ID: 1082935428

View in Genome Browser
Species Human (GRCh38)
Location 11:58652094-58652116
Sequence GCTCAGCAGCACCATGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 2, 1: 1, 2: 19, 3: 42, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082935428_1082935429 -7 Left 1082935428 11:58652094-58652116 CCTATAGCATGGTGCTGCTGAGC 0: 2
1: 1
2: 19
3: 42
4: 166
Right 1082935429 11:58652110-58652132 GCTGAGCAGCCACTCTGATTTGG 0: 4
1: 24
2: 76
3: 74
4: 169
1082935428_1082935431 5 Left 1082935428 11:58652094-58652116 CCTATAGCATGGTGCTGCTGAGC 0: 2
1: 1
2: 19
3: 42
4: 166
Right 1082935431 11:58652122-58652144 CTCTGATTTGGCATCTCCTTTGG 0: 25
1: 40
2: 53
3: 80
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082935428 Original CRISPR GCTCAGCAGCACCATGCTAT AGG (reversed) Intronic
901799131 1:11697348-11697370 GATCAGCAGCTCCATGTTCTGGG + Intronic
903180385 1:21602228-21602250 CCACAGCAGCCCCATGCCATGGG + Intronic
904012788 1:27399346-27399368 GCTGAGCAGCTCCAGGCTGTGGG - Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904416102 1:30361990-30362012 GCTCAGCACCACCTTCCTTTCGG + Intergenic
905043107 1:34976602-34976624 GCTCAGCAGCGCCAGGCTGAGGG + Intergenic
906071427 1:43019409-43019431 GCTGAGATGCACCATGCTCTTGG - Intergenic
908660915 1:66434349-66434371 GCTGAGCAGGACCATCCTGTAGG + Intergenic
909460608 1:75908955-75908977 GTACAGCAGCACCATGCTAGAGG - Intronic
910240359 1:85079737-85079759 CCTCAGCAGCAGCATGCCCTGGG - Intronic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
912232072 1:107806011-107806033 GCTTTTCAGTACCATGCTATAGG - Intronic
912589540 1:110802399-110802421 AGTCAGCAGCAGCATGCTATAGG + Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
919877206 1:201878357-201878379 GCTCAGCAGTTCAATGCTACTGG - Exonic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1067523039 10:47022380-47022402 GCACAGCAGCCCCCTGCTCTGGG - Intergenic
1069531460 10:69222618-69222640 GCTCAGGAGCACCCTGTGATGGG + Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070601577 10:77869901-77869923 GCTCAGCACGACCCAGCTATGGG - Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1073556037 10:104452602-104452624 GCTGAGCAGCACAGTGCTAGTGG - Intronic
1074673118 10:115818253-115818275 GCTCAGCAGCTCCATGCTTCTGG - Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077390307 11:2297828-2297850 AATCAGCAGCACCTTGATATTGG - Exonic
1078090347 11:8261200-8261222 GCCCAGCAGCTCCATGGTAGTGG + Intronic
1078361318 11:10670072-10670094 GATCAGCAGCACCTTGTTTTTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1085678583 11:78549151-78549173 TCTCAGCAGCACCATGCCCAAGG - Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086552942 11:88073284-88073306 GTTCAACAGAACCATGCTACAGG + Intergenic
1087700239 11:101429244-101429266 CTTCAGCAGGATCATGCTATAGG - Intergenic
1090996664 11:131872275-131872297 GCTCAGCAGCAACTGGCTTTTGG + Intronic
1091686936 12:2569206-2569228 GCTGAGGGGCACCATGCTCTAGG + Intronic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096421385 12:51461238-51461260 GGTCAGCAGTACCATGAGATTGG + Exonic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1104253362 12:127117635-127117657 GCTCAGCAGGAGCCTTCTATTGG - Intergenic
1104291265 12:127471218-127471240 ACTCACCAGCTCCATGCTCTTGG + Intergenic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1107726141 13:43301430-43301452 TCTCAGCAGTACCATTCCATAGG - Intronic
1107793841 13:44030002-44030024 GCTGAGCAGCACCATGTGGTTGG + Intergenic
1107985879 13:45775752-45775774 CCTCATCAGCACCAAGCTGTGGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1113601911 13:111575558-111575580 CCTCAGCAACACCATGCGGTTGG + Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119899866 14:78250534-78250556 TGTCAGCAGCCCCATGCTCTTGG - Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127719915 15:61689237-61689259 GCTTAGCAGCACCATGCCATAGG - Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1131801173 15:96070886-96070908 GCTCGGGAGCACCATGCCAATGG - Intergenic
