ID: 1082932417

View in Genome Browser
Species Human (GRCh38)
Location 11:58622597-58622619
Sequence CCACGCCCTGCCTGACTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082932417_1082932427 18 Left 1082932417 11:58622597-58622619 CCTCTGAGTCAGGCAGGGCGTGG 0: 1
1: 0
2: 4
3: 29
4: 228
Right 1082932427 11:58622638-58622660 CATTAGTAGAGAATGCCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 97
1082932417_1082932428 19 Left 1082932417 11:58622597-58622619 CCTCTGAGTCAGGCAGGGCGTGG 0: 1
1: 0
2: 4
3: 29
4: 228
Right 1082932428 11:58622639-58622661 ATTAGTAGAGAATGCCCAGTGGG 0: 1
1: 0
2: 2
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082932417 Original CRISPR CCACGCCCTGCCTGACTCAG AGG (reversed) Intronic
900093196 1:929490-929512 CCACGCACAGCCCGGCTCAGGGG - Intronic
900590841 1:3459104-3459126 CCACCCAGTGCCTGGCTCAGTGG + Intronic
900931793 1:5742432-5742454 CCATGCGCTGCCTGGCACAGGGG + Intergenic
901278263 1:8010141-8010163 TGACGCACTGCCTGACCCAGGGG - Intronic
901479998 1:9518626-9518648 CCACACCCTGCCTCCCTCAGAGG + Intergenic
901742972 1:11354422-11354444 CCACGCCCAGCTTGACACAGTGG + Intergenic
902589957 1:17466658-17466680 CCACACTGTTCCTGACTCAGGGG + Intergenic
902652433 1:17845355-17845377 CCACCCCCATCCTGACTCAGAGG - Intergenic
903656232 1:24950338-24950360 CCTCCCCATGCCTGCCTCAGTGG + Intronic
903917681 1:26776124-26776146 CCAGGCCCAGCCTGAATCTGTGG + Intronic
904050637 1:27635958-27635980 CCTCGACCTGCCTGACTCGAGGG - Intergenic
904146988 1:28400868-28400890 CCACGCCCGGCCTGAGTGAAGGG + Intronic
905631105 1:39519013-39519035 CCAAGCCAGGCCTGGCTCAGAGG + Intronic
905666654 1:39767158-39767180 CCAAGCCAGGCCTGGCTCAGAGG - Intronic
905703453 1:40036779-40036801 CCTTTCCCAGCCTGACTCAGAGG - Intergenic
906519417 1:46458446-46458468 CCAGCCTCTGCCTGCCTCAGAGG + Intergenic
907310637 1:53537123-53537145 CCACCCCCTGCCTGGCTCCTGGG - Intronic
911102065 1:94103053-94103075 CATCGGCCTGTCTGACTCAGTGG - Exonic
915879987 1:159659423-159659445 CCTTTCCCTCCCTGACTCAGTGG - Intergenic
915904714 1:159869332-159869354 CCATGCTGTCCCTGACTCAGTGG - Intronic
916323645 1:163533463-163533485 CTACGCCCTGCCATACACAGAGG - Intergenic
920913752 1:210241324-210241346 CCACCCACTTCCTGACTCACTGG - Intronic
1062988369 10:1791037-1791059 GCAGGCCCTGCCTGCCTGAGAGG + Intergenic
1063846125 10:10128516-10128538 CCAGGCACTGGCTGACTCTGGGG - Intergenic
1067669687 10:48307208-48307230 CCGCGCCCTGGCTGCCTCCGGGG + Intronic
1069615568 10:69804068-69804090 CCACGCCCTGCCAGGCTCCAGGG + Intronic
1070568260 10:77620227-77620249 CCACAGCCTGCCAGCCTCAGAGG + Intronic
1071100946 10:82037081-82037103 ATATACCCTGCCTGACTCAGAGG - Intronic
1072627120 10:97119660-97119682 CCACCTCCTGCCTGTCTCTGGGG - Intronic
