ID: 1082928849

View in Genome Browser
Species Human (GRCh38)
Location 11:58579068-58579090
Sequence GCGCGCGCGCGCGCCGCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082928845_1082928849 4 Left 1082928845 11:58579041-58579063 CCGATTGGCCCGCTGAGCGTCTG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG 0: 1
1: 0
2: 2
3: 27
4: 265
1082928847_1082928849 -4 Left 1082928847 11:58579049-58579071 CCCGCTGAGCGTCTGTGGCGCGC 0: 1
1: 0
2: 0
3: 1
4: 68
Right 1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG 0: 1
1: 0
2: 2
3: 27
4: 265
1082928844_1082928849 12 Left 1082928844 11:58579033-58579055 CCTCTTTTCCGATTGGCCCGCTG 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG 0: 1
1: 0
2: 2
3: 27
4: 265
1082928848_1082928849 -5 Left 1082928848 11:58579050-58579072 CCGCTGAGCGTCTGTGGCGCGCG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG 0: 1
1: 0
2: 2
3: 27
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082928849 Original CRISPR GCGCGCGCGCGCGCCGCCAG CGG Intergenic
900180409 1:1308660-1308682 GCGCGCGCGCACGGAGCCTGAGG - Exonic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
901641435 1:10694903-10694925 GCGCGCTCGCATGCTGCCAGCGG + Intronic
902348430 1:15835920-15835942 GCGCGCGCGCTCGCCGTGCGGGG + Intergenic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
902813426 1:18902423-18902445 GCGCGCGCTCGGGCCGCCCCGGG + Intronic
903206019 1:21783104-21783126 GCGGGCGGGCGCGGCGGCAGTGG - Exonic
903522210 1:23959503-23959525 GCGCGCGGGCTCGCCGCCCTTGG - Intronic
904532999 1:31181599-31181621 GTGAGCGCGCGGGCCACCAGGGG + Exonic
912532748 1:110338487-110338509 GCGCGGGAGAGCGCCGCCCGCGG - Exonic
914813621 1:151047684-151047706 GCGCTCGCGCGGGCCGCGCGGGG - Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
916961439 1:169893686-169893708 GCGGGCGCGCGCCCCGCTCGCGG - Intronic
917565383 1:176207275-176207297 GCGCGCGCGAGCGGCGGAAGAGG + Exonic
917884050 1:179366099-179366121 GCGCGCGAGAGCGCTGCCTGTGG + Intronic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
920924489 1:210328896-210328918 GCGCGCGGGCACGGCGGCAGGGG + Exonic
921217728 1:212951448-212951470 GTGCGCGCGGGCGCGGCGAGGGG - Exonic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
923056031 1:230426338-230426360 TCCCGGGCGCGAGCCGCCAGAGG + Intergenic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1063929849 10:11018063-11018085 GCGGGCGCACGCGGCGGCAGCGG - Exonic
1066429364 10:35336930-35336952 GCCCGCCCGCTCGCCGCCACGGG - Exonic
1072059760 10:91798521-91798543 GCGCGCGTGGGCGCGGCCATGGG + Exonic
1073432291 10:103494283-103494305 GCGCGGGTGCGCGCCACCGGGGG - Exonic
1073503841 10:103967036-103967058 GCGCGCGTGCGCGGGGCCAGAGG + Intergenic
1075335902 10:121608835-121608857 GCGGGGGCGAGCGCCGCCCGGGG + Intergenic
1077154311 11:1084661-1084683 GCGCGCGCCTGCACCGCCAAGGG + Intergenic
1077923021 11:6655622-6655644 GCGCGAGCGGGCGCTGCCCGGGG - Exonic
1078988026 11:16613594-16613616 GCGCGCGCGCGTGGAGGCAGCGG - Intronic
1080283595 11:30585377-30585399 GCGCGCGCGGGCGGCCCCGGGGG + Intronic
1080628546 11:34052232-34052254 GCGCGCGCGCGACCCGCCAGCGG - Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1082035552 11:47642563-47642585 GCGTGCGCGCGCGCCGCGGGCGG - Exonic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1083342523 11:61967766-61967788 GAGCGCGCGAGGGCCTCCAGCGG - Intergenic
1084000122 11:66291686-66291708 GCGAGCGCGAGCGCGGCCGGAGG + Intergenic
1084053481 11:66616371-66616393 ACGCGCGCGAGCGGCGCCGGCGG - Intergenic
1084786997 11:71448326-71448348 GCGCGCGCAAGCGAGGCCAGGGG - Exonic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1089713688 11:120336380-120336402 GCGGGCGCGCGCGCAGACAGCGG - Intergenic
1091446591 12:547116-547138 GAGCGCGCGTGGGCCACCAGGGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1094025812 12:25958876-25958898 GTGCGCGAGCGCTCGGCCAGCGG - Intergenic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1098255375 12:68610837-68610859 GCACCCGCGCGCCCCGCCCGCGG + Exonic
1098963682 12:76764156-76764178 GCGAGCGCGAGCCCCGCCGGAGG - Exonic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1102025837 12:109714010-109714032 GAGCCCCCGCGCGCCGCCCGGGG + Intergenic
1102056518 12:109900475-109900497 CCGCCCGCGCGGGCCGCCTGCGG - Intronic
1103308828 12:119989003-119989025 GCGGCTGCGCGCGCCGCCTGCGG - Intergenic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105368523 13:19782595-19782617 GCCCGCGCCCGCGCCTCCAGAGG - Exonic
1106447514 13:29850076-29850098 CCGCGCGGGCGCTCCGACAGCGG - Exonic
1107123394 13:36819385-36819407 GCGGGGCCGGGCGCCGCCAGCGG + Exonic
1107468031 13:40666657-40666679 GCCGGCGCGCGCGCCGCCGCGGG - Intergenic
1110630260 13:77698414-77698436 GGGCGCGGGGACGCCGCCAGGGG + Intronic
1112271958 13:97976626-97976648 GCGCGCTCGCGGGCCGCGGGAGG - Intronic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113655612 13:112066672-112066694 GCGCGCGCGCGCTCAGGAAGCGG + Intergenic
1115203122 14:30874600-30874622 GCACCCGCGCCCGCCGCCCGGGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1119046398 14:71321370-71321392 GCGTGCGCGCGCGCCGGGCGCGG - Intronic
1120941771 14:89956178-89956200 GCGCCCGTGCGCGCCCCCTGAGG - Intronic
1122300159 14:100726953-100726975 GGGCGCGGGCGCGCAGCGAGGGG - Exonic
1122629860 14:103102699-103102721 GAGCTCGCGCGCGACGCCCGCGG + Exonic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1123040330 14:105487712-105487734 CCGCGCCCGCGCGCCCCGAGGGG + Intronic
1125521960 15:40353147-40353169 GCGCGCGCGCGCGCATCCGTGGG + Intronic
1127770097 15:62224199-62224221 TCTCCCGCGCCCGCCGCCAGGGG + Intergenic
1127931647 15:63600991-63601013 GCGCCCGCGCGCGCCCGCCGCGG + Intronic
1128455241 15:67828150-67828172 CCCCGCGCCCGCCCCGCCAGTGG + Intronic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129983550 15:79896714-79896736 GGGCGTGCGCGCGCCGGGAGGGG + Intronic
1130002608 15:80060044-80060066 GGGCGCCCGCGCGCCGTCTGAGG - Intronic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1130224595 15:82047137-82047159 GCGCGCGCCGGCCCCGCCCGCGG + Intergenic
1130270793 15:82445853-82445875 GGGCGCGCTCGCCCCGCCTGGGG - Intergenic
1130463133 15:84173176-84173198 GGGCGCGCTCGCCCCGCCTGGGG - Intronic
1130489541 15:84421612-84421634 GGGCGCGCTCGCCCCGCCTGGGG + Intergenic
1130501132 15:84500374-84500396 GGGCGCGCTCGCCCCGCCTGGGG + Intergenic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1131558492 15:93419561-93419583 GCGCGCGCGCGCGCAACCCAGGG - Intergenic
1132527720 16:425905-425927 GCGCCCGCCCGCGCCGCCGAGGG + Exonic
1132585957 16:705836-705858 GGGGGCGCGCGCGGCGCCGGCGG - Intronic
1132915210 16:2340396-2340418 GCGGGCGCGGGCGCGGCCGGAGG + Intronic
1133156415 16:3880011-3880033 GAGCGAGCGCGGGCCGCGAGCGG + Exonic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1134070495 16:11256832-11256854 GGAGGCGCCCGCGCCGCCAGGGG - Intronic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1135040520 16:19114158-19114180 GCGCCCCCGCGCGCCGCCGTCGG - Intronic
1136209409 16:28747079-28747101 GCACGCGAGGCCGCCGCCAGGGG + Intergenic
1136365000 16:29805912-29805934 GCGAGCGCGCGCGTGGCCAGCGG - Intergenic
1136458458 16:30395498-30395520 GCAGGCGCCCGAGCCGCCAGCGG - Exonic
1136531877 16:30875361-30875383 GCGCGCGCCCGCGCCCCAACCGG + Intronic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1140046122 16:71441613-71441635 GCGAGCGCGCCGGCCGCCAGGGG + Intergenic
1140462244 16:75148959-75148981 CCGCGCGCGCGCGCCCGCCGGGG - Intronic
1141054586 16:80803936-80803958 GCGGGCGCGGGCGCCGCGGGAGG + Intronic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1141840092 16:86568470-86568492 GAGGGCGCGCTCGCCGCCACGGG + Exonic
1141972343 16:87492452-87492474 GGGCGCGCGCGGGGCGCCGGGGG + Intergenic
1142037141 16:87869377-87869399 GCGCGCGCTAGCGGCGCCGGCGG - Exonic
1144185183 17:12789910-12789932 TCGCGGGCGCGCACCGACAGCGG - Intronic
1144724929 17:17496963-17496985 CCGCGCGCTCGGGCCGCCAGAGG + Intergenic
1145370146 17:22300903-22300925 GCGCATGCGCGAGGCGCCAGAGG + Intergenic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146445310 17:32928158-32928180 GCGCGGGCGCGGGCCTGCAGCGG - Exonic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147742747 17:42678130-42678152 ACGCGCGCGCGCGCCCGCGGAGG - Intergenic
1147967248 17:44199834-44199856 GCGCGCGCGTGTGCCGCGACCGG + Intronic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148842587 17:50508470-50508492 GCGCACGCGCCCGCCGCCGGCGG - Exonic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1152212485 17:79009773-79009795 GCGCGCGCTCGCCCCGCCTCTGG + Exonic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1152719771 17:81917800-81917822 GGGCGCCCGCGCGCCGCACGCGG + Intronic
1152759077 17:82098845-82098867 GCCCACCCGCGCGCCGCCATTGG - Intergenic
1153457519 18:5296231-5296253 GCGCGCACGCGCGCGGCTTGGGG + Intronic
1154241566 18:12657982-12658004 GCGGCCGCGCGCGCCGCCGCCGG + Exonic
1155130959 18:22933830-22933852 GCGCGCGCGCGAGCCGCAGTCGG - Exonic
1160204624 18:76822678-76822700 GCGCCCTCGCGCCCCGCCGGCGG + Intronic
1160500704 18:79400116-79400138 TCGCGCGCGCGCGACCGCAGGGG - Intronic
1160765504 19:805841-805863 GCGAGCGCGAGGACCGCCAGTGG + Intronic
1161114549 19:2489269-2489291 GCCCGGCCGCCCGCCGCCAGGGG - Intergenic
1161461559 19:4400567-4400589 GCGCGCGCGGGGGCCGGCACCGG - Intergenic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1161802583 19:6424400-6424422 TCGCGCGCGCGCGCAGGCGGGGG - Intronic
1162100417 19:8335453-8335475 ACGGGCGCGCGCGGCGACAGCGG + Exonic
1162485964 19:10960853-10960875 GCGCGCACGCGCGCCGGGAGCGG + Intergenic
1162778924 19:12996532-12996554 GGGGGCGGGCGCGCTGCCAGCGG + Intronic
1163631294 19:18419274-18419296 GCGCGTGCGCGCTCCGGCGGCGG + Intronic
1163807072 19:19405891-19405913 GCGCGCGCTCGTTCCGCCTGTGG - Intronic
1164835148 19:31350974-31350996 GCGCCCGGGCGCGCCGGCTGGGG + Intergenic
1165745983 19:38229626-38229648 GGGCCCGCGCGCGGCGGCAGCGG - Intronic
1166367376 19:42284420-42284442 GCGCGCGCGGGGGCCGTCACGGG - Intronic
1166975052 19:46601104-46601126 GCGAGCGCGCGCGCGCCCGGCGG + Intronic
1167056030 19:47112195-47112217 GAGCGGGCGAGCGCCGCGAGGGG + Intronic
1168059270 19:53882298-53882320 GGGCGCGCCGGCTCCGCCAGGGG - Exonic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
1168408073 19:56121032-56121054 GCGCGCGTGCGCGCTGCTGGGGG - Intronic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
926267975 2:11344053-11344075 GGGCAGGCGCGAGCCGCCAGAGG - Exonic
928093561 2:28391004-28391026 GCGGACGCGCGCGCCGGCCGTGG - Intergenic
928278300 2:29921621-29921643 GCGCGAGCGCGCGCAGGGAGGGG + Intergenic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
933206376 2:79512796-79512818 CCGCGGGCGCGCGCGGCCTGGGG - Intronic
936452873 2:112646295-112646317 GTTCCCGCGCGCGCCGCCCGGGG - Intronic
937221771 2:120346160-120346182 GCGGGCGCCCTCGTCGCCAGCGG + Exonic
939153803 2:138501753-138501775 GCGCGTGCGCGCGGCGGCGGCGG - Intergenic
940265180 2:151828528-151828550 GTGCGCAGGCGCGCGGCCAGAGG + Intergenic
941366900 2:164621162-164621184 GCGCTCGCGCGTGCAGCCAGGGG + Exonic
946362834 2:219229404-219229426 GCGCGCCCCCGCCCCGCCGGCGG + Intronic
947119236 2:226799129-226799151 GCGCGCGCGCGCTCCTGGAGGGG - Exonic
947119238 2:226799131-226799153 GCGCGCGCGCGCGCTCCTGGAGG - Exonic
948140865 2:235670843-235670865 GCGCGCGCGGGCGGCGGCCGGGG + Intronic
1169664439 20:8019178-8019200 GCGCGCATGCGCGGCGCGAGCGG + Intronic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173279982 20:41618791-41618813 GCGCGCTCGGGCGCCGGCGGGGG + Intergenic
1174330368 20:49812830-49812852 TCGCCCGCCCGCGCCTCCAGCGG + Exonic
1175715654 20:61252910-61252932 GGGCGCGCCGGCTCCGCCAGTGG - Intronic
1175911502 20:62407312-62407334 GCGCGCGGGCGCGCGGGCAGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1176547735 21:8208832-8208854 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1176555632 21:8253038-8253060 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1176555635 21:8253047-8253069 GCGCGCGCGTGCGCCGAGCGCGG + Intergenic
1176555783 21:8253474-8253496 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176566821 21:8392300-8392322 GCGCGCGCGCATGGCGCCCGCGG - Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574562 21:8436066-8436088 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1176574720 21:8436508-8436530 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611174 21:8987358-8987380 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1176611334 21:8987801-8987823 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1177834134 21:26170875-26170897 GCGCCCGCTCGCGCCGGGAGGGG + Intronic
1178708198 21:34890786-34890808 GCGCGCCCGCCCGCCCGCAGGGG + Intronic
1179775366 21:43658725-43658747 GCGAGCACGCGCGCTTCCAGGGG - Intronic
1181522806 22:23459224-23459246 ACGCCCGGGCGCGCAGCCAGGGG - Intergenic
1181610871 22:24011169-24011191 ACGCGCGCGCGCGCCGCCCAAGG + Intergenic
1182494204 22:30694872-30694894 GCGCGCGGCCGAGCGGCCAGTGG - Exonic
1183441439 22:37825259-37825281 GCGCGCGCTTCCGCCGCCTGTGG + Exonic
1183649448 22:39145658-39145680 GCGTGCGTGCGCGCGGCCGGCGG - Intronic
1183679557 22:39319671-39319693 GCGCGCTCGCACGCCGGAAGGGG - Exonic
1184681129 22:46072539-46072561 GCACGCGAGCGCGGCGCCGGCGG + Intronic
1185302541 22:50090035-50090057 GCGCGTGCGGGCGGCGGCAGCGG + Exonic
1185351750 22:50343259-50343281 GCGCGCACGCTCGCGGCCGGGGG - Intergenic
1185351755 22:50343268-50343290 GCGAGCGTGCGCGCCCCAAGCGG + Intergenic
1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG + Intergenic
1203252609 22_KI270733v1_random:125117-125139 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1203252768 22_KI270733v1_random:125559-125581 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260665 22_KI270733v1_random:170203-170225 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1203260824 22_KI270733v1_random:170645-170667 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
950345321 3:12287842-12287864 GCGGGCGCGGGCGCCGGCTGGGG - Intronic
953748697 3:45594040-45594062 GCGCGCGGGCGGGCGCCCAGGGG - Intronic
954334907 3:49910587-49910609 TCGCGCACGGCCGCCGCCAGGGG + Exonic
954468886 3:50675032-50675054 GCCTTCGCCCGCGCCGCCAGGGG + Intergenic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
963607240 3:147421621-147421643 GCGTGCGCGCGCGTGGCCTGAGG + Intronic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964852070 3:161105372-161105394 GGGCCCGCGCGTGCAGCCAGGGG - Intronic
966449065 3:180037089-180037111 GCACGCGCGCGCGTTCCCAGGGG + Intergenic
966846651 3:184135588-184135610 CCGCGCACGCGAGCAGCCAGAGG + Intronic
968433896 4:575472-575494 GCGAGCGCGCGGGGCGCCGGGGG + Intergenic
968450591 4:674341-674363 GCGCACGCATGCGCCGTCAGCGG + Intronic
968804650 4:2764244-2764266 GCGAGGGCCCGCGCCGCCCGCGG - Intergenic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
973894232 4:55396150-55396172 CCGCGCACGGGCGCCGCAAGAGG - Exonic
975986181 4:80202907-80202929 GCCCCCGCCCGCGCCGCCTGCGG - Exonic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
986288486 5:6378589-6378611 GCTCGCCCGCGCTCCCCCAGAGG - Exonic
986704197 5:10441844-10441866 GTGCGCGTGCGCGGCTCCAGGGG + Exonic
987082808 5:14440993-14441015 GCGCGCGCGCGCGCTGCAGTTGG - Intronic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
989229881 5:39074075-39074097 GCGCGCCCTCGCGGCGCCCGCGG + Intronic
989379399 5:40798340-40798362 GCCCCCGCCCGCCCCGCCAGGGG - Exonic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
994367111 5:98928818-98928840 GAGCGCGCGCGCGACGGCGGCGG - Exonic
995047736 5:107670380-107670402 CCGAGGGTGCGCGCCGCCAGCGG + Intronic
995106539 5:108382070-108382092 GCGGGTGCGCGCGCCGGCGGCGG - Exonic
996308569 5:122077874-122077896 GCCCCCGCGCGAGCCGCCGGCGG - Exonic
1002123367 5:177022851-177022873 GCGAGAGGGCGCGCCGCCTGTGG + Exonic
1002184200 5:177446735-177446757 GCGCGCGCGGCAGCCGGCAGAGG - Intronic
1002487732 5:179550923-179550945 GCGCCCGCGCCGGCGGCCAGCGG - Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002521758 5:179796260-179796282 GCGCGCGCGCTCGCGTACAGCGG - Exonic
1004114101 6:12749800-12749822 GGGCGGGGGCGCGGCGCCAGGGG - Intronic
1004216921 6:13711725-13711747 GAGCGCGGGCGCGCGGCCCGGGG + Intergenic
1004561805 6:16759969-16759991 GTGCGCGCGCGCGCCGGGCGGGG - Intronic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1012895534 6:104941564-104941586 GCACGGGGCCGCGCCGCCAGAGG + Intergenic
1015181285 6:130365453-130365475 GCGCCCGCGCAGCCCGCCAGGGG + Intergenic
1017671975 6:156777726-156777748 GCGCGGGCGCGGGCAGGCAGCGG + Intergenic
1018612929 6:165661762-165661784 ACGCTCCCGCGCTCCGCCAGGGG + Intronic
1019143794 6:169963940-169963962 GCGCGTGCGTGCGCCTCCACGGG + Intergenic
1019473400 7:1232973-1232995 GCGCCCCCGCGCCCCGCCACCGG + Exonic
1019588521 7:1817313-1817335 CCGCCCGGGCGCGCAGCCAGGGG + Intronic
1022020949 7:26398834-26398856 GTGCGGGCGCGCGCAGCCTGGGG - Intergenic
1022363397 7:29685140-29685162 ACGCGCGCGTGCGCCGTGAGCGG + Intergenic
1022697981 7:32728598-32728620 ACGCGCGCGTGCGCCGTTAGCGG - Intergenic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1026360507 7:69598252-69598274 GCGGGAGCGCGCGCCGAGAGAGG + Intergenic
1026822321 7:73557759-73557781 GCGCCTGCGCGCCCCGCCCGGGG + Exonic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1038008842 8:23457709-23457731 GTGCGCGCTCCCGCCGCCAGCGG - Intergenic
1038176345 8:25184721-25184743 GCCCGTGCCCGCGCCGCCCGCGG - Intronic
1038727663 8:30095610-30095632 GCGCGCGCGCGAGCCCGGAGGGG - Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1043388273 8:79768382-79768404 GCGCGAGGGCGCGCCGGCGGGGG + Intergenic
1049719268 8:144108134-144108156 GCGCCCGCGCCCGCCGGCTGTGG + Exonic
1049752522 8:144291884-144291906 GCGCGCGGGCGCGGGGCCCGTGG + Intronic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1057361188 9:94374894-94374916 GCGCGCGGGCGCGCAGGCCGCGG + Exonic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1057662175 9:97013270-97013292 GCGCGCGGGCGCGCAGGCCGCGG - Exonic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1060952325 9:127612204-127612226 GCCCCCGCGCGCGCCGGCGGCGG + Intergenic
1061038734 9:128127725-128127747 GCGCCCGCCCGCGGCGCCGGCGG - Exonic
1061208471 9:129177469-129177491 GCGGGCGCGGGCGGCGGCAGCGG + Exonic
1061208498 9:129177594-129177616 GAGCGCCCCCGCGCCGCCCGCGG + Exonic
1061283647 9:129610606-129610628 GCGGGCGCGAGCGCCGCGCGAGG + Intronic
1061286524 9:129626412-129626434 GCGTGCGCGCGGGCCGGCACAGG + Intronic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062621225 9:137423358-137423380 GGGCGGGCGCCTGCCGCCAGGGG + Exonic
1203469013 Un_GL000220v1:108268-108290 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1203469171 Un_GL000220v1:108710-108732 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476834 Un_GL000220v1:152240-152262 GCGCACGCGCGCGCCGAACGGGG - Intergenic
1203476992 Un_GL000220v1:152682-152704 GCGCGCGCGGCCGGCGCCCGCGG - Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1185641493 X:1591575-1591597 GCGAGCCCGCGCGCCGGAAGTGG + Exonic
1189137088 X:38561432-38561454 GCGGGGGCGCGTGCCGCGAGAGG - Exonic
1195316844 X:103687494-103687516 GCACGCGCGCGCGCCCGCCGTGG - Intronic
1195954888 X:110318182-110318204 GGGCGCGCGCGCGCCGCTCCCGG + Exonic
1197774661 X:130111135-130111157 GGGCGCGAGCGAGCCGCGAGGGG - Intergenic
1200129016 X:153830953-153830975 GGGCGCACGCGCGCCGGGAGGGG + Intergenic
1200173799 X:154097792-154097814 GCGCGCCCGCGCCCCGCCCTCGG + Intergenic
1202372060 Y:24205436-24205458 GGGCGCGCTCGCCCCGCCTGGGG + Intergenic
1202498725 Y:25464680-25464702 GGGCGCGCTCGCCCCGCCTGGGG - Intergenic