49243800 AGTTAAGACCAGAATGAGGATGG - Intronic
1175488532 20:59363195-59363217 ATGTCAGACCTGAATGAGCCGGG + Intergenic
1177897170 21:26867348-26867370 ATGTCATACCTTACTGTGGAAGG + Intergenic
1178161758 21:29925394-29925416 ATAAAATACATTAATGAGGATGG - Intronic
1178556222 21:33592693-33592715 TTGTATGAACTGAATGAGGAGGG + Intronic
1178884453 21:36474411-36474433 ATGTAATGCATTAATAAGGAAGG + Intronic
1179119128 21:38526679-38526701 ATGTTATTTCTGAGTGAGGAGGG + Intronic
1179238090 21:39564878-39564900 AAGCAATACCTGCCTGAGGAAGG - Intronic
1183292489 22:37011259-37011281 ATGGACTTCCTGACTGAGGATGG - Exonic
1183714251 22:39524483-39524505 ATTTAGTACCTGGATGTGGATGG - Intergenic
950571802 3:13805131-13805153 ATGCATTAACTGAATGAGGATGG + Intergenic
953085761 3:39665167-39665189 ATGTCTTAGCTGAATGGGGAGGG + Intergenic
955287443 3:57656385-57656407 ATGTAATACATGAATGCACATGG - Intronic
956087003 3:65622081-65622103 ATGTATTTCCTGCAGGAGGAAGG - Exonic
956670833 3:71688105-71688127 ATGTAATACAGAACTGAGGAAGG - Intronic
957868707 3:86059778-86059800 AAGTATTACCTGAATGATGCAGG - Intronic
958695057 3:97516899-97516921 ATGAAATAAATGAATGAGGGGGG - Intronic
960486768 3:118262136-118262158 ATGTGATCCAAGAATGAGGATGG + Intergenic
961226411 3:125252521-125252543 CTGTAATCCCTGCATGAGGCGGG + Intronic
963073757 3:141327737-141327759 ATGTAATACATGAATAATGGAGG + Intronic
965045997 3:163577288-163577310 ATTTAATAACTGGATGACGAGGG - Intergenic
965553069 3:169989500-169989522 GTGTAATACCTGCATCAAGAAGG + Intronic
965553478 3:169995544-169995566 ATGTAAAACCAGAAAGAGGGGGG - Exonic
966056072 3:175691934-175691956 ATGTAATTCCTGAAGGTGAAAGG - Intronic
966128756 3:176610560-176610582 ATTTAATAACTGAAGGAGAATGG + Intergenic
971091411 4:23350240-23350262 AAGTCATACATGACTGAGGACGG + Intergenic
971749915 4:30633620-30633642 AAGTAATTAATGAATGAGGATGG - Intergenic
973544334 4:51965907-51965929 ATGTGATACTTGAATGTAGAGGG + Intergenic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
976486520 4:85611872-85611894 ATTAAATATCTGAATGAAGAAGG - Intronic
976957562 4:90920269-90920291 ATATTTTAACTGAATGAGGATGG - Intronic
978571491 4:110142649-110142671 ATGATCTACCTGAAGGAGGAAGG - Intronic
979676352 4:123414077-123414099 ATGTAATGACTGGATTAGGAGGG - Intergenic
982660188 4:158197322-158197344 ATGCAAAACCTGAAAGAGAAGGG + Intergenic
984239962 4:177206398-177206420 ATGAAAGACCTGGATGAAGAAGG - Intergenic
984797540 4:183677444-183677466 CTATAATTCCTAAATGAGGAGGG - Exonic
987323529 5:16792456-16792478 ATGTGAGAGCTGATTGAGGATGG - Intronic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
994688856 5:102991094-102991116 CTGTAAAACCTGAATAATGATGG - Intronic
995077409 5:108002561-108002583 ATGAAAGACCTGAATGAGAAAGG + Intronic
995327204 5:110904476-110904498 TTGTAATGCCTGAGTGAGAAAGG - Intergenic
1000374236 5:160564612-160564634 TTCTAAGAGCTGAATGAGGATGG + Exonic
1000728845 5:164805660-164805682 AACTAATAAATGAATGAGGATGG + Intergenic
1003219963 6:4151863-4151885 ATGTAATACATAAACGAGAAAGG - Intergenic
1003413350 6:5885725-5885747 ATGGAAAACGTGCATGAGGAGGG - Intergenic
1004636019 6:17468524-17468546 ATGTAATAAATCAATGAGAAAGG - Intronic
1005644104 6:27825092-27825114 TTGTCATACCTTAATGAGGGTGG - Intergenic
1008226511 6:48924848-48924870 ATGTTATACCTGAGTCAGGTTGG - Intergenic
1012127306 6:95446646-95446668 ATCTAATACATGAATAAGAAGGG - Intergenic
1013145910 6:107391556-107391578 ATTCAATAGCTGTATGAGGAGGG + Intronic
1013309261 6:108878562-108878584 ATGGAATATCTGAATATGGATGG + Intronic
1014139457 6:117924622-117924644 ATGTAACACCTTGAGGAGGAGGG + Intronic
1014370682 6:120603638-120603660 ATTTAAAACCTGAATGAAGGAGG + Intergenic
