ID: 1082937875

View in Genome Browser
Species Human (GRCh38)
Location 11:58673389-58673411
Sequence CATGTTTGTACAGCCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082937875_1082937878 0 Left 1082937875 11:58673389-58673411 CCCTCAAAGGCTGTACAAACATG 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1082937878 11:58673412-58673434 CATTCCTGGCAATAACCTAGAGG 0: 1
1: 0
2: 0
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082937875 Original CRISPR CATGTTTGTACAGCCTTTGA GGG (reversed) Intronic
909337295 1:74490470-74490492 CATGTTTGTAGATCCTATCATGG - Intronic
915222191 1:154384011-154384033 TATTTTTGTACAGCATGTGATGG - Intergenic
919148466 1:193664467-193664489 AATGATTGAACAGCCTGTGAAGG + Intergenic
919691356 1:200531265-200531287 CATGTTTTCACAGCCTCTGGTGG + Intergenic
921379951 1:214514280-214514302 TATCTTTGTAGAGCGTTTGAGGG - Intronic
923185592 1:231569879-231569901 TAGGTTTGGAAAGCCTTTGATGG - Intronic
1065051826 10:21800367-21800389 AATGTTTTTAGAGCCTCTGAGGG - Intronic
1067038689 10:42936897-42936919 CAGGTTTGTATAGTCCTTGAGGG - Intergenic
1071940016 10:90579856-90579878 CATGTATGTACAGTCTATGTAGG - Intergenic
1071985819 10:91049205-91049227 AATTTTTGTCCAGCTTTTGAAGG - Intergenic
1073584776 10:104699278-104699300 CATGTTTGCAGAGCTCTTGATGG + Intronic
1073593489 10:104778217-104778239 AATGGTTGTACAAACTTTGAGGG - Intronic
1074400066 10:113134507-113134529 CCTGTTTTTCCAGCCTGTGAGGG - Intronic
1075204243 10:120433065-120433087 CATTTTTGTACAAACTTTGGGGG - Intergenic
1075214083 10:120516774-120516796 CCTGTTTGTCCAGCCTTTCATGG + Intronic
1077294428 11:1818818-1818840 CATGTGTGAACTGCCTTTGAGGG + Intergenic
1078428006 11:11267059-11267081 CATGTGTGCACAGCCGTTGTAGG + Intergenic
1079254783 11:18818615-18818637 CATGGTTGTACACATTTTGAGGG + Intergenic
1082573431 11:54771569-54771591 CATTTTTGTAGAACCTGTGAAGG + Intergenic
1082937875 11:58673389-58673411 CATGTTTGTACAGCCTTTGAGGG - Intronic
1087232379 11:95680919-95680941 CCTGTATGTATAGTCTTTGAAGG + Intergenic
1088384688 11:109240378-109240400 AATATTTGGACAGCCATTGAAGG - Intergenic
1089073736 11:115720596-115720618 CATGTTTGCACTGCAATTGAAGG + Intergenic
1091314816 11:134606884-134606906 CATATTTGTATAGATTTTGATGG + Intergenic
1093011182 12:14108886-14108908 CAGGAATGTACAGCCTGTGAGGG + Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1098187673 12:67915479-67915501 GATGTTGGTAGATCCTTTGAAGG + Intergenic
1101882391 12:108634290-108634312 CATATTTGCAAACCCTTTGAAGG - Intergenic
1108017751 13:46094320-46094342 CATGTTTGTACCACCTCTCAAGG + Intronic
1108648692 13:52454940-52454962 CACGTTTGCACAGCGTGTGAAGG - Intergenic