1075733217 10:124648512-124648534 CCTCGTCCTGCCTGCCTCATAGG + Intronic
1075991619 10:126843211-126843233 CCCAGCCCTCCCTGCCTCAGGGG - Intergenic
1076284330 10:129278154-129278176 CCATTCCCTGCCTTAGTCAGAGG - Intergenic
1076402310 10:130192309-130192331 CCCAGCCCTCCCTGACACAGGGG - Intergenic
1076605911 10:131689751-131689773 CCACGCCCAGCCTCACTGAGTGG + Intergenic
1076883133 10:133249239-133249261 CCACGCCCCTCCCCACTCAGGGG - Intergenic
1077141067 11:1025135-1025157 CCAGGCCCTCCCTGATGCAGGGG - Intronic
1077502146 11:2914284-2914306 CCACGACCTGCCAGACGCAGGGG - Intronic
1078100184 11:8325847-8325869 CCACGCCCTTCCTTACTCTGTGG + Intergenic
1078435084 11:11318082-11318104 CATGGCCCTGCCTGACTCAGAGG - Intronic
1079341257 11:19613406-19613428 CCAAGGCCTGCCTGATGCAGTGG - Intronic
1082932417 11:58622597-58622619 CCACGCCCTGCCTGACTCAGAGG - Intronic
1083453687 11:62763617-62763639 TCTTGCCCTGCCTAACTCAGAGG + Intronic
1083946210 11:65924555-65924577 CCACCCAGGGCCTGACTCAGGGG + Intergenic
1084361402 11:68670441-68670463 GGACGCCCTGCCTGGCTCAGAGG - Intergenic
1084883664 11:72189643-72189665 CCACTCCCTGCCTGTCTCCTAGG + Intronic
1086298216 11:85395601-85395623 CCCTCCCATGCCTGACTCAGTGG + Intronic
1088721630 11:112597092-112597114 CCACACCCTGCATACCTCAGTGG - Intergenic
1089812888 11:121146057-121146079 CCAGCACCTGCCAGACTCAGGGG + Exonic
1091713679 12:2760840-2760862 ATATGCCCTGCCTGACTCAGAGG - Intergenic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1092547875 12:9467321-9467343 ATATGCCCTGCCTGACTCAGAGG - Intergenic
1092728535 12:11507616-11507638 ATATGCCCTGCCTAACTCAGAGG + Intergenic
1092784644 12:12016348-12016370 CCAAGCCCTTCCTGAGACAGAGG + Intergenic
1094505109 12:31055041-31055063 ATATGCCCTGCCTGACTCAGAGG + Intergenic
1095097949 12:38158027-38158049 CCACCCCGGGCCTGACGCAGGGG - Intergenic
1096121809 12:49093511-49093533 CCAAGCTCTGCCTATCTCAGGGG - Intronic
1096179578 12:49543255-49543277 ACCTGCCCTGCCTCACTCAGGGG + Exonic
1099864647 12:88264542-88264564 CCATGACCAGACTGACTCAGTGG - Intergenic
1103940493 12:124498891-124498913 CCACGAACTGCCTGACTCCACGG + Intronic
1104859330 12:131916451-131916473 CCACGCCCTGCCGGGCTAGGAGG - Exonic
1104899321 12:132179866-132179888 CCAGGCCCTGCCTGTGCCAGGGG - Intergenic
1104902084 12:132194970-132194992 CCACCCCCAGCCAGACTCACAGG - Intergenic
1104933578 12:132353062-132353084 CCAGGCCGGGCGTGACTCAGTGG + Intergenic
1105347221 13:19585062-19585084 CCAGGCCCTGCCTTTCTCTGTGG + Intergenic
1105853395 13:24355336-24355358 CCACGCCTGGCCTGGCTCGGAGG + Intergenic
1107079289 13:36357135-36357157 CCACGCTCTGCCTCACTCCAAGG - Intronic
1107853363 13:44591769-44591791 CCATGCCCTTGCAGACTCAGAGG + Intergenic
