ID: 1082941646

View in Genome Browser
Species Human (GRCh38)
Location 11:58711348-58711370
Sequence GAGAACTGAACAGAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 439}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082941646_1082941652 26 Left 1082941646 11:58711348-58711370 CCTGTCTCCTCTGTTCAGTTCTC 0: 1
1: 0
2: 3
3: 25
4: 439
Right 1082941652 11:58711397-58711419 CTTTCTGCAGAAAGTAAAAATGG 0: 73
1: 96
2: 52
3: 71
4: 583
1082941646_1082941649 -7 Left 1082941646 11:58711348-58711370 CCTGTCTCCTCTGTTCAGTTCTC 0: 1
1: 0
2: 3
3: 25
4: 439
Right 1082941649 11:58711364-58711386 AGTTCTCATGGCAAAATTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082941646 Original CRISPR GAGAACTGAACAGAGGAGAC AGG (reversed) Intronic
900606499 1:3525906-3525928 GCAAACAGAACAGAGCAGACAGG + Intronic
900627024 1:3612973-3612995 GGGAACTGAACATAGGGGTCTGG + Intergenic
901432522 1:9225740-9225762 GGGAAGAGAAGAGAGGAGACTGG - Intergenic
901479199 1:9512747-9512769 GTACACTGAACAAAGGAGACAGG - Intergenic
901931733 1:12600387-12600409 GAGCACACAGCAGAGGAGACGGG - Intronic
902700034 1:18166015-18166037 GTACACTGAACAAAGGAGACAGG - Intronic
903314312 1:22489310-22489332 GAGGACTCAACCAAGGAGACTGG + Intronic
903725172 1:25436930-25436952 GAGAAGGCAACAGAGGAGATGGG - Intronic
904578816 1:31524467-31524489 GAGAACTGAAAAGAGGAAGCAGG - Intergenic
905119247 1:35669167-35669189 GAGAACTGGACAGAGTGGCCTGG + Intergenic
906175681 1:43770205-43770227 GAGAAGTGAGGAGAGGAGAGGGG + Intronic
906253383 1:44328952-44328974 AAGAACTTCACAGAGTAGACTGG + Intronic
907570938 1:55483100-55483122 GAGAAGTGAAGAGAAGAGAGGGG + Intergenic
907884201 1:58577664-58577686 GAGAACTGGACAAAGAAGAGAGG - Exonic
909857020 1:80547812-80547834 GTACACTGAACAAAGGAGACAGG - Intergenic
910726539 1:90345769-90345791 GTGAAATAAACAGAGGATACGGG - Intergenic
911482996 1:98467869-98467891 GAGAACTGAAAAGACAAGAAGGG + Intergenic
911742197 1:101399060-101399082 GAGAACTGAAATGATGAGGCTGG - Intergenic
912338771 1:108889202-108889224 GTACACTGAACAAAGGAGACAGG + Intronic
912468259 1:109888857-109888879 GGGCAATAAACAGAGGAGACAGG + Intergenic
912988672 1:114460796-114460818 GTGAACTGAGCAGAGGAGCTTGG - Intronic
913488543 1:119356655-119356677 GTACACTGAACAAAGGAGACAGG + Intergenic
913560130 1:120009955-120009977 GAAAACTGAACATATGGGACTGG - Intronic
913637995 1:120783611-120783633 GAAAACTGAACATATGGGACTGG + Intergenic
914280716 1:146169374-146169396 GAAAACTGAACATATGGGACTGG - Intronic
914541759 1:148620314-148620336 GAAAACTGAACATATGGGACTGG - Intronic
914624881 1:149450933-149450955 GAAAACTGAACATATGGGACTGG + Intergenic
914948574 1:152089164-152089186 GACAACAGAGCAGGGGAGACTGG - Intergenic
916771327 1:167911637-167911659 GTACACTGAACAAAGGAGACGGG - Intronic
916912520 1:169366496-169366518 GAGCACTGAAGAGAAGAAACTGG + Intronic
918015067 1:180625239-180625261 GAGAAATTCACAAAGGAGACTGG - Intergenic
918601530 1:186368840-186368862 GAGAAGTGAACATAGGGGAAAGG - Intronic
919199222 1:194331241-194331263 GAGAAGAGAAGAGAGGAGAGAGG + Intergenic
919806638 1:201384556-201384578 GAGAGCTGCTCAGAGGAGGCAGG - Intronic
919966312 1:202529835-202529857 GAGAAAGGTACAGAGGAGAAAGG - Intronic
920386979 1:205576244-205576266 GAGAACTGCACTGAGCTGACAGG - Intronic
921349148 1:214217901-214217923 GGGCATTGAACAGAGGACACAGG + Intergenic
921367324 1:214385768-214385790 GAGATCTGATCAGATGAGACAGG + Intronic
922633414 1:227138447-227138469 GAAAACTTAGCAAAGGAGACTGG + Intronic
923150034 1:231224652-231224674 GAGAACTGAACAAAGAAGAGGGG - Intronic
924454477 1:244208080-244208102 GAAAGCTGTACAGAGGAGTCAGG + Intergenic
924576384 1:245284527-245284549 CAGAAATGAACTGAGGATACAGG - Intronic
924806943 1:247368969-247368991 GTGCATTGAACAAAGGAGACAGG + Intergenic
924887041 1:248229744-248229766 CAGAACTGGACAGAGCAGATTGG - Intergenic
1063237127 10:4128611-4128633 ATGAACTGAACACAGGAGATTGG + Intergenic
1063479137 10:6356478-6356500 GAGAATTGAACAGAGTCAACAGG - Intergenic
1064332868 10:14410202-14410224 GAGAAGAGAACAGAAGAGAAAGG + Intronic
1065583714 10:27197421-27197443 GAAAACTGAACTGAGGAAAATGG - Exonic
