ID: 1082937049

View in Genome Browser
Species Human (GRCh38)
Location 11:58666022-58666044
Sequence GGGTGTACAAAATGTCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 2, 1: 2, 2: 6, 3: 15, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082937049 Original CRISPR GGGTGTACAAAATGTCACAG GGG (reversed) Intronic
903603504 1:24558475-24558497 GGAGGTACAAAATGTGAGAGAGG - Intronic
904797773 1:33070299-33070321 AGGTGGAAAAAATGTCCCAGAGG + Intronic
908737381 1:67290804-67290826 GGGGATCCAAAATGTCACTGTGG + Intergenic
909359065 1:74741415-74741437 GGGTGTCCAAAATTTAACTGGGG + Intronic
910555758 1:88530597-88530619 GGGTACAAGAAATGTCACAGAGG + Intergenic
911528000 1:99008635-99008657 GGATGTACAAAAAGTCAAGGTGG + Intergenic
912705316 1:111907263-111907285 GTGTGTACAAAATAACAAAGGGG + Intronic
912904541 1:113690047-113690069 GGGTGTATAATATACCACAGGGG - Intergenic
914133970 1:144883318-144883340 GGGGGTGCAAAAAGCCACAGCGG + Intergenic
914708095 1:150187979-150188001 AGGTGTAAAAAATGTCCCAATGG - Intergenic
917129707 1:171728611-171728633 GGGCTTATAAAATGTCACAGAGG + Intronic
917145440 1:171885633-171885655 GGGTGTCAAAGATGTGACAGGGG + Intronic
918847737 1:189640341-189640363 GGTTGGAGAAAATGTTACAGAGG - Intergenic
921112746 1:212054912-212054934 GGTTGTACAGAATGTCACTCGGG - Intronic
921314075 1:213874285-213874307 GGGGGTCCAAAATGTCATTGTGG + Intergenic
923878552 1:238077008-238077030 GGGTCTAAATAATGTCACTGCGG - Intergenic
1064459665 10:15521708-15521730 GAGTGTACGTAATGTCACCGTGG - Intronic
1067247672 10:44559852-44559874 GGGTGTAGAATAAGGCACAGGGG - Intergenic
1067460709 10:46456255-46456277 GGGTGGACAGAGAGTCACAGTGG + Intergenic
1067626482 10:47928345-47928367 GGGTGGACAGAGAGTCACAGTGG - Intergenic
1068813997 10:61289180-61289202 GGGTGATGAAAATGTTACAGTGG + Intergenic
1070086353 10:73240960-73240982 GGGTCTACAAAATCTCAAAGCGG + Exonic
1077518570 11:3017240-3017262 GGGTGTCAACATTGTCACAGAGG + Exonic
1077693029 11:4366394-4366416 GATTGGAGAAAATGTCACAGAGG + Intergenic
1078716901 11:13848483-13848505 GGGTGTGTACAATGTCACTGCGG + Intergenic
1079040601 11:17055911-17055933 GGGTGTACAAAATGTCACAGGGG - Intergenic
1079663773 11:23076911-23076933 TGGTGTACAAATTGTCACCCAGG - Intergenic
1082937049 11:58666022-58666044 GGGTGTACAAAATGTCACAGGGG - Intronic
1083736003 11:64681852-64681874 GGGTGTACACCATGCCAGAGAGG + Intronic
1085881534 11:80473109-80473131 GTGTGTACAAACTTGCACAGGGG + Intergenic
1087529620 11:99362063-99362085 GGGAATACAAAATGTTACAGAGG - Intronic
1089945204 11:122463312-122463334 TGTTGTACCAAATGTCACAAAGG - Intergenic
1093318704 12:17684931-17684953 GGGAGTGTAATATGTCACAGTGG - Intergenic