1108455880 13:50612865-50612887 CCTGACCCTGCCTGCCTCAGAGG + Intronic
1109396475 13:61766101-61766123 CCACCCGCAGCCAGACTCAGAGG - Intergenic
1113523309 13:110955372-110955394 CCATCCCCTGCCTGACTCAGAGG + Intergenic
1113611415 13:111647222-111647244 CCAAACCCTGCCTTCCTCAGTGG + Intronic
1113684441 13:112272545-112272567 ACACGCCTGGCCTGTCTCAGAGG + Intergenic
1113701998 13:112395124-112395146 CCATCCCCTGCCTGACTCAGAGG - Intronic
1114713936 14:24805041-24805063 CCCCACCCTGCCTGCCTCAGAGG - Intergenic
1117913157 14:60653198-60653220 CCTCGCTCTGCCTGGCTGAGGGG + Intronic
1118333847 14:64835136-64835158 GCATGCCTAGCCTGACTCAGTGG + Intronic
1118592902 14:67414300-67414322 GCCCACCCTGCCTGACTCACTGG + Intergenic
1120718499 14:87865797-87865819 CCAGCCCCTCCCTGACTCTGAGG + Intronic
1122299062 14:100721756-100721778 CCACGCACAGCATGACTCAGTGG + Intergenic
1122996549 14:105268386-105268408 CCGGGCCTTGCCAGACTCAGTGG + Intronic
1128323377 15:66707512-66707534 CCCCGCCCTGCCCGGCTCAGCGG + Intronic
1129189910 15:73931145-73931167 GCACCCCCCGCCTGACTCACCGG + Intronic
1129742180 15:77994621-77994643 CCATGCCCTGCCTGAGTCACAGG - Intronic
1129843302 15:78756859-78756881 CCATGCCCTGCCTGAGTCACAGG + Intergenic
1130173899 15:81547559-81547581 CCCAGCTCAGCCTGACTCAGTGG - Intergenic
1131324815 15:91432053-91432075 CTGCGCCCAGCCTCACTCAGCGG + Intergenic
1132369055 15:101280565-101280587 CCACGCCTGGCCAAACTCAGGGG - Intergenic
1132892651 16:2211849-2211871 CCACTCCCAGCCTGGTTCAGAGG - Exonic
1133016056 16:2941160-2941182 CCATGCCCAGTCTGACTCACTGG - Intronic
1133128590 16:3662687-3662709 ACACGGCCTTCCTGCCTCAGCGG + Exonic
1133160969 16:3911458-3911480 CTAAGCTCTGCCGGACTCAGTGG + Intergenic
1133195654 16:4168226-4168248 CCACGCCCAGCCTGCAACAGTGG + Intergenic
1133623111 16:7545290-7545312 CCGCACCCTGCCTCTCTCAGTGG - Intronic
1135195937 16:20394728-20394750 CCAGGCCTAGCCTGACCCAGAGG + Intronic
1135507524 16:23051740-23051762 ACAAGCTCTGCCTGACACAGGGG + Intergenic
1136537965 16:30911405-30911427 CCGATCACTGCCTGACTCAGGGG - Intergenic
1136620292 16:31423987-31424009 CCAGGTCCTGCCTGAGTCTGGGG - Intronic
1137615749 16:49845919-49845941 CCATGTCCTGCCTTTCTCAGGGG - Intronic
1138534457 16:57652669-57652691 CCAGGGCCTGCCTTCCTCAGTGG + Intronic
1138655768 16:58490438-58490460 CCCCTCCCTCCCTGACTCAGTGG + Intronic
1139272755 16:65699070-65699092 CATCACCCTGCCTGACTCTGGGG - Intergenic
1139354619 16:66360163-66360185 CCCTGCCCTGCCTGGCTCACTGG + Intergenic
1139533724 16:67558452-67558474 CCACACCCAGCCTGAGGCAGTGG - Intergenic
1142009294 16:87705770-87705792 CCAGGCCCTGCCCGGCTCTGCGG - Intronic
1142396275 16:89833529-89833551 CTACGCCCTGCTGGGCTCAGGGG + Intronic
1142772297 17:2107230-2107252 CCCTGCCCTGCCTGACCCAAAGG - Intronic