1065946185 10:30607421-30607443 GAGAACAGGAGAGAGGAGAGAGG - Intergenic
1067104235 10:43355252-43355274 GGGAACTGAGCAGAGGAGGTTGG - Intergenic
1067268164 10:44765648-44765670 GAGAAGAGAAGAGAGGAGAGAGG - Intergenic
1068040849 10:51822636-51822658 CAGAACTGAACAGGAGAAACTGG - Intronic
1068813190 10:61279895-61279917 TAGAACTCAATAGAGGAGCCAGG - Intergenic
1069460710 10:68592372-68592394 GAGAACTAAAGAGAGGTGATTGG - Intronic
1069587225 10:69616003-69616025 AATAACAGGACAGAGGAGACAGG - Intergenic
1070549948 10:77483254-77483276 GAGAACAGAGGAGAGGAGAAGGG - Intronic
1071398441 10:85245759-85245781 CAGGAAGGAACAGAGGAGACAGG + Intergenic
1072814688 10:98494217-98494239 GTATACTGAACAAAGGAGACAGG + Intronic
1073848431 10:107586582-107586604 GTACACTGAACAAAGGAGACAGG - Intergenic
1076368346 10:129936389-129936411 GAGGACAGAGCACAGGAGACAGG + Intronic
1077460062 11:2704614-2704636 GAGAACTGAAGAGAGGCAGCAGG + Intronic
1077910709 11:6569613-6569635 GAGAATGGATCAGAGGAGGCAGG + Intronic
1078007293 11:7541532-7541554 GAGGAATGGACAAAGGAGACAGG - Intronic
1080481877 11:32660201-32660223 GAGAACTGACCCAAAGAGACTGG - Intronic
1080663655 11:34317260-34317282 GAGATCTGAACAGAGGGCAGTGG - Intronic
1081778064 11:45690365-45690387 GTATACTGAACAAAGGAGACAGG - Intergenic
1082890442 11:58133259-58133281 GAGAATTTAATAGAGGAGATTGG + Intronic
1082941646 11:58711348-58711370 GAGAACTGAACAGAGGAGACAGG - Intronic
1083301374 11:61741137-61741159 GAGGACAGGACAGAGGAGGCTGG - Intronic
1083390032 11:62342037-62342059 GTATACTGAACAAAGGAGACAGG + Intronic
1083640266 11:64141651-64141673 GAGCACTGAGCCGAGGAGGCCGG - Intronic
1083831622 11:65237129-65237151 GAGAAGTGAGGAGAGGAGAGCGG + Intergenic
1084048185 11:66582762-66582784 GTGCACTGAACAAAGGAGACTGG + Intergenic
1084557956 11:69886027-69886049 GAGAGCTTCCCAGAGGAGACAGG - Intergenic
1084569153 11:69949200-69949222 CCAAACTGAACAGAGGACACAGG + Intergenic
1084813717 11:71632344-71632366 GAGCATTAAAAAGAGGAGACGGG + Intergenic
1085275055 11:75293044-75293066 GAGAAATGAGGAGAGGAGAGGGG + Intronic
1087324956 11:96710447-96710469 GTGAGCTCAGCAGAGGAGACAGG - Intergenic
1088102824 11:106173936-106173958 GTACACTGAACAAAGGAGACAGG + Intergenic
1088352381 11:108904672-108904694 GAGAAATAAACAGAGGAGATGGG - Intronic
1088368301 11:109061717-109061739 GAGAATGGAATAGAGCAGACAGG - Intergenic
1088546747 11:110966822-110966844 GAGACTTGATCAGAGGACACAGG - Intergenic
1088575391 11:111266604-111266626 GAGAACTGAACAGGTGGGAAGGG - Intronic
1089663296 11:119999787-119999809 GAGAGCTCAAAAAAGGAGACTGG + Intergenic
1089690354 11:120183222-120183244 GAGAACTGAGGAGAGGTGGCGGG + Intronic
1090093240 11:123718073-123718095 GAGAAGAGAACTGAGGAGAAGGG - Intergenic
1090840503 11:130483531-130483553 GAGAAATGAGGAGAGGAGAGAGG + Intergenic
1091203421 11:133800422-133800444 GAAAACTGACAAGAGGAGAAGGG + Intergenic
1091467546 12:698364-698386 GTACACTGAACAAAGGAGACAGG - Intergenic
1091534938 12:1397700-1397722 GGGAACAGGATAGAGGAGACAGG + Intronic
1091907089 12:4197642-4197664 GAGGAAAGAAGAGAGGAGACTGG + Intergenic
1092503989 12:9076644-9076666 TAGAAAAGAAGAGAGGAGACAGG + Intronic
1094297879 12:28928276-28928298 GAGCACTGGGCAGAGGAGCCTGG + Intergenic
1094477119 12:30849659-30849681 GTACACTGAACAAAGGAGACAGG + Intergenic
1095470968 12:42536433-42536455 GAGAATTGATCTGAGGAAACAGG - Intronic
1095537937 12:43274165-43274187 AAGAACTGAACAGAGAACATAGG + Intergenic
1095926488 12:47584511-47584533 GAGAAGACAACAAAGGAGACTGG + Intergenic
1095999786 12:48119488-48119510 GAGAACTGAAAGGAGCAGAAAGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096609379 12:52790956-52790978 CAGAGCTGAACAGAGAAGCCTGG + Intronic
1096800287 12:54106288-54106310 GAGAAGGGAAGAGAGGAGTCTGG + Intergenic
1097126566 12:56780970-56780992 GTATACTGAACAAAGGAGACAGG - Intronic
1097469107 12:59966615-59966637 GAGATTTGAAAAGAGGAGATGGG - Intergenic
1098556180 12:71821702-71821724 GAGGATTGAACACAGGAGCCTGG - Intergenic
1098711088 12:73762929-73762951 GTACACTGAACAAAGGAGACAGG - Intergenic
1100312736 12:93412581-93412603 GTATACTGAACAAAGGAGACAGG + Intronic