1096742020 12:53700545-53700567 GGGAGAACAAAATCTCAGAGAGG + Intergenic
1097477265 12:60073671-60073693 GGGTATATAAAAACTCACAGAGG + Intergenic
1097553476 12:61105980-61106002 AGGTGTACTCCATGTCACAGGGG + Intergenic
1098244558 12:68502959-68502981 GAGTGTACACATTGTAACAGGGG + Intergenic
1104235794 12:126935266-126935288 GGGGGTACAAAGTTTCACTGCGG + Intergenic
1107633282 13:42364633-42364655 GGGTGGAGAAAATGACACACAGG + Intergenic
1108052663 13:46461649-46461671 GTGTGTACAAAACGTCACAGAGG - Intergenic
1108908580 13:55512437-55512459 TGGTCTGCAAAAGGTCACAGGGG - Intergenic
1109538466 13:63743333-63743355 GTGTGTACAAAACGTCACAGAGG - Intergenic
1109545373 13:63836436-63836458 GTGTGTACAAAACGTCACAGAGG + Intergenic
1109978801 13:69877834-69877856 TGGTGTAGAAAATATAACAGAGG - Intronic
1115230694 14:31157387-31157409 GAGTGTATAAAATGTAACATTGG - Intronic
1116937467 14:50756874-50756896 GAGTGTACATCATGTCATAGAGG - Exonic
1124663912 15:31575243-31575265 GGGTGTACAACATACCACACAGG - Intronic
1124802932 15:32852276-32852298 GGATGTACAAAATGAAACAGAGG - Intronic
1125137479 15:36360429-36360451 GGGTCTATAGAATGGCACAGAGG - Intergenic
1126663526 15:51055042-51055064 GGCTGAAAAAAATGTGACAGAGG - Intergenic
1127579732 15:60327450-60327472 GGGTGCACTCAACGTCACAGGGG - Intergenic
1129821342 15:78604050-78604072 GGATCAACAAAATGTCAGAGCGG + Intronic
1130529433 15:84734995-84735017 GTGAGTGCAGAATGTCACAGTGG - Intergenic
1131190913 15:90315894-90315916 GGCTGCACAAAATGACTCAGAGG + Intergenic
1133704557 16:8341158-8341180 GGGGGGAAAGAATGTCACAGAGG + Intergenic
1135228069 16:20678892-20678914 GGCTGAACAAAATCTCAGAGGGG - Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1136652150 16:31682098-31682120 GGGTGGTGAAAATGTGACAGGGG - Intergenic
1138868212 16:60849488-60849510 GGGTACTCAAAATGTCACTGTGG + Intergenic
1146311111 17:31769043-31769065 GGGTGTCCAAAATGTAACTCAGG - Intergenic
1203172876 17_GL000205v2_random:167335-167357 GGGTGTACAACATGTAACAACGG - Intergenic
1155361513 18:25007631-25007653 GAGTGTACAAAATGTCTCCATGG - Intergenic
1155493225 18:26419820-26419842 AAGTGTTCAGAATGTCACAGCGG - Intergenic
1160593507 18:79958468-79958490 TTGTGGACAAAATGTCACAAGGG + Intergenic
1162229735 19:9256154-9256176 GGGTGTACGCAATGTCACAGGGG + Intergenic
1162229743 19:9256221-9256243 GGGTGTACAGAATGTCACAGGGG + Intergenic
1162229757 19:9256311-9256333 GGGTGTACACAATGTCACAGGGG + Intergenic
1164919376 19:32077385-32077407 GGGGATACGAAATGTCTCAGTGG + Intergenic
926807156 2:16721678-16721700 GGGTATAAAAATTCTCACAGAGG - Intergenic
928821976 2:35372636-35372658 AGGTCTCCAAAATGCCACAGAGG - Intergenic
932598118 2:73106866-73106888 AGGTGAACCAAAGGTCACAGTGG + Intronic
933273931 2:80263829-80263851 GGCTGTAAAAAATGTTTCAGTGG - Intronic