1109105125 13:58240382-58240404 GATGTTCGTTCAGTCTTTGAAGG - Intergenic
1109166415 13:59040500-59040522 CTTGTTTGTAGTGCCTGTGAAGG - Intergenic
1109405342 13:61890629-61890651 CATGTTTCTAGAGCCTTGAATGG - Intergenic
1113206183 13:107919414-107919436 CATGCTTTTACAGCCATTGCAGG + Intergenic
1116281246 14:42911296-42911318 CATACTTTTACAGCCTTTGCAGG + Intergenic
1116300302 14:43171774-43171796 CATAGTTGTACAGATTTTGAGGG - Intergenic
1118793133 14:69114138-69114160 TAAGTTAGTACAGCCTTTGGTGG + Intronic
1122829756 14:104389937-104389959 CCTGTCTGCACAGCCTTTGATGG - Intergenic
1124662645 15:31562792-31562814 CATGTATGTACTGTCTTCGACGG - Intronic
1125104158 15:35951032-35951054 GATGTTTGAACACTCTTTGAAGG - Intergenic
1125260957 15:37824130-37824152 CATCTTTGTACAGCCCTTGTAGG - Intergenic
1126838983 15:52697225-52697247 CATGGTTGTGCAGGCTTTGCAGG - Intronic
1127053444 15:55108510-55108532 CCTGTTTCTACAGTCTTTGGGGG - Intergenic
1131391866 15:92056209-92056231 CACATTTGTTCAGCCTTTGGGGG + Intronic
1133366810 16:5216708-5216730 CATGAGTGTACAGCATTTGTGGG + Intergenic
1133386187 16:5372134-5372156 CATTCTTGAACTGCCTTTGAAGG + Intergenic
1133912765 16:10080823-10080845 TATACTTGAACAGCCTTTGAAGG + Intronic
1135036220 16:19079321-19079343 CAACTTAGTACATCCTTTGATGG - Exonic
1138903150 16:61298254-61298276 CATGTTTGTACATACTAAGACGG - Intergenic
1138920155 16:61517654-61517676 CAAGTGTGTACAACCTGTGAGGG + Intergenic
1143137138 17:4718251-4718273 CATGGTAGTACAGCTTTTGGGGG - Exonic
1147908637 17:43840841-43840863 CTGGTTTGTACAGCCTTTTGGGG + Intergenic
1153456954 18:5293617-5293639 CATATTTGTACAGAGATTGATGG + Intronic
1155402768 18:25457259-25457281 TATGTTTGTCCTGCCTTTGGGGG - Intergenic
1157552838 18:48593278-48593300 CAAGTTTGTAGTGCATTTGAAGG + Intronic
1157657728 18:49408085-49408107 TATGTTTGTATAGCTTTTTATGG - Intronic
1159637475 18:70822671-70822693 CATTTTTGTGCAGGCTTTGGGGG - Intergenic
1160176758 18:76601170-76601192 CATGTTTCTATAGCATTAGATGG + Intergenic
925779005 2:7362818-7362840 CATGTTTGTAAGCCCTTTGAAGG + Intergenic
929735269 2:44541478-44541500 TATGTATGTACAGTATTTGAAGG + Intronic
931239956 2:60443370-60443392 CAAGCTTCTACAGTCTTTGATGG + Intergenic
931411721 2:62039092-62039114 CATTTATTTCCAGCCTTTGAAGG + Intronic
932353974 2:71053053-71053075 CATGGGTGTACATCCTGTGACGG - Intergenic
935314532 2:101818570-101818592 CAAGTTTGAACAGCATTTTAAGG + Intronic
939624777 2:144463291-144463313 AATTTTTGGACAGCCTGTGAAGG + Intronic
945589483 2:211712167-211712189 CTTGTTTCTACAGCTTGTGATGG - Exonic
946630522 2:221662657-221662679 CTAGATTGTACAGTCTTTGAAGG + Intergenic
947555342 2:231087524-231087546 CAGGTTTGTAAAGTTTTTGAAGG + Intronic
