ID: 1082928712

View in Genome Browser
Species Human (GRCh38)
Location 11:58578399-58578421
Sequence TAACTTAACCAAGGGCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082928712_1082928716 -1 Left 1082928712 11:58578399-58578421 CCAGAATGCCCTTGGTTAAGTTA No data
Right 1082928716 11:58578421-58578443 AACGGTGCGCATGCGCCAAGAGG No data
1082928712_1082928717 2 Left 1082928712 11:58578399-58578421 CCAGAATGCCCTTGGTTAAGTTA No data
Right 1082928717 11:58578424-58578446 GGTGCGCATGCGCCAAGAGGCGG No data
1082928712_1082928718 3 Left 1082928712 11:58578399-58578421 CCAGAATGCCCTTGGTTAAGTTA No data
Right 1082928718 11:58578425-58578447 GTGCGCATGCGCCAAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082928712 Original CRISPR TAACTTAACCAAGGGCATTC TGG (reversed) Intergenic