934992505 2:98931405-98931427 GGGAGGAGAAAATGTCAGAGAGG - Intronic
935970798 2:108529009-108529031 GGGTATACAACAAGTCACTGAGG + Intergenic
937231573 2:120400992-120401014 TTGTGTACAAAATGGCACAAGGG - Intergenic
940905679 2:159167405-159167427 GGGTGTATAAAATCTCCCGGAGG - Intronic
941610225 2:167652364-167652386 TGAGCTACAAAATGTCACAGTGG - Intergenic
946568346 2:220993128-220993150 TGATGTACAAAGTGTCTCAGAGG + Intergenic
946612206 2:221471277-221471299 GGGTTCACAGCATGTCACAGGGG + Intronic
1169304996 20:4482054-4482076 GGGGGTTAAAATTGTCACAGAGG + Intergenic
1176328871 21:5529116-5529138 GGGTGTACAACATGTAACAACGG - Intergenic
1176398886 21:6291835-6291857 GGGTGTACAACATGTAACAACGG + Intergenic
1176438271 21:6697269-6697291 GGGTGTACAACATGTAACAACGG - Intergenic
1176462533 21:7024339-7024361 GGGTGTACAACATGTAACAACGG - Intergenic
1176486094 21:7406117-7406139 GGGTGTACAACATGTAACAACGG - Intergenic
1176791842 21:13327462-13327484 GGGGGCCCAAAATGTCACTGTGG - Intergenic
1183080776 22:35454626-35454648 AGGTGTCCAAAATCACACAGTGG - Intergenic
1185166100 22:49263283-49263305 GGGTATAAGAAATGACACAGAGG + Intergenic
949590637 3:5490777-5490799 ATGTGTACAAAATATCACATAGG - Intergenic
950955714 3:17051539-17051561 GGGGGAAAAAAAAGTCACAGTGG + Intronic
951423634 3:22517195-22517217 GGGTACACAAAATGTCATTGTGG + Intergenic
952691036 3:36206476-36206498 GAGGGTACAACATGTCCCAGTGG + Intergenic
953897562 3:46813795-46813817 GGGTACCCAAAATGTCACTGTGG - Intergenic
953934795 3:47032073-47032095 GAATGTACCAAATGTGACAGAGG + Intronic
956401612 3:68885566-68885588 GGGTATTCAAAATTTAACAGAGG + Intronic
957109874 3:75940799-75940821 GGGTGTAATTAATGGCACAGCGG + Intronic
958789010 3:98629888-98629910 GGGTACCCAAAATGTCACTGTGG - Intergenic
959135045 3:102407925-102407947 GTTTGTATGAAATGTCACAGAGG + Intronic
962649978 3:137478718-137478740 GGATCTAGAAAATGGCACAGTGG - Intergenic
962705489 3:138039280-138039302 GGGTGAATAAAGTATCACAGTGG + Intergenic
963018784 3:140851432-140851454 AGGTATACAAATTTTCACAGGGG - Intergenic
965193255 3:165559325-165559347 GGGTAAACTGAATGTCACAGGGG + Intergenic
972695730 4:41444582-41444604 GGGTGGTCAACATATCACAGTGG + Intronic
974841452 4:67304000-67304022 GGGTGTTTAATATGCCACAGTGG + Intergenic
975024308 4:69530321-69530343 GGGAACACAAAATGTCACAGCGG + Intergenic
976665108 4:87582239-87582261 GGTTGAACCAAATGTCCCAGTGG - Intergenic
976973043 4:91132332-91132354 AGGTGTACAAAAGGTCACAGAGG + Intronic
979160678 4:117456944-117456966 GGGTGTTCAAAATGAAAAAGTGG - Intergenic
982873230 4:160610975-160610997 GAGTTTTAAAAATGTCACAGAGG - Intergenic
986293231 5:6417078-6417100 GTGGGTACAGGATGTCACAGAGG + Intergenic