947952378 2:234159477-234159499 CATGTTTGGATATCTTTTGAGGG + Intergenic
948316013 2:237029067-237029089 CCCGTTTCTGCAGCCTTTGAAGG + Intergenic
1169323820 20:4658466-4658488 TATCTTTGTTTAGCCTTTGATGG - Intergenic
1172201721 20:33131729-33131751 CATATTTCTACAGCCTTTGGAGG - Intergenic
1178073723 21:28996355-28996377 CAAGTCTGTAAATCCTTTGAAGG + Intergenic
1178301029 21:31453302-31453324 CATGTTGGAACTGCCTATGAAGG + Intronic
1183918626 22:41145451-41145473 CTTGAATGTACAGCCCTTGATGG + Intronic
953221868 3:40979146-40979168 CATTCTTGTCCAGCCTGTGAGGG - Intergenic
955893817 3:63677712-63677734 AATGTTTGTAAAGCCCTTAAAGG - Intronic
956787925 3:72657865-72657887 CATGACTGAAGAGCCTTTGAAGG + Intergenic
957043887 3:75359542-75359564 CATGTGTGTACATTCTGTGATGG + Intergenic
957075682 3:75601727-75601749 CATGTGTGTACATTCTGTGATGG + Intergenic
961880535 3:130058515-130058537 CAGGGCTGTACTGCCTTTGAAGG - Intergenic
962962410 3:140322741-140322763 CCTGGTTGTAAAGCCTCTGAGGG + Intronic
965831891 3:172800039-172800061 CAGGTTTGTCCAGGCCTTGAGGG + Intronic
966502928 3:180665919-180665941 TTTGTTTGTACAGCATTTTAGGG + Intronic
972791079 4:42371985-42372007 CTTGTTTTTACTGCCATTGAAGG - Intergenic
973795963 4:54426765-54426787 TCTGTTTGTACAGCATTTGGTGG - Intergenic
973891421 4:55371072-55371094 TATTTTTTTACATCCTTTGAAGG + Exonic
979530922 4:121768274-121768296 CATGATTGTACTGCCTCTCAGGG + Intergenic
981921938 4:150095300-150095322 CATGATTTTACCGCCTATGAAGG + Intronic
982013123 4:151126048-151126070 CAGGTATGTGCAGCCTTTGTCGG - Intronic
982890423 4:160842265-160842287 CATGTTTGTACAGACACTGGTGG + Intergenic
983567332 4:169167201-169167223 GATGTTTGTATAGCCATGGAAGG + Intronic
984716074 4:182926524-182926546 CATGTTTGCATGGCCCTTGAGGG - Intergenic
988735656 5:34018392-34018414 AATGTTTTTACAGCCATAGAAGG - Intronic
990344977 5:54863176-54863198 ATGGTTTGTCCAGCCTTTGAGGG + Intergenic
990898647 5:60726922-60726944 CATGTTGGTAGAGCTTTTTAAGG - Intergenic
992511097 5:77435838-77435860 CCTGTTTCTCCTGCCTTTGAAGG - Intronic
994216605 5:97144692-97144714 CATTTTTATACAGTCTTTAAAGG - Intronic
994413487 5:99439171-99439193 AATCTTAGTTCAGCCTTTGATGG - Intergenic
994691542 5:103025831-103025853 CATCTTTGTACAACCTTGTAAGG - Intronic
995928204 5:117401591-117401613 CCTAGTTGTACAGCCTTTAAAGG + Intergenic
996754865 5:126924969-126924991 CATGTTTGTAAAGACTTGGATGG - Intronic
997189578 5:131918465-131918487 CATATTTCTACAGTGTTTGAAGG - Intronic
997435754 5:133873819-133873841 TATGCTGGTACAGCCTTTGAGGG - Intergenic
1000353629 5:160372441-160372463 CATGTTTTTCCAACTTTTGAAGG + Intergenic
1001283610 5:170406321-170406343 CTTGTGTGTATAGCATTTGAGGG + Intronic
1001526471 5:172432322-172432344 CATGTTAGCACAGCATTTGTGGG + Intronic
1004429214 6:15528891-15528913 CATGTTTGAACAGCCCTCCAGGG + Intronic
1005656863 6:27947427-27947449 CATGATTGGACAGACTTTTAGGG + Intergenic
1006485192 6:34334131-34334153 CAGCTTTGTACAGCCTTGGCTGG + Intronic
1007940850 6:45779927-45779949 CCTGTCTGTACAGCCTCTCAGGG - Intergenic
1010112474 6:72254850-72254872 CATGTTTGCAAACACTTTGAGGG - Intronic
1011976105 6:93301244-93301266 CATATTTGTACATATTTTGAGGG + Intronic
1013467373 6:110429742-110429764 CATGTCTGTACAGCATTTAGTGG - Intronic
1013862178 6:114649141-114649163 TATGTTCCTATAGCCTTTGATGG - Intergenic
1016117047 6:140299866-140299888 CTTGTTTGATCTGCCTTTGAAGG + Intergenic
1016990417 6:149924566-149924588 GATCTGTGTACAGCTTTTGAGGG + Intergenic
1017539178 6:155382641-155382663 CATGATTGTAAACCCTCTGAAGG + Intergenic
1018762668 6:166905290-166905312 CATGTTTGTGAAGCCTTGCATGG + Intronic
1020517055 7:9135556-9135578 CCTGGTTGTACAGCAGTTGAAGG + Intergenic
1023266982 7:38417019-38417041 CCTATTTGTACAGTCTATGAAGG + Intronic
1023304658 7:38813051-38813073 CATTTTTGTACAGCTTTTTGTGG - Intronic
1026617946 7:71923847-71923869 CATGTTAGCATGGCCTTTGAAGG + Intronic
1028014170 7:85686186-85686208 CATGTTTCTCCAGGCTTTGCAGG - Intergenic
1034296720 7:149979537-149979559 CATATTTGCTCAGACTTTGAAGG + Intergenic
1034369866 7:150585535-150585557 CATGGTTGTACACACCTTGAGGG - Intergenic
1034426664 7:151017628-151017650 TATGTCTGTATAGCCTATGATGG - Intronic
1034587618 7:152109309-152109331 TATGTTCTTTCAGCCTTTGAAGG + Intronic
1034809309 7:154117292-154117314 CATATTTGCTCAGACTTTGAAGG - Intronic
1037728810 8:21506316-21506338 CATGTTTGAAGAGGCTTTTAGGG + Intergenic
1040776260 8:51046376-51046398 CTTTTTTGTAGGGCCTTTGAGGG + Intergenic
1041307439 8:56477066-56477088 GATGTTTGTGCAGCCAGTGAAGG - Intergenic
1042465440 8:69124739-69124761 TATGTTTGTATAGTTTTTGAGGG + Intergenic
1045108992 8:98921574-98921596 CAAGTTGTTACAGCCTATGATGG + Intronic
1050592007 9:7170484-7170506 CATGTTTGTTCATCTTTTAATGG - Intergenic
1050791229 9:9472582-9472604 CAAGTTTCTACAGCATTTGAGGG + Intronic
1189228022 X:39429919-39429941 CATGGCTGCACAGACTTTGATGG - Intergenic
1189813580 X:44802789-44802811 CATGTGTGTATTGTCTTTGATGG + Intergenic
1193707559 X:84841328-84841350 AATGTCTGTACACTCTTTGAAGG - Intergenic
1193720569 X:84981114-84981136 CATTTTTCTAGAGCCTTAGAAGG - Intergenic
1194703130 X:97139547-97139569 CATGTTTGCCCATGCTTTGAAGG + Intronic
1196489077 X:116246736-116246758 CAGGTATGTATAGCCGTTGAGGG + Intergenic
1198674149 X:139113990-139114012 AATGTCTTTACAGCCTTCGATGG + Intronic