1133623840 16:7551504-7551526 GCTCAGTAGCACAGAGCTATTGG - Intronic
1139377861 16:66511696-66511718 ACTCAGCAGCACAAAGCCATGGG + Exonic
1140533769 16:75690427-75690449 TGTCGGCAGCTCCATGCTATGGG - Intronic
1140759439 16:78097980-78098002 GCTCCCCAGCCCCATGTTATAGG - Intergenic
1141505028 16:84471355-84471377 GCTCAGCAGCACCAGGGCAGAGG + Intergenic
1141858186 16:86699176-86699198 GTTCATCAGCACTAAGCTATGGG - Intergenic
1148142037 17:45335850-45335872 TCTCAGCAGATCCATGCTGTTGG - Intergenic
1149288633 17:55194037-55194059 CATCAGAAGCACCATGCAATAGG - Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1151897877 17:76992511-76992533 GCTCAGCAGAACCTTGCTTTAGG - Intergenic
1152288114 17:79424071-79424093 GCTGTGCAGCACCCTGGTATGGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155759753 18:29550397-29550419 ACCCAGCAGCACCTTGATATTGG - Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157875263 18:51267219-51267241 GCTCTGCAGCACCTTGATCTCGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1162763117 19:12900279-12900301 GCTCAGACACACCATGTTATAGG + Intronic
1163639923 19:18456403-18456425 GCTCAGCAGGACCATCGTCTGGG + Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1165825715 19:38704717-38704739 GCTCAGCAGCAGGAGGCTCTGGG + Intronic
1167641310 19:50683570-50683592 GCTCTTCAGCACCATGCTTGGGG + Intronic
925314883 2:2913891-2913913 GCTCAGCAGGAGCCTGCAATGGG + Intergenic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
929127621 2:38535702-38535724 GCTCGGCAGGACCAGGCTCTGGG + Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
933319730 2:80758131-80758153 GCTCAGCCGCAGGATGCTCTTGG + Intergenic
938776216 2:134543876-134543898 GCTCAGCAGCACATTGGGATGGG - Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
944597024 2:201270442-201270464 GCTCAGCGGACCCAGGCTATTGG - Intronic
946313310 2:218894796-218894818 GCTAAGGAGCACCCTGATATGGG - Intronic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
947369738 2:229432763-229432785 GCTCATCAGAACCATGTTAGAGG - Intronic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1174173191 20:48629540-48629562 TCCCAGCAGCACCAGGCTTTGGG + Exonic
1177104841 21:16943030-16943052 GTTCAGCGGCACTATACTATAGG - Intergenic
1177723364 21:24936160-24936182 GAGAAGCAGCACCATGCTCTGGG + Intergenic
1179467492 21:41586458-41586480 CCTGGGCAGCACCATGCTACTGG + Intergenic
1179730034 21:43362518-43362540 GCTCAGCAGCACCATCTGCTTGG + Intergenic
1181481325 22:23201021-23201043 GCTTAGCAGCACCAAGCACTAGG - Intronic
1185380826 22:50506884-50506906 GCTCAGCAGCTCCAGGCCCTGGG + Exonic
950081069 3:10222491-10222513 GCTCAGAAGCTCCATGCTGAGGG + Intronic
950103313 3:10371851-10371873 GATCAGCAGCTCCATGGTCTTGG + Exonic
950843009 3:15986288-15986310 GCACAGAAGCACCATGTTAGGGG + Intergenic
952884899 3:38006296-38006318 GCCCATCAGGACCATGCTGTCGG - Intronic
954900683 3:54016598-54016620 GCTCAGAAGGACCTTGCTCTTGG + Intergenic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
956099997 3:65758188-65758210 GCTCAACAGCTCCATTCTAGGGG - Intronic
956931092 3:74043793-74043815 GCTCAGCTGCAGCATGATAAAGG + Intergenic
959266654 3:104149084-104149106 GCCCAGGAGTTCCATGCTATAGG - Intergenic
959766460 3:110036142-110036164 GTTCAGCCACACTATGCTATAGG - Intergenic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
961793593 3:129393880-129393902 GCCCAGGAGCTCCATGCCATGGG - Intergenic
961809830 3:129515327-129515349 GCCCAGGAGCTCCATGCCATGGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
967939968 3:194758025-194758047 GCTCAGGAGCAAGATGCTTTTGG + Intergenic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
969710944 4:8843083-8843105 GCTCTTCACCACCATGCCATCGG - Intergenic
972688484 4:41373728-41373750 GCTCCTAACCACCATGCTATGGG + Intronic
973974283 4:56246620-56246642 CCTCAGAAACACCATGCCATGGG - Intronic