1143542769 17:7579534-7579556 CCACCCACAGCCTGACTCAGGGG - Exonic
1147118818 17:38323001-38323023 CCATGCCCAGCCTGAACCAGGGG - Exonic
1147590958 17:41683025-41683047 CCACGCCCGGCCTGACATGGGGG - Intergenic
1147674717 17:42197070-42197092 CCACGCCCAGCCTGAGTTTGGGG - Intergenic
1148106158 17:45120122-45120144 CCACTCCCTTCCTGGCCCAGTGG + Intronic
1148871283 17:50660122-50660144 CACCACCCTGCCTGACTGAGAGG + Intronic
1150260634 17:63787533-63787555 CCACGCCCAGCCTGTTTCAATGG - Intronic
1151591525 17:75047463-75047485 CCACGTTCAGCCTGACCCAGCGG - Exonic
1152089816 17:78240245-78240267 CCACTCCTTGCCTGCCTCAAAGG + Exonic
1152423632 17:80207258-80207280 CCACGCCCGGCCAAAATCAGGGG - Intronic
1152862690 17:82705063-82705085 GCGCGCCCTGCCTGGCTCCGAGG - Intergenic
1152923758 17:83078677-83078699 CCACCACGTGCCTGACCCAGTGG - Intergenic
1153698521 18:7668574-7668596 CCAGGCCATGCAGGACTCAGAGG - Intronic
1153823944 18:8857135-8857157 CCACCGCCTGCCGGACGCAGAGG - Intergenic
1154980398 18:21498708-21498730 CCCAGCCATGGCTGACTCAGAGG + Intronic
1155654562 18:28177956-28177978 CCACGCGCTGCCTGGCTGCGCGG + Intergenic
1158458713 18:57629594-57629616 ACACGCCCTGACTGACCCACTGG + Intergenic
1158591854 18:58784921-58784943 CCACGGCCTGCCCTTCTCAGAGG - Intergenic
1160462055 18:79046756-79046778 CCTCACCGTGCCTGACTCAGCGG - Intergenic
1160990244 19:1857456-1857478 CCGGGCCCAGCCTGAGTCAGAGG - Intronic
1161048055 19:2147052-2147074 CCACGCCCAGCCGAACTGAGCGG - Intronic
1161141332 19:2649890-2649912 GCACACCCTCCCTGACTCTGCGG + Intronic
1162375536 19:10303128-10303150 CCACACCCGGCCTGAGTCGGGGG + Intergenic
1162958469 19:14112772-14112794 CCAGGCCCTGCCTTCCTCAGTGG + Intronic
1163262297 19:16198397-16198419 GGACGCCCTGCCTGGCTCCGAGG - Intronic
1164566357 19:29328814-29328836 CCAAGCCCTGCCAGCCTCACTGG - Intergenic
1165901398 19:39170959-39170981 CCACGCCCTGCCTGGCTCTGTGG + Intronic
1166998849 19:46733084-46733106 CCAGGCCCTGCAGGGCTCAGTGG - Exonic
1167272622 19:48514394-48514416 CCATCCCCACCCTGACTCAGTGG - Intergenic
1167493572 19:49805574-49805596 CCGCGCCGTACCTGACTCACCGG - Exonic
1167714971 19:51137331-51137353 CCACCCCATGCATGAGTCAGGGG + Intergenic
925228510 2:2207993-2208015 CCACTCCATGCCCCACTCAGTGG + Intronic
925650054 2:6080501-6080523 CCGCGCCCGGCCTGACGGAGAGG - Intergenic
925872609 2:8284171-8284193 CCCCGGCCTGCATGTCTCAGGGG + Intergenic
927813638 2:26194911-26194933 CCACTCCCACCTTGACTCAGTGG + Intronic
927857335 2:26535817-26535839 CTCCGCCCAGCCTGCCTCAGGGG - Intronic
928282841 2:29964083-29964105 TCCCGCCCTGCCTCAGTCAGGGG + Intergenic
929592876 2:43158364-43158386 CCTCACCCATCCTGACTCAGAGG + Intergenic
929778839 2:44944528-44944550 CCGCGCCCGCCCTGACACAGAGG - Intronic