990124943 5:52503636-52503658 TAGTGTACAAAATCTCACAGAGG - Intergenic
994393159 5:99208369-99208391 GGGTGTACACAATATCGCAGGGG - Intergenic
1001315047 5:170636026-170636048 GAGTCTCCAAAATGTCACATCGG - Intronic
1001982123 5:176044746-176044768 GGGTGGACAACAGGTCCCAGAGG - Intergenic
1002235338 5:177799311-177799333 GGGTGGACAACAGGTCCCAGAGG + Intergenic
1003604682 6:7548395-7548417 GGGTGTTCTACCTGTCACAGAGG + Intronic
1007291624 6:40791563-40791585 GGTTGTCCTAAATGTCCCAGTGG + Intergenic
1010896331 6:81369078-81369100 GGGACTTGAAAATGTCACAGGGG - Intergenic
1011520633 6:88200942-88200964 GGGTGTCCACAATGCCCCAGAGG + Intergenic
1011950904 6:92962503-92962525 AGGTAAACTAAATGTCACAGGGG - Intergenic
1012981288 6:105832580-105832602 GGGTGTAGAAATTGCTACAGAGG - Intergenic
1013098038 6:106963748-106963770 GAATGTACTAAAAGTCACAGAGG + Intergenic
1013365334 6:109433378-109433400 GGGAGAAAAAAATGTCACTGTGG + Intronic
1014310075 6:119788677-119788699 GGGTGTAGGAAATGGCAGAGTGG + Intergenic
1015292135 6:131549285-131549307 GGCTGTGCAAAATGTCCCTGTGG - Intergenic
1020691248 7:11357347-11357369 GGGTGCTCAAAATGTCAAAAAGG - Intergenic
1021482715 7:21135558-21135580 GGGGGAAAAAAATGTCACAAAGG + Intergenic
1028675629 7:93457423-93457445 GGTTGAACAAGATCTCACAGTGG + Intronic
1029645619 7:101853910-101853932 AGGTGTGCAAAATGCCACTGCGG - Intronic
1033739207 7:144256400-144256422 GGGTGTCCAAAATGTCCCAGTGG + Intergenic
1036422792 8:8613700-8613722 AGGTGGACAAAAAGACACAGAGG + Intergenic
1037237453 8:16738108-16738130 GGGTGTTCAAAATATCATGGTGG - Intergenic
1037460052 8:19099805-19099827 GGGAGTACCGAATGTCATAGTGG - Intergenic
1037792677 8:21960141-21960163 GGGTCTGCAAAGGGTCACAGAGG - Intronic
1040632707 8:49234612-49234634 GGGTGCACAGCATGTCAAAGAGG - Intergenic
1042512363 8:69625348-69625370 GTGAGGACAAAATGTCACATGGG - Intronic
1048966249 8:139616878-139616900 GGCTGTAGAATATGGCACAGTGG - Intronic
1052388037 9:27845312-27845334 AGGTATAGAAAGTGTCACAGAGG - Intergenic
1055839284 9:80483053-80483075 GGCTGTACACAAGTTCACAGAGG + Intergenic
1056370054 9:85944857-85944879 GGGTGAACATCATGTCCCAGGGG - Intronic
1059393779 9:114017734-114017756 GGGTTTACAGAAGGTCACTGGGG + Intronic
1060488759 9:124066308-124066330 GGGTGTGCAATATCTCACAGTGG - Intergenic
1203785701 EBV:126278-126300 GGGTGTCCAAACGGTCCCAGAGG - Intergenic
1203433239 Un_GL000195v1:111344-111366 GGGTGTACAACATGTAACAACGG + Intergenic
1185827706 X:3268081-3268103 CGGTGAACAAAAAGTCACTGGGG + Intergenic
1186323820 X:8457665-8457687 GGGATTACAAAATATCACAAAGG - Intergenic
1194032167 X:88831161-88831183 GGGGATCCAAAATGTCACTGTGG - Intergenic
1194969576 X:100328309-100328331 GGGTGTAAAAAATATTAAAGAGG + Intronic