ID: 1082928715 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:58578408-58578430 |
Sequence | GCGCACCGTTAACTTAACCA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1082928715_1082928716 | -10 | Left | 1082928715 | 11:58578408-58578430 | CCTTGGTTAAGTTAACGGTGCGC | No data | ||
Right | 1082928716 | 11:58578421-58578443 | AACGGTGCGCATGCGCCAAGAGG | No data | ||||
1082928715_1082928718 | -6 | Left | 1082928715 | 11:58578408-58578430 | CCTTGGTTAAGTTAACGGTGCGC | No data | ||
Right | 1082928718 | 11:58578425-58578447 | GTGCGCATGCGCCAAGAGGCGGG | No data | ||||
1082928715_1082928717 | -7 | Left | 1082928715 | 11:58578408-58578430 | CCTTGGTTAAGTTAACGGTGCGC | No data | ||
Right | 1082928717 | 11:58578424-58578446 | GGTGCGCATGCGCCAAGAGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1082928715 | Original CRISPR | GCGCACCGTTAACTTAACCA AGG (reversed) | Intergenic | ||