931757726 2:65388870-65388892 CCACCCCCTCCTTGGCTCAGGGG + Intronic
931790185 2:65658039-65658061 CCAGCCCCTGCCTGACCCTGGGG - Intergenic
932344736 2:70988280-70988302 CCCTGCCCTGCCTGCCCCAGCGG + Exonic
932470380 2:71951196-71951218 CCAGGCCCAGCCTGACTGTGTGG + Intergenic
933270347 2:80226568-80226590 CCACGCACTGCCTCACTCCAGGG - Intronic
933607642 2:84400820-84400842 CCACGCCCTGCCTGACGATGGGG - Intergenic
934559774 2:95307080-95307102 CCACCCCCTGCCTCACAAAGAGG + Intronic
935818430 2:106869520-106869542 CCATGCCCTCCCTGACTGGGTGG - Intronic
937098734 2:119252393-119252415 TCACTGCCTGCCAGACTCAGAGG - Intronic
940254930 2:151718590-151718612 CCACCCCTTCCCTGGCTCAGAGG + Intronic
940650213 2:156434947-156434969 CCACGTCCAGACTGACTCATTGG + Intergenic
941008241 2:160269627-160269649 CCAGGCACTGCCTGCCTCACAGG - Intronic
943248175 2:185483238-185483260 CCAGTCCCTGCCAGGCTCAGTGG + Intergenic
946926461 2:224631873-224631895 CCGCGCCCGGCCTGACTCCAAGG + Intergenic
947873904 2:233455670-233455692 TCAAGCCCATCCTGACTCAGCGG - Intronic
948746010 2:240095121-240095143 GCAGCCCCTGCCTGACTCACAGG - Intergenic
948999708 2:241606273-241606295 CCCCACCCTGCTTGACTCATGGG - Intronic
1169000668 20:2165686-2165708 CCAAGCCCTGCCTTAAACAGTGG + Intronic
1169152871 20:3304294-3304316 TCCCTCCCTGCCTGCCTCAGTGG + Intronic
1171993207 20:31712734-31712756 CCTATCCCTGCCTGACTCGGGGG + Intronic
1172750210 20:37245472-37245494 CCCTGCCCTGCCTTCCTCAGGGG + Intergenic
1174354621 20:49989678-49989700 CCACCCCCAGCCTGACTCTGGGG - Intergenic
1175744446 20:61445445-61445467 CCATGCCCCGCCTGCCTCAGAGG - Intronic
1179306226 21:40155902-40155924 CCACGCCCTGCCCTCCCCAGTGG - Intronic
1179980573 21:44893591-44893613 CCTGGCCCTGCCTGGCCCAGCGG + Intronic
1180625499 22:17191013-17191035 CCGCCCCGTGCCTGACTCCGAGG + Intronic
1180924513 22:19544444-19544466 CCAGGCCCTGCCAGCCCCAGAGG - Intergenic
1181458777 22:23074097-23074119 CCAGGTCCTGCAGGACTCAGTGG + Intronic
1181825539 22:25512523-25512545 CCACCCCCTTCCTCATTCAGTGG + Intergenic
1182362367 22:29754272-29754294 CCACGCCCTGCCAGAAACACAGG + Intronic
1183099209 22:35573654-35573676 CCACGGCGTGCCTGAATCCGGGG - Intergenic
1183281951 22:36936894-36936916 CCCCTCCCTGGCTGCCTCAGAGG + Intronic
1183949681 22:41345888-41345910 CGAAGCCCTGCCTGGCTCATGGG + Intronic
1184552762 22:45213327-45213349 CCATGCCCTGCCTGGCTCCTGGG + Intronic
953127993 3:40110123-40110145 CAAGGCCCTGCCAGACTCATTGG + Intronic
954444814 3:50540911-50540933 CCCCACCCTCCCTGACGCAGGGG + Intergenic
960573189 3:119205534-119205556 CCACGCTCAGCCTCACTCACAGG - Intergenic
960881721 3:122352370-122352392 CCATGCCTGGCCTGGCTCAGTGG - Intergenic
964763671 3:160157976-160157998 CCACGCCCTCCTTGACTGATGGG - Intergenic
966619537 3:181948748-181948770 CCACACAGTGCCTGACACAGTGG + Intergenic
966769149 3:183488585-183488607 CCATGTCCTGCCTGAGTCCGAGG + Exonic
968615217 4:1574703-1574725 CCAGGCCTCGCCTGTCTCAGGGG - Intergenic
968677558 4:1892274-1892296 CCACACCCGGCCTGAGTGAGTGG + Intronic
968759257 4:2433590-2433612 CCATGCCCAGCCTCACTCACAGG + Intronic
968830614 4:2931497-2931519 CCGTGCCCTGCAGGACTCAGGGG + Intronic
968914086 4:3489591-3489613 CCAGGCCCAGCCTGACTCAGTGG - Intronic
969370469 4:6728049-6728071 CCACACAGTGCCTGACTCAGAGG + Intergenic
969622413 4:8285319-8285341 CAATGGCCTGCCTGCCTCAGAGG + Intronic
969680037 4:8637786-8637808 CATGGCCATGCCTGACTCAGGGG + Intergenic
969755846 4:9150159-9150181 CCACGCCCAGCCTCACTAAAGGG - Intergenic
970496264 4:16628950-16628972 CCACCCTGTGCCTGGCTCAGTGG + Intronic
972021080 4:34315117-34315139 GCAAGCTCTGCCTGACCCAGAGG + Intergenic
978761868 4:112361682-112361704 CCACCCACTGCCTGACTCTAGGG + Intronic
978768066 4:112425067-112425089 CCACTCCCTGCCTGAATCAAAGG + Intronic
982256770 4:153458506-153458528 CCGCGCCCGGCCTGACTCCTTGG + Intergenic
984285891 4:177728438-177728460 TCCCGGCCTGCATGACTCAGCGG + Intergenic
984855120 4:184188458-184188480 CCACGCTCTGCTTGAGTCAAGGG + Intronic
986443529 5:7801278-7801300 CCTCGCCCTGCCAGACACACAGG + Intronic
989674043 5:43953223-43953245 ATATGCCCTGCCTGGCTCAGAGG + Intergenic
992507968 5:77406677-77406699 CCCCCTCCTGCCTGCCTCAGAGG + Intronic
994428725 5:99628165-99628187 ACATGCCCTGCCTGGGTCAGAGG - Intergenic
995047619 5:107669878-107669900 CCGGGCCCAGACTGACTCAGGGG + Intronic
998461418 5:142313064-142313086 CCAAACCCAGCCTGGCTCAGCGG + Exonic
1001479580 5:172078767-172078789 CCACGCTCTGCCTCGTTCAGAGG + Intronic
1001592776 5:172877846-172877868 CCAGGCCCTGCGTGACCCACAGG + Intronic
1003138232 6:3449668-3449690 CTACACCCTCCCTGACCCAGGGG - Intronic
1003587173 6:7401967-7401989 CCACGCCTTGCCTAAATCACTGG + Intronic
1004168266 6:13275637-13275659 TCACACCCTACCTGGCTCAGTGG - Intronic
1006103747 6:31703330-31703352 CCCCGCCCTCCCTGCCTCTGAGG + Exonic
1006190155 6:32202475-32202497 CCACGCTGTGCCTGCCTCAGTGG - Exonic
1006706310 6:36024392-36024414 CCACGGCGTGCCTGGCTCTGCGG + Intronic
1007104563 6:39274616-39274638 CTACGCCCTGGCTGCCTCACTGG + Intergenic
1007336233 6:41157096-41157118 CCATGGCCTCCCTGGCTCAGGGG - Intergenic
1007871298 6:45042130-45042152 CCACGCCCAGCCAGACTGAATGG - Intronic
1010892233 6:81327310-81327332 GCAAGCTCTGCCTGCCTCAGGGG + Intergenic
1012062891 6:94511144-94511166 CCATCCCCTTCCTGGCTCAGGGG - Intergenic
1012484171 6:99702443-99702465 CCACCCCGTGCCTGGCTCGGTGG + Intergenic
1012881814 6:104800055-104800077 CCATCCCGTGCCTGGCTCAGCGG + Intronic
1016385018 6:143522470-143522492 CCCAGCCCTGCCTGCCTCTGGGG + Intergenic
1018635579 6:165856315-165856337 CCACCCCCTGCCTGACTCTACGG + Intronic
1018724315 6:166598957-166598979 CCCAGCCCGGCCTGTCTCAGGGG + Intronic
1019676251 7:2314317-2314339 CCACGCCCTACCTGACGCCGGGG + Exonic
1019795066 7:3043191-3043213 CACAGCCCAGCCTGACTCAGAGG - Intronic
1020442189 7:8229526-8229548 CCTTGCCCTGCCTTACTGAGTGG - Intronic
1022015549 7:26345845-26345867 CCAGGCCCTGCATGTCTCTGGGG - Intronic
1025255529 7:57381824-57381846 CCACACCCTGCATGACTGACTGG - Intergenic
1025638064 7:63341021-63341043 CCTCACCCTGCCAGACTCAAGGG - Intergenic
1025644632 7:63407078-63407100 CCTCACCCTGCCAGACTCAAGGG + Intergenic
1025706505 7:63870174-63870196 CCACTCCCTCCCCGACCCAGTGG - Intergenic
1030202467 7:106919124-106919146 CCATCCCATGCCTGGCTCAGCGG + Intergenic
1036205659 8:6803968-6803990 CCACATCCTGCCTCACTCAAGGG + Intergenic
1036379085 8:8225460-8225482 CCACGCCCGGCCTCACTGAAGGG - Intergenic
1036850477 8:12197151-12197173 CCACGCCCGGCCTCACTGAAGGG + Intergenic
1036871842 8:12439424-12439446 CCACGCCCGGCCTCACTGAAGGG + Intergenic
1038634696 8:29276241-29276263 CCACAGCATGCGTGACTCAGAGG + Intergenic
1045362642 8:101447434-101447456 CCTCTGCCTGCCAGACTCAGGGG - Intergenic
1047756983 8:127926487-127926509 ACCAGCCCTGGCTGACTCAGGGG + Intergenic
1049203342 8:141352186-141352208 CCCAGCCCTGCCTGACTCCAGGG - Intergenic
1050227817 9:3480794-3480816 ACATGCCCTGCCTGTCTTAGAGG + Intronic
1056754934 9:89375706-89375728 CCACGCACTGCCTGAAGCACAGG + Intronic
1057156755 9:92848969-92848991 CCACACCCGGCCTGAATCAAAGG - Intronic
1057199133 9:93131111-93131133 CCAGGCCCTGCCTGTCTGTGTGG - Intronic
1057548982 9:96038403-96038425 CCACTCCCTGCCCTGCTCAGCGG - Intergenic
1058887023 9:109329509-109329531 TCCCGCCCTGACTGACTCACTGG + Intergenic
1060494284 9:124106539-124106561 CACCGCCCTCCCTGCCTCAGTGG + Intergenic
1061053460 9:128209340-128209362 CCAGGCCCTGGCTGGGTCAGAGG + Intronic
1061377883 9:130236782-130236804 TCACTCCCAGCCTGACTCGGTGG + Exonic
1061587849 9:131579945-131579967 CCCTGGCCTGCCTGACTCTGAGG - Intronic
1061590558 9:131594960-131594982 CCCCTCCCTGCCTGACATAGGGG - Intronic
1062321210 9:135991235-135991257 CCAGACCCTGCCAGACTCACGGG - Intergenic
1062601047 9:137318720-137318742 ACCCTCCCTGCCTGGCTCAGGGG + Intronic
1185878072 X:3715292-3715314 CCAAGCCCTGCCTGGCCGAGGGG + Intergenic
1190334678 X:49255235-49255257 CCACGCCCAGCCGGGGTCAGAGG + Intronic
1198750333 X:139932262-139932284 CCCCGGCCTGCCTGACCCGGGGG + Intronic
1200787315 Y:7272502-7272524 CCAAGCCCTGCCTGGCCGAGGGG - Intergenic
1201256023 Y:12109020-12109042 CCATGCCCTGCCAGACTCACAGG - Intergenic
1201743352 Y:17346145-17346167 CCAAGCCATGCCTCACTCTGTGG - Intergenic