1015659978 6:135564857-135564879 TTGTAGTACCTGAAAGAGGCAGG - Intergenic
1016411625 6:143789138-143789160 CTTTCATACCTGGATGAGGAGGG + Intronic
1016630493 6:146224245-146224267 ATGAAATACCAGAGTGAGGTGGG + Intronic
1017502809 6:155040969-155040991 TTGTAATGCCTGATGGAGGAGGG + Intronic
1018230568 6:161671143-161671165 ATGGGATACCTGCATGGGGAGGG + Intronic
1019036613 6:169065273-169065295 ACGTAATACCTGAAAAATGAAGG - Intergenic
1023233136 7:38054561-38054583 ATGTTATACCTCAATGGAGATGG + Intergenic
1023308815 7:38861061-38861083 ATAAATTACCTGAAAGAGGATGG + Intronic
1023426312 7:40040467-40040489 AAGTAACACCTGAAAGAGAAAGG - Intronic
1024936881 7:54719717-54719739 ATGTAAACCCTGAGTGTGGAGGG - Intergenic
1026309506 7:69171489-69171511 ATGTGATACCTGTATAAGGTAGG - Intergenic
1026587961 7:71672352-71672374 ATCTGATCTCTGAATGAGGAAGG + Intronic
1027298172 7:76800010-76800032 AAGAAATACATGTATGAGGAGGG + Intergenic
1028560038 7:92165412-92165434 ATATAATTCCTGATTAAGGATGG + Intronic
1029989309 7:104948501-104948523 ATGTAATACCTTAACGATCAGGG + Intergenic
1030721524 7:112876522-112876544 TTGTAATACCTGGTTGAGGTAGG - Intronic
1034071285 7:148188297-148188319 CTTTAATACCTCAATGTGGACGG + Intronic
1034502931 7:151462671-151462693 ATGAAATACCTGAATAAGTTGGG + Intergenic
1042018601 8:64345075-64345097 ATGTAATGCCTGAAATGGGAGGG + Intergenic
1042018967 8:64349384-64349406 CTGTAAATCCTGAATGAAGAAGG + Intergenic
1043364295 8:79514099-79514121 ATTTAATACAAAAATGAGGAGGG + Intergenic
1045180246 8:99773134-99773156 ATGTAATACTTGAAAAAGGTAGG + Intronic
1045443982 8:102241300-102241322 AGATAAGACCTGAATGAGCATGG + Intergenic
1045823252 8:106366903-106366925 ATGTAATACATGAAAGAAGATGG - Intronic
1045934736 8:107665796-107665818 ATGTAATATCTTGATGAGGATGG + Intergenic
1047044350 8:121034823-121034845 ATGCAATACTTGAAGGAGCATGG + Intergenic
1047152065 8:122274889-122274911 TTGGAATACCTGAATGAGACAGG + Intergenic
1047165401 8:122432748-122432770 ATGCAATACCTGAAATGGGATGG + Intergenic
1048170439 8:132100939-132100961 ATGTTATACCTGGATGGAGAAGG + Intronic
1048426133 8:134325578-134325600 AGCTAATACCTCACTGAGGAAGG - Intergenic
1048735402 8:137494201-137494223 ATGTAATAAAGAAATGAGGAAGG + Intergenic
1049350037 8:142159534-142159556 ATGGAATTCCTAAATGAGGAAGG + Intergenic
1051851019 9:21508099-21508121 ATGAGATACCTGAAAGGGGATGG + Intergenic
1052394904 9:27927257-27927279 ATTTAATAGATGAAGGAGGAAGG + Intergenic
1054751522 9:68912072-68912094 GGGTAATACTTGAATGAGTAGGG - Intronic
1056337226 9:85584377-85584399 AAGGAATACATGAAAGAGGAAGG - Intronic
1056648418 9:88435628-88435650 ATGTAATATCAGAAAAAGGAAGG - Intronic
1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG + Intergenic
1186188353 X:7043545-7043567 AAGGAATACCTGAGTGAGGCTGG - Intergenic
1186408879 X:9328439-9328461 ATGGACTACCTCAATAAGGAAGG + Intergenic
1187249930 X:17588023-17588045 ATATAATGCCTGAATGTAGATGG + Intronic
1187798934 X:23038033-23038055 ATGGCTTTCCTGAATGAGGAGGG + Intergenic
1188107398 X:26160939-26160961 ATGAAATACCTGCATCAGGAGGG - Intergenic
1188811616 X:34658416-34658438 ATTGAATACATTAATGAGGAGGG + Intergenic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1194289876 X:92058173-92058195 AACTAATACCTAAAAGAGGAAGG + Intronic
1196254704 X:113503165-113503187 AAGTAATAGCTGAATATGGATGG + Intergenic
1196520891 X:116669339-116669361 ATTTTATATCTTAATGAGGAAGG - Intergenic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1200013171 X:153135991-153136013 GTTTAACACATGAATGAGGACGG - Intergenic
1200026429 X:153263932-153263954 GTTTAACACATGAATGAGGACGG + Intergenic
1200607390 Y:5282751-5282773 AACTAATACCTAAAAGAGGAAGG + Intronic