1100482922 12:94996521-94996543 GAGAACAGAAGAAAGGAGGCTGG + Intronic
1100587132 12:95990761-95990783 GAGAAAGGTAAAGAGGAGACAGG + Intronic
1101280320 12:103247723-103247745 GAGACATGTACAGAGGAGTCAGG - Intronic
1101729944 12:107418700-107418722 GAGAACTGCAAAGAAGGGACAGG - Intronic
1102448282 12:113020833-113020855 GAGAAGTGGACAAAGGACACGGG - Intergenic
1102619549 12:114183052-114183074 GAGAACTAAAGAGGGGAGAAAGG - Intergenic
1102701301 12:114841855-114841877 AAGAAAGGAACAGAGGAGGCAGG - Intergenic
1102760520 12:115380870-115380892 GAGCACAGCACAGAGGAAACTGG + Intergenic
1104560022 12:129834923-129834945 GAGAATTGAACAGAAGGGAGAGG + Intronic
1104935741 12:132363509-132363531 GAGAACAGAGCAGAGGGGACAGG - Intergenic
1105439122 13:20401354-20401376 GGGCACAGACCAGAGGAGACTGG + Intergenic
1105719248 13:23097918-23097940 GAGAAAACAATAGAGGAGACTGG + Intergenic
1106428898 13:29660329-29660351 GTACACTGAACAAAGGAGACAGG + Intergenic
1107428776 13:40319805-40319827 GAGAGCCACACAGAGGAGACTGG + Intergenic
1108901458 13:55413924-55413946 GAGGACTAAACACAAGAGACTGG - Intergenic
1109605321 13:64686892-64686914 GTACACTGAACAAAGGAGACAGG - Intergenic
1110699842 13:78534181-78534203 GAGAATGGAAGAGAGAAGACCGG - Intergenic
1111161171 13:84397202-84397224 AAAATCTGAACAGAGAAGACAGG + Intergenic
1113029643 13:105978879-105978901 GAGAACTGAGCATAGTAGATTGG - Intergenic
1113124844 13:106965841-106965863 GAGAACAGAAAGGAGGAGAAAGG - Intergenic
1114511019 14:23261017-23261039 GTACACTGAACAAAGGAGACAGG + Intronic
1115478708 14:33840974-33840996 GAGAACTGAAGAGCTTAGACTGG - Intergenic
1116300706 14:43178440-43178462 GTGAACTGAAGAAAGGAGCCAGG - Intergenic
1116423989 14:44767201-44767223 GGCAAATGAGCAGAGGAGACAGG + Intergenic
1118006277 14:61566686-61566708 GAGAAATCACCAGAGAAGACAGG - Intronic
1118147221 14:63152293-63152315 GAGAGCTGAAAAAAGAAGACAGG + Intergenic
1118437534 14:65785147-65785169 GGGATCTGGACAGAGGACACTGG + Intergenic
1121078332 14:91087772-91087794 GTACACTGAACAAAGGAGACAGG - Intronic
1121617717 14:95324035-95324057 GAGAAGTGATCAGAGGAGTGAGG + Intergenic
1122017476 14:98808454-98808476 GAGAAGTGAAGAGAGGTGCCCGG - Intergenic
1122428964 14:101628023-101628045 GAACCCTGCACAGAGGAGACGGG + Intergenic
1123828260 15:24105599-24105621 AAGAACGGAACAAAGGACACTGG - Intergenic
1123842562 15:24263549-24263571 AAGAACAGAACAAAGGACACTGG - Intergenic
1123852132 15:24369562-24369584 AAGAACGGAACAAAGGACACTGG - Intergenic
1123866660 15:24526156-24526178 GTGCACAGAACAAAGGAGACAGG - Intergenic
1126940179 15:53758627-53758649 GAGAGCTGAACAGGGAAGAAAGG + Intronic
1128403846 15:67314692-67314714 GAGTGCTGAACTGAGGACACAGG + Intronic
1130646312 15:85730234-85730256 GAGAAGTAAACAGGGGACACGGG + Intronic
1131291173 15:91108320-91108342 CAGAACTGAACTAAGGAGATTGG - Intronic
1131295240 15:91142216-91142238 AAGCACAGAAGAGAGGAGACAGG - Intronic
1131835326 15:96384409-96384431 GAGAGATGGACAGAGGAGAAAGG - Intergenic
1132054783 15:98642252-98642274 GAGAACTGAACAGGGACCACAGG - Intergenic
1132070011 15:98768130-98768152 GAGAACAGAACTGTGGAGAAAGG - Intronic
1132609783 16:809694-809716 GGGGGCTGAACAGAGGAGGCTGG + Intronic
1133802788 16:9097674-9097696 GAGAACAGAGCAGGGGAGCCTGG - Intronic
1134242054 16:12513393-12513415 GAGAACTGAGTAGAGGGGAGGGG - Intronic
1134425137 16:14134984-14135006 GACAACTGAAAAGAAGAGATGGG - Intronic
1134470258 16:14518701-14518723 GAGAACAGGATGGAGGAGACAGG + Intronic
1135200220 16:20430835-20430857 GAGAAATGGAGAGAGGAGAAGGG + Intronic
1135218470 16:20592772-20592794 GAGAAATGGAGAGAGGAGAAGGG - Intergenic
1135240778 16:20805889-20805911 GTACACTGAACAAAGGAGACAGG - Intronic
1135798269 16:25467114-25467136 GAGAAGAGAATGGAGGAGACAGG - Intergenic
1135949185 16:26897119-26897141 GAGAAATGAACAAAGCAGATGGG + Intergenic
1136296917 16:29309069-29309091 GAGGGATGGACAGAGGAGACGGG - Intergenic
1137039837 16:35600259-35600281 GCACACTGAACAAAGGAGACCGG + Intergenic
1137271322 16:46904159-46904181 GAGAAATGCACAGAAGAAACGGG + Intronic
1137295872 16:47092861-47092883 GAAAACTGAACAGACAAGATGGG - Intronic
1137623337 16:49891561-49891583 TAGAACAGCTCAGAGGAGACTGG + Intergenic
1138517198 16:57542725-57542747 GAGAACTGGGCAGAGGAGAGTGG - Exonic
1139265457 16:65634422-65634444 CAGAGCTGAACAGAGCTGACAGG + Intergenic
1141617692 16:85219685-85219707 AAGAAATGACCACAGGAGACAGG - Intergenic
1141826302 16:86482859-86482881 GAGAAATGAAAGGAGGTGACAGG - Intergenic
1142377609 16:89714417-89714439 GGGAACTGTATAAAGGAGACAGG - Intronic
1144427608 17:15158506-15158528 GAGGAGTGAACAGAGGTGTCAGG + Intergenic
1144864944 17:18329474-18329496 GAGAACTGGCCTGAGGATACTGG + Intronic
1145016509 17:19402152-19402174 ACGAGCTGAACAGAGGAGATTGG + Intergenic
1145359853 17:22203092-22203114 GAGAAGTGCATAGAGGAGAAGGG + Intronic
1147157718 17:38552585-38552607 GGGAAGTGAGCTGAGGAGACAGG + Exonic
1147534240 17:41308391-41308413 GAGCTCTGAACACAGCAGACAGG + Exonic
1151259853 17:72907888-72907910 GAGAAGTGGAAGGAGGAGACAGG + Intronic
1151344801 17:73494952-73494974 CAGGACTGATCAGAGGAGGCGGG + Intronic
1152022643 17:77788713-77788735 CAGATCTGAACAGAAGACACAGG - Intergenic
1152972905 18:182406-182428 TAGAACTGAGCAGAAGAGAAGGG + Intronic
1153959124 18:10125147-10125169 TCAAACTGAAAAGAGGAGACTGG + Intergenic
1154145249 18:11861408-11861430 GAGAAGGGGACAGAGGACACTGG + Intronic
1154274118 18:12945153-12945175 GAGAATTTAACACAGGAAACTGG - Intergenic
1154277181 18:12972246-12972268 GAGAACTGAACTGAGGAAGAAGG + Intronic
1155554634 18:27004931-27004953 TATAACTTAACAGAGGAGAAGGG - Intronic
1157169080 18:45385445-45385467 TAGAACTGAGCAGAGGAGAGAGG + Intronic
1157405374 18:47418381-47418403 AAGACCTGAACAGAAGAGAAAGG - Intergenic
1157410441 18:47458732-47458754 GAGAAATGAAGAGGGAAGACAGG + Intergenic
1158406259 18:57162270-57162292 GAGGGGTGATCAGAGGAGACAGG + Intergenic
1158904289 18:61997122-61997144 GTGAACTGAACAGGGGAGGTTGG + Intergenic
1159003777 18:62995091-62995113 GAGAACAGCACAGGGGAAACCGG - Intergenic
1159243780 18:65778391-65778413 AAAAACTGCACAGAGGAAACTGG + Intronic
1159941248 18:74410711-74410733 GAGAAAAGAACACAGGAAACTGG - Intergenic
1161112824 19:2479345-2479367 GAGAACTGAAGTGGGGAGAGGGG + Intergenic
1161950508 19:7465112-7465134 CAGAACTGATCAGAGGCAACTGG - Intronic
1163976481 19:20857992-20858014 GTACACTGAACAAAGGAGACAGG - Intronic
1164262692 19:23581849-23581871 CAGAACTGATTAGAGGAGATCGG + Intronic
1165359026 19:35322577-35322599 GTACACTGAACAAAGGAGACAGG + Intronic
1165923553 19:39313772-39313794 GAGAAATAGAGAGAGGAGACAGG + Intronic
1166259529 19:41627839-41627861 GAGAACTGAGCAGAGAATCCTGG + Intronic
1167054965 19:47104663-47104685 ACAGACTGAACAGAGGAGACAGG + Intronic
1167335429 19:48882538-48882560 GTACACTGAACAAAGGAGACAGG + Intronic
1167535742 19:50050450-50050472 GAGAACTGAACCCAGGAGGCCGG - Intronic
1167643219 19:50693316-50693338 GAGAATGGAACAGGGGAGAGTGG - Intronic
925271220 2:2608865-2608887 AAGAACTGAACAGAAGTGCCTGG - Intergenic
925364524 2:3302872-3302894 GAGAACAGAACAGAGGAAAAGGG + Intronic
927211222 2:20640388-20640410 GAAAACTGAGGAGAGAAGACAGG + Intronic
928817432 2:35316012-35316034 GTGAAGTGAACAGTGGAGAAGGG + Intergenic
930003268 2:46875983-46876005 AACAGCTGAACAGAGGAGACTGG + Intergenic
930158489 2:48129173-48129195 GAGGACTGAATGGAGGAGAAAGG + Intergenic
931722632 2:65078479-65078501 AAGAACTGATGAGAGGGGACAGG + Intronic
932290357 2:70571968-70571990 GAGAAATGAGCAGCTGAGACTGG + Intergenic
932553247 2:72794538-72794560 AAGAAGTGAACAGAGGACATAGG - Intronic
933406668 2:81868637-81868659 GTACACTGAACAAAGGAGACAGG - Intergenic
933679154 2:85083567-85083589 GAGACCTGATGAGAGGAGATAGG + Intergenic
933716334 2:85363825-85363847 GAGAACAGCACAGCAGAGACTGG + Intronic
934863350 2:97782722-97782744 AATAGCAGAACAGAGGAGACAGG + Intronic
934881073 2:97979631-97979653 TAGAACTGAAGAGAAGAGAGGGG + Intronic
934902438 2:98171498-98171520 AAGAACTGAAAAGAGGAGTGTGG + Intronic
938262041 2:129903286-129903308 GAGCACTGGACACAGGAGTCTGG + Intergenic
938732521 2:134157932-134157954 GAGAACTGAACAGACTTGTCAGG - Intronic
939045070 2:137240206-137240228 GAGAACTAGAAAGAGGAGAGAGG - Intronic
939881057 2:147631901-147631923 GAGGACTGATGAGAGGTGACTGG - Intergenic
940822850 2:158376748-158376770 TAGAATTGAAAAGAGGAGATAGG - Intronic
942354968 2:175100893-175100915 GTACACTGAACAAAGGAGACAGG - Intronic
943306501 2:186269115-186269137 GAGAAATAAACAGAAGAGATGGG + Intergenic
943881164 2:193145613-193145635 TAGGACAGACCAGAGGAGACTGG + Intergenic
944069946 2:195657381-195657403 GAGAACAGAACCGGGGAGTCGGG + Intronic
944271617 2:197789901-197789923 GGGACCTGAACAAAGGTGACAGG + Intergenic
947773856 2:232692275-232692297 GAGAACTGAACAAACAAGAAAGG - Intergenic
947801504 2:232931122-232931144 GAGAACAGGAAAGAGGTGACAGG + Intronic
947858876 2:233344700-233344722 GAGAACTAGGCAGAGAAGACAGG - Intronic
947864097 2:233384227-233384249 GAGAACTGAGCTGAGGATAAAGG - Intronic
948111495 2:235459908-235459930 TAGAACTGAACCAAGGAGAATGG + Intergenic
948915422 2:241032402-241032424 GGGAACTGAACAATGGAAACTGG - Intronic
1168900992 20:1364829-1364851 GAACACCGAACAAAGGAGACAGG - Intronic
1169812181 20:9619526-9619548 GGGACCTGAACACAGCAGACAGG - Intronic
1170597410 20:17816464-17816486 GAAAACTGAAGGGAGGAGAAGGG + Intergenic
1171036318 20:21715075-21715097 GAGGACTAGAAAGAGGAGACGGG - Exonic
1171796163 20:29568053-29568075 GAGAAGGGAAGAGAGGAGTCTGG - Intergenic
1171852072 20:30316114-30316136 GAGAAAGGAAGAGAGGAGTCTGG + Intergenic
1173472440 20:43334220-43334242 GTACACTGAACAAAGGAGACAGG - Intergenic
1173476520 20:43363718-43363740 GAGAACTGCAGAGAGGACTCAGG - Intergenic
1173971988 20:47160297-47160319 GAGAACTGAGTAGCTGAGACAGG - Intronic
1175549241 20:59805991-59806013 GAGAAGGGAACAAAGGAGACAGG - Intronic
1177595429 21:23234302-23234324 ATGCACTAAACAGAGGAGACAGG + Intergenic
1177725187 21:24958026-24958048 GAGAACTGAACAGAGATTAGTGG - Intergenic
1178581892 21:33844992-33845014 GAGAGGTAAACAGAGTAGACTGG - Intronic
1178865955 21:36327511-36327533 GTGAACTGAACAGAGGAGGCTGG + Intronic
1179500344 21:41804745-41804767 CAGAGCTGAACAGAGGAGACTGG - Intronic
1179828348 21:43981099-43981121 CAAAACTGAAGAGGGGAGACAGG - Exonic
1180105487 21:45615710-45615732 GAGAAGTGCACAGAGCAGAAGGG - Intergenic
1180206927 21:46266469-46266491 CAGAACTGGAAGGAGGAGACAGG + Intronic
1180672995 22:17567926-17567948 GTATACTGAACAAAGGAGACAGG + Intronic
1181688843 22:24547001-24547023 AAGGACTGAACAGAGAAGAGGGG + Exonic
1181918185 22:26297680-26297702 GAGAGCAAAACAGAGAAGACAGG - Intronic
1181997421 22:26893709-26893731 GAGAACAGAGAAGAGGAGAGGGG + Intergenic
1182027149 22:27129072-27129094 GAGAACTTCAGAGAGGAGAGAGG + Intergenic
1182243396 22:28935460-28935482 GAGAAATGAACTGAGGACATGGG - Intronic
1182598891 22:31444264-31444286 GTGAAGTGGACAGAGGTGACTGG - Intronic
1182923333 22:34100078-34100100 GTACACTGAACAAAGGAGACAGG - Intergenic
1183048883 22:35244822-35244844 GTATACTGAACAAAGGAGACAGG - Intergenic
1183310743 22:37108298-37108320 GAGGTCTGAACTGAGGTGACAGG - Intronic
1183579223 22:38713540-38713562 CAGGACTGGACTGAGGAGACTGG + Intronic
1183769202 22:39908937-39908959 GAGCACAGAACACAGGATACGGG - Intronic
1184120439 22:42446336-42446358 GAGGCCCGGACAGAGGAGACGGG + Intergenic
1184811224 22:46833667-46833689 GACAACTGAGCAGAGGAGCTTGG + Intronic
949529183 3:4937123-4937145 GAGAAGAGAACAGAGGTGGCAGG - Intergenic
949840614 3:8315951-8315973 GAGAATTTAATAGAGGAGATTGG - Intergenic
950115502 3:10448118-10448140 GAGGACTGGACAGAGGAGACAGG + Intronic
950448609 3:13053159-13053181 GAGAAAGGAAGAGAGGGGACTGG + Intronic
950688350 3:14635434-14635456 GAGAAATGAAGAGGGGAGAGAGG - Intergenic
950861959 3:16155957-16155979 GAGCAAAGAACTGAGGAGACAGG - Intergenic
952197180 3:31088212-31088234 GAGAATTTAAGAGAGGTGACTGG + Intergenic
953079014 3:39598021-39598043 GAGAACTACAAACAGGAGACAGG + Intergenic
954010554 3:47633233-47633255 GAGAATGGGACTGAGGAGACAGG + Intronic
954067029 3:48114999-48115021 GTACACTGAACAAAGGAGACAGG - Intergenic
955297847 3:57749637-57749659 TAGATTTGCACAGAGGAGACTGG + Intergenic
956087965 3:65633536-65633558 GAGAAAAGAACAGAGAAGGCAGG - Intronic
956595245 3:70959996-70960018 GACCACTGAGCAGAGGAGGCTGG + Intronic
957039398 3:75325827-75325849 TAGATCTGGAAAGAGGAGACAGG - Intergenic
957573587 3:81980756-81980778 GAGACTGGAACAGAGGAGTCTGG + Intergenic
958896868 3:99839115-99839137 GAGAATTGAGCAGGGGATACAGG - Intronic
960270930 3:115673772-115673794 GAGAACTGAGCAGTGGAGGAGGG + Intronic
960723199 3:120644744-120644766 GAGAACTGAAAAGAGGAAAAGGG + Intronic
961134554 3:124497689-124497711 GACAACAGGTCAGAGGAGACAGG - Intronic
961280099 3:125759375-125759397 GAGCATTAAAAAGAGGAGACGGG + Intergenic
962428056 3:135291749-135291771 GAGAGCTGAACAGGTGAAACAGG + Intergenic
962569656 3:136700091-136700113 TAGAACAGCACAGAGGAGAAAGG - Intronic
962714236 3:138113622-138113644 GAGACCTCAACAGAGATGACAGG + Intronic
962962719 3:140325870-140325892 GTACACTGAACAAAGGAGACAGG - Intronic
963324262 3:143843775-143843797 GAGCACTGAACAGGGGATACAGG + Intronic
963776164 3:149443645-149443667 AAGAACTGAACAAAGGTTACAGG + Intergenic
963914345 3:150844040-150844062 GAGAGCTGAACTGATAAGACAGG - Intergenic
964484210 3:157171003-157171025 GAGAACTGAGGAAGGGAGACTGG - Intergenic
964514429 3:157492637-157492659 GAGAACAGAACAGAGACAACAGG + Intronic
964766142 3:160179632-160179654 GACAAGTGAACAGAAGAGAGTGG + Intergenic
966223003 3:177569113-177569135 AAGAACGTAACAGAGGACACAGG - Intergenic
968867240 4:3221136-3221158 GAGGACTGGACAGTGGAGTCAGG - Intronic
969084258 4:4643828-4643850 GTGCACCGAACAAAGGAGACAGG + Intergenic
969193779 4:5544701-5544723 GAGAACTAAACAGAGAAGAGAGG + Intronic
969233423 4:5848081-5848103 AAGAAATGAAGAGAGGAGATAGG - Intronic
970843707 4:20509603-20509625 CAGAGCAGAACAGAGGAGAAGGG + Intronic
970959675 4:21857375-21857397 GAGAGCTGAAAAGAGATGACAGG + Intronic
971498673 4:27295179-27295201 GAGCACTCCACAGAGGAGAAGGG - Intergenic
972380647 4:38516800-38516822 AGGAACTTAGCAGAGGAGACCGG - Intergenic
972801981 4:42486098-42486120 GTACACTGAACAAAGGAGACAGG + Intronic
974349560 4:60726640-60726662 ATGAGCTGAGCAGAGGAGACTGG - Intergenic
974543812 4:63274942-63274964 GCGAACTGAACAGATGGGAGTGG + Intergenic
974679945 4:65147518-65147540 GGGAACTGAGCAGAGGTGACTGG - Intergenic
975010154 4:69340764-69340786 GTACACTGAACAAAGGAGACAGG + Intronic
975619013 4:76276882-76276904 GAGGATGGGACAGAGGAGACGGG - Intronic
975817701 4:78236152-78236174 GAGAACAGGAAAGAGGAGGCTGG + Intronic
976046333 4:80952755-80952777 GAGGGCAGAACAGAGGAGAGAGG - Intronic
976287047 4:83381012-83381034 GAGAAGAGAAGAGAGGAGAGGGG - Intergenic
977189264 4:93978714-93978736 GAGAACAGTACAGGAGAGACCGG - Intergenic
977573488 4:98654197-98654219 GAGAACTGTCCAGATGAGCCTGG + Intronic
977988340 4:103412598-103412620 GTACACTGAACAAAGGAGACAGG + Intergenic
978760416 4:112351273-112351295 GTGAACTGGACAGAGGAGGGTGG + Intronic
980249495 4:130296043-130296065 GAGAAAAGAAAAGAGGAGAAAGG - Intergenic
980970564 4:139563355-139563377 GAGCACAGAACAGGGGACACAGG - Intronic
981816603 4:148837972-148837994 GTATACTGAACAAAGGAGACAGG - Intergenic
981959930 4:150524386-150524408 GTGAACAGAAGAGTGGAGACAGG + Intronic
983859145 4:172683060-172683082 GAGAAATGAACGCAGGAAACAGG - Intronic
984429456 4:179629307-179629329 AAGGCCTGAACAGAAGAGACAGG + Intergenic
985121562 4:186648188-186648210 GAGGAGGGAAGAGAGGAGACAGG + Intronic
985166998 4:187107256-187107278 GGGATTTGAACAGAGGAGGCAGG - Intergenic
985584743 5:724720-724742 GAAAACTGCATATAGGAGACAGG - Intronic
985598246 5:809034-809056 GAAAACTGCATATAGGAGACAGG - Intronic
985670759 5:1205441-1205463 GAGCAGTGAACAGAGAGGACTGG - Intronic
985688146 5:1293042-1293064 GAGCAGTGAACAGAGGAGGCTGG - Intronic
986035092 5:3929751-3929773 GAGAAGTGAAGGGAGGAGAAGGG + Intergenic
986046206 5:4040808-4040830 GAGAAGAGAACAGAGGAGAAGGG - Intergenic
986723275 5:10575817-10575839 GAGAACTGATCAGAGGCTGCTGG + Intronic
987523539 5:19019011-19019033 GATAACTGAAAAGAGCAGGCTGG - Intergenic
988622060 5:32833140-32833162 GAGCAGTGCACAGAGGGGACTGG + Intergenic
989216231 5:38907508-38907530 GAGACCTAGACAGAGGAGAATGG + Intronic
989257137 5:39378052-39378074 GAGAATTTAAAAGAGGAGAGAGG + Intronic
991998077 5:72408023-72408045 GAGAACTGGGAAGAGAAGACAGG + Intergenic
992060106 5:73035796-73035818 GAGAATTGAGCAGTAGAGACTGG - Intronic
992949427 5:81843143-81843165 GAGGCCTTAAGAGAGGAGACAGG - Intergenic
993179955 5:84539977-84539999 GTACACTGAACAAAGGAGACAGG - Intergenic
995254971 5:110035599-110035621 GGGAAATGAAGAAAGGAGACTGG + Intergenic
996713489 5:126567276-126567298 GTACACTGAACAAAGGAGACAGG - Intronic
997570321 5:134922338-134922360 AAGAACTGAACTGAGGAGCTGGG - Intronic
998874156 5:146582538-146582560 GAGGACTGCTCAGAGGAGTCAGG - Intronic
998971063 5:147593114-147593136 GAGAACTGAAGAGTGATGACAGG + Intronic
999113839 5:149144190-149144212 GGAAAATGAACAGAGGAGAATGG + Intronic
999346979 5:150832078-150832100 GTACACTGAACAAAGGAGACAGG + Intergenic
999390822 5:151188241-151188263 GGAAATAGAACAGAGGAGACAGG + Intronic
999862456 5:155663172-155663194 GAGAACTGTACAGAGGTCAGTGG + Intergenic
1000315908 5:160090988-160091010 GAAAACCAAACAGAAGAGACCGG + Intronic
1000628864 5:163569068-163569090 AATAACTGACAAGAGGAGACAGG - Intergenic
1001702940 5:173720774-173720796 GAGAGCAGAACAGAGGGGAGGGG + Intergenic
1002207716 5:177575153-177575175 GTACACTGAACAAAGGAGACAGG + Intergenic
1002859381 6:1066571-1066593 AAGAAGTGAAGAGAGGAGAGGGG - Intergenic
1003844980 6:10163657-10163679 GAGAAAAGAACAGAGGTGAGCGG + Intronic
1003940665 6:11022149-11022171 CAGAACAGAAAAGAGGAGAAAGG + Intronic
1004442015 6:15662881-15662903 GAGGCCTGAGGAGAGGAGACCGG - Exonic
1004939505 6:20540990-20541012 GAGAGATGAGCAGAGGAGACTGG + Intronic
1004959806 6:20774314-20774336 GAGAACCAAACAGAGAAGATTGG + Intronic
1005391189 6:25335078-25335100 GTGAAATGAACAGAAGAGACAGG - Intronic
1005608963 6:27504915-27504937 GAAAACGGAAGAGAGGAGAAAGG - Intergenic
1006278850 6:33029929-33029951 GAGTATTCAACAGAGGGGACAGG - Intergenic
1007580298 6:42954767-42954789 GTACACTGAACAAAGGAGACAGG - Intergenic
1010507451 6:76677618-76677640 GAGAATTGAAGAGGGGAGAAAGG - Intergenic
1010567504 6:77433902-77433924 GACAATTGAACAGAAGAAACAGG - Intergenic
1010951564 6:82042857-82042879 TAGAGCTGAACTGGGGAGACAGG - Intergenic
1011014817 6:82743353-82743375 AAGAGCTGAAGAGAGGAGAATGG + Intergenic
1011626646 6:89288519-89288541 GAGAACTGCACAGCTGAGCCCGG + Intronic
1014161877 6:118179062-118179084 GAGAACTGAGCAGAAGCAACTGG + Intronic
1014186937 6:118445541-118445563 ACAAACTGAACAGAGAAGACTGG - Intergenic
1015966748 6:138701948-138701970 GAGAACTGAAATGAAGAGAAGGG - Intergenic
1016516162 6:144895053-144895075 CAGAACAGAACAGTGAAGACAGG - Intergenic
1017403711 6:154093716-154093738 GAGAACTGGACACAGAAGAGAGG + Intronic
1018426389 6:163686816-163686838 GAGAAAAGAACAGAGGGGAGGGG - Intergenic
1018604795 6:165585515-165585537 GAGAAGTGCACAGAGGAAAAGGG + Intronic
1018949043 6:168366549-168366571 GTACACTGAACAAAGGAGACAGG - Intergenic
1019037851 6:169076741-169076763 GAGAACGAAACACAGGTGACAGG + Intergenic
1020141801 7:5615772-5615794 GAGAACTGGGGAGGGGAGACAGG - Intergenic
1020976297 7:15011615-15011637 GAGAAAGGAGCAGAGGGGACTGG - Intergenic
1021722002 7:23513725-23513747 GTACACTGAACAAAGGAGACAGG + Intronic
1023132928 7:37021160-37021182 GAGAGGTGAAAAGAGGAGAGTGG + Intronic
1023357188 7:39379080-39379102 TAGAAGTGAAGAGAGGAGCCAGG + Intronic
1023956173 7:44888554-44888576 AAGAAATGAACAGAGGGGGCTGG - Intergenic
1023956222 7:44888872-44888894 AAGAAATGAACAGAGGGGTCCGG - Intergenic
1024947521 7:54825191-54825213 GAGAAAAGAACAGAGGAAAAGGG - Intergenic
1025850452 7:65239628-65239650 GGGAACTGGACACAGGGGACTGG - Intergenic
1026066282 7:67076257-67076279 GTACACTGAACAAAGGAGACAGG - Intronic
1026939808 7:74281043-74281065 GAGAAGAGAACATAGGAGATGGG - Intergenic
1027529767 7:79315757-79315779 GAGAGATGAAAAGAGGAGGCAGG + Intronic
1029076057 7:97935490-97935512 GAGCATTAAAAAGAGGAGACGGG - Intergenic
1029536240 7:101159463-101159485 GAGAATTGGACAAAGGAGACTGG - Intronic
1029984417 7:104909789-104909811 GAGAAATGGAGAGAGGAGTCAGG + Intergenic
1032354455 7:131197042-131197064 GAGAATTAAACAGAGGAGGATGG - Intronic
1034131035 7:148717688-148717710 GAAAACTGATCACAGGAGCCCGG - Intronic
1035031593 7:155864528-155864550 TGGAACTGAACAGAAGAGAAAGG - Intergenic
1035256122 7:157628870-157628892 AAGAAGTGAACAGAAGAGAGTGG - Intronic
1035554296 8:554696-554718 CAGAGATGAACAGATGAGACAGG + Intergenic
1036123589 8:6043834-6043856 GAGAGAGAAACAGAGGAGACAGG - Intergenic
1036260379 8:7235263-7235285 GAGCATTAAAAAGAGGAGACGGG - Intergenic
1036306236 8:7604258-7604280 GAGCATTAAAAAGAGGAGACGGG + Intergenic
1036312416 8:7693819-7693841 GAGCATTAAAAAGAGGAGACGGG - Intergenic
1036357081 8:8052243-8052265 GAGCATTAAAAAGAGGAGACGGG + Intergenic
1036570941 8:9979450-9979472 GAGAATAGAACAGAGGAGGCTGG - Intergenic
1036683318 8:10891909-10891931 GAGAGCTGAACAAGGCAGACAGG + Intergenic
1036901489 8:12673015-12673037 GAGCATTAAAAAGAGGAGACGGG - Intergenic
1037227076 8:16605256-16605278 TTGAACTGAAAAGAGTAGACAGG - Intergenic
1037964769 8:23125679-23125701 AAGAAATGAACAGCTGAGACTGG + Intergenic
1038996932 8:32933812-32933834 GAGAAATGAACAGAAGATATAGG + Intergenic
1039710855 8:40054741-40054763 GAGAGGTGAAAAGAGGACACAGG + Intergenic
1040611061 8:48982732-48982754 GAGCACACAACAGAGGAGCCTGG + Intergenic
1040758849 8:50813250-50813272 GAGCACTGCACAGAGGAACCTGG + Intergenic
1042216931 8:66436964-66436986 CAGAACTGAACTGAGCAGGCTGG + Intronic
1045593100 8:103621249-103621271 GTACACTGAACAAAGGAGACAGG + Intronic
1046126720 8:109919446-109919468 TAGAACAGGACAGAGGAGACAGG + Intergenic
1046607230 8:116384850-116384872 GACAAAAGAACAGAGGAGGCTGG + Intergenic
1048009083 8:130442585-130442607 GATAACCTAACAGAGTAGACAGG + Intronic
1048173934 8:132134515-132134537 GAGAAGTGAGGAGAGGAGAGGGG + Intronic
1048173941 8:132134545-132134567 GAGAAGTGAGGAGAGGAGAGGGG + Intronic
1048425176 8:134316800-134316822 GAGAGCTGAAACAAGGAGACAGG - Intergenic
1048872456 8:138810734-138810756 GAGAACAGAGGAGAGGAGAGAGG + Intronic
1048898822 8:139018750-139018772 CAGCACAGAACAGAGGAGGCAGG - Intergenic
1049073366 8:140374261-140374283 GAGGACTGTAAAGAGGAGGCAGG + Intronic
1049310685 8:141932095-141932117 GAGAACAGACCAGAGCTGACCGG - Intergenic
1051304688 9:15697012-15697034 CAAAACAGAACAGAGGAGAATGG - Intronic
1051796078 9:20871941-20871963 AAGAAGTGATCAGAGGAGAAAGG + Intronic
1053789853 9:41679370-41679392 GAGAAGGGAAGAGAGGAGTCTGG + Intergenic
1054155285 9:61635386-61635408 GAGAAGGGAAGAGAGGAGTCTGG - Intergenic
1054178194 9:61891060-61891082 GAGAAGGGAAGAGAGGAGTCTGG + Intergenic
1054475074 9:65566494-65566516 GAGAAGGGAAGAGAGGAGTCTGG - Intergenic
1054659335 9:67689764-67689786 GAGAAGGGAAGAGAGGAGTCTGG - Intergenic
1055377836 9:75669411-75669433 GAGAACTGAGCAGAGGCTCCAGG + Intergenic
1055744106 9:79423879-79423901 TGGAACAGAACAGAGGACACAGG + Intergenic
1056751042 9:89351470-89351492 GAGAACTGATAAGAGCAGAGTGG + Intronic
1056920307 9:90781915-90781937 GTACACTGAACAAAGGAGACAGG + Intergenic
1057030807 9:91773811-91773833 GAGATCTGAAGAGTGGACACTGG - Intronic
1058900413 9:109437686-109437708 ATGAACTGAACACAGGAGACTGG + Intronic
1059494088 9:114695133-114695155 GAGAACTGAACTGAGAAGCAAGG + Intergenic
1061176584 9:129001351-129001373 GAGAGCTGGACATAGGAGAGGGG + Intronic
1061421796 9:130476767-130476789 GGGAAATGGACAGAGGAGAGGGG + Intronic
1061470099 9:130817593-130817615 GTACACTGAACAAAGGAGACAGG - Intronic
1061501480 9:131005576-131005598 GTACACTGAACAAAGGAGACAGG - Intergenic
1062173046 9:135145873-135145895 GAGAACTGAGCAGGGCAGAGTGG - Intergenic
1185586957 X:1248029-1248051 GAGAAGAGAAGAGAGGAGAGGGG + Intergenic
1186701389 X:12093832-12093854 GAGAACTAGACAGATGAGGCAGG - Intergenic
1186754005 X:12650679-12650701 TAGACCAGAAGAGAGGAGACAGG + Intronic
1187385419 X:18844190-18844212 GTACACCGAACAGAGGAGACAGG + Intergenic
1187826921 X:23340794-23340816 GATAACTCACCAGAAGAGACTGG - Intronic
1188113939 X:26221968-26221990 AGGCACTGAACAGAGTAGACAGG + Intergenic
1189516697 X:41719624-41719646 GTACACTGAACAAAGGAGACAGG + Intronic
1189569316 X:42278531-42278553 GGGAAGTGAACAGAGTAGACTGG + Intergenic
1189620667 X:42833981-42834003 GTACACTGAACAAAGGAGACAGG - Intergenic
1190007356 X:46753559-46753581 CAGAACTCATCAGATGAGACTGG - Intronic
1191846956 X:65554056-65554078 GTACACTGAACAAAGGAGACAGG - Intergenic
1192149200 X:68701526-68701548 AAGAAGTGCACAGAGCAGACAGG - Intronic
1193574423 X:83181868-83181890 GAGATATGAAGAGAGGACACAGG + Intergenic
1193853195 X:86565205-86565227 GAAAACTTCACAGAGGAGATAