ID: 1082928716

View in Genome Browser
Species Human (GRCh38)
Location 11:58578421-58578443
Sequence AACGGTGCGCATGCGCCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082928714_1082928716 -9 Left 1082928714 11:58578407-58578429 CCCTTGGTTAAGTTAACGGTGCG No data
Right 1082928716 11:58578421-58578443 AACGGTGCGCATGCGCCAAGAGG No data
1082928709_1082928716 24 Left 1082928709 11:58578374-58578396 CCTAGGCGAAATAAGACTTCATC No data
Right 1082928716 11:58578421-58578443 AACGGTGCGCATGCGCCAAGAGG No data
1082928712_1082928716 -1 Left 1082928712 11:58578399-58578421 CCAGAATGCCCTTGGTTAAGTTA No data
Right 1082928716 11:58578421-58578443 AACGGTGCGCATGCGCCAAGAGG No data
1082928711_1082928716 0 Left 1082928711 11:58578398-58578420 CCCAGAATGCCCTTGGTTAAGTT No data
Right 1082928716 11:58578421-58578443 AACGGTGCGCATGCGCCAAGAGG No data
1082928715_1082928716 -10 Left 1082928715 11:58578408-58578430 CCTTGGTTAAGTTAACGGTGCGC No data
Right 1082928716 11:58578421-58578443 AACGGTGCGCATGCGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082928716 Original CRISPR AACGGTGCGCATGCGCCAAG AGG Intergenic