ID: 1082916010

View in Genome Browser
Species Human (GRCh38)
Location 11:58438213-58438235
Sequence CAAGGTTACCACAGAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082916010_1082916015 21 Left 1082916010 11:58438213-58438235 CCATCAGCTCTGTGGTAACCTTG No data
Right 1082916015 11:58438257-58438279 ATGGTAGCTGAAAAAAACATTGG No data
1082916010_1082916013 2 Left 1082916010 11:58438213-58438235 CCATCAGCTCTGTGGTAACCTTG No data
Right 1082916013 11:58438238-58438260 AACCAGCACACATGGAACTATGG No data
1082916010_1082916011 -6 Left 1082916010 11:58438213-58438235 CCATCAGCTCTGTGGTAACCTTG No data
Right 1082916011 11:58438230-58438252 ACCTTGAAAACCAGCACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082916010 Original CRISPR CAAGGTTACCACAGAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr