ID: 1082922427

View in Genome Browser
Species Human (GRCh38)
Location 11:58510063-58510085
Sequence GTCAAAAATGTCTCCAGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082922421_1082922427 8 Left 1082922421 11:58510032-58510054 CCAGTAACACCACCACCTCCCAT No data
Right 1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG No data
1082922424_1082922427 -7 Left 1082922424 11:58510047-58510069 CCTCCCATTTGTAACAGTCAAAA No data
Right 1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG No data
1082922423_1082922427 -4 Left 1082922423 11:58510044-58510066 CCACCTCCCATTTGTAACAGTCA No data
Right 1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG No data
1082922420_1082922427 29 Left 1082922420 11:58510011-58510033 CCTCTCTCTAATCACTAGATTCC No data
Right 1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG No data
1082922425_1082922427 -10 Left 1082922425 11:58510050-58510072 CCCATTTGTAACAGTCAAAAATG No data
Right 1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG No data
1082922422_1082922427 -1 Left 1082922422 11:58510041-58510063 CCACCACCTCCCATTTGTAACAG No data
Right 1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082922427 Original CRISPR GTCAAAAATGTCTCCAGACG TGG Intergenic
No off target data available for this crispr