974964063 4:68738235-68738257 GCTTAGCAACAGCATGCTGTAGG - Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
985006678 4:185541299-185541321 CCTCAGCTTCACCTTGCTATTGG + Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986341963 5:6796883-6796905 GCTCAACAGAACCATGCTCTTGG - Intergenic
986378909 5:7163067-7163089 GCTCACCAGCAACATGCAAGGGG - Intergenic
990120570 5:52445945-52445967 GCTCTGCAGCATAATGCTTTAGG + Intergenic
990532350 5:56687071-56687093 GCTCAGCAGCAGCATGCATGAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992275231 5:75109669-75109691 GCTCAGCAGCAACTTTCTTTTGG - Intronic
993243146 5:85415971-85415993 GCTCAGCAGCAACAGTCTACAGG - Intergenic
993443217 5:87980670-87980692 GCACAGCTGCACCATGATCTTGG + Intergenic
993978957 5:94518491-94518513 GTTCTCAAGCACCATGCTATTGG - Intronic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995606374 5:113860080-113860102 GCTCAGTACCACCGTGCTATAGG - Intergenic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997258473 5:132447234-132447256 GCTCAGCAGCCCCAAGCTATGGG + Intronic
998148351 5:139743232-139743254 GCTCACCAGCACCTTGCTGGAGG + Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999660379 5:153856429-153856451 GTTCAGCAGCACCATGACACAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001734046 5:173984263-173984285 CTCCAGCAGCACCACGCTATGGG + Intronic
1002575556 5:180171948-180171970 GCTCACGAGACCCATGCTATAGG + Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1005683297 6:28227807-28227829 GCTCAGAAGTGCCATTCTATTGG + Exonic
1006290258 6:33129482-33129504 ACTCAGCAGCAGCATCCTCTTGG - Intergenic
1007679111 6:43622150-43622172 GCTCACCATCACCATGCCCTGGG + Exonic
1009693538 6:67067104-67067126 GTCTAGCAGCACCAAGCTATAGG - Intergenic
1010527563 6:76922536-76922558 GTTCAGCAGCTACTTGCTATAGG + Intergenic
1011508252 6:88071888-88071910 ACTCAGCAGCACTATGCTATAGG - Intergenic
1011793798 6:90930226-90930248 TCACAGCAGCTACATGCTATTGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1015870318 6:137769603-137769625 ACACAGCAGTACAATGCTATAGG - Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1019214783 6:170436084-170436106 GCCCAGCTGCCCCCTGCTATGGG + Intergenic
1019925459 7:4189178-4189200 GCCCAGCAGCACCGTGCCAGAGG - Intronic
1019969551 7:4529222-4529244 GCTCAGCAGACCCAAGCTCTGGG - Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1024211640 7:47211121-47211143 ACTCAGGAGCTCCATTCTATTGG - Intergenic
1024704168 7:51938967-51938989 CCCCAGCAGCACCAAGCTATGGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1025202525 7:56970970-56970992 GGTCAGCAGCAACCTGCCATTGG - Intergenic
1025669424 7:63605957-63605979 GGTCAGCAGCAACCTGCCATTGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1035285859 7:157806908-157806930 CCTCAGCAGCACCAAGCTCAGGG + Intronic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041563547 8:59248378-59248400 GCTCAGCCTCACCATGCCTTAGG - Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1044091290 8:88005216-88005238 GCTCAGCTGGACAAGGCTATTGG - Intergenic
1044407584 8:91846564-91846586 ATTCAGCAGTATCATGCTATAGG + Intergenic
1044482679 8:92711146-92711168 GCTCCCCAGCACTACGCTATTGG + Intergenic
1047853930 8:128889465-128889487 TCTCAGCAGCACCTTCCTAAGGG + Intergenic
1048080114 8:131117764-131117786 GTTGAGCTGCACCATGCTATAGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060059585 9:120447231-120447253 GCTCAGCTGCATCATTCTGTGGG + Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188901218 X:35734562-35734584 GCTGAGCAGCATCATTCTGTGGG - Intergenic
1191701507 X:64047556-64047578 GCTAAGCAGCATCATTCTGTAGG + Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1193758796 X:85440646-85440668 ACTCAGCAGCTCCAGTCTATGGG - Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196067988 X:111487082-111487104 TTTCAGCCACACCATGCTATTGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1199882044 X:151981632-151981654 GCCCACCAGCACCTTGCTCTAGG - Intergenic