ID: 1082928709

View in Genome Browser
Species Human (GRCh38)
Location 11:58578374-58578396
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082928709_1082928716 24 Left 1082928709 11:58578374-58578396 CCTAGGCGAAATAAGACTTCATC No data
Right 1082928716 11:58578421-58578443 AACGGTGCGCATGCGCCAAGAGG No data
1082928709_1082928713 6 Left 1082928709 11:58578374-58578396 CCTAGGCGAAATAAGACTTCATC No data
Right 1082928713 11:58578403-58578425 AATGCCCTTGGTTAAGTTAACGG No data
1082928709_1082928717 27 Left 1082928709 11:58578374-58578396 CCTAGGCGAAATAAGACTTCATC No data
Right 1082928717 11:58578424-58578446 GGTGCGCATGCGCCAAGAGGCGG No data
1082928709_1082928710 -6 Left 1082928709 11:58578374-58578396 CCTAGGCGAAATAAGACTTCATC No data
Right 1082928710 11:58578391-58578413 TTCATCTCCCAGAATGCCCTTGG No data
1082928709_1082928718 28 Left 1082928709 11:58578374-58578396 CCTAGGCGAAATAAGACTTCATC No data
Right 1082928718 11:58578425-58578447 GTGCGCATGCGCCAAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082928709 Original CRISPR GATGAAGTCTTATTTCGCCT AGG (reversed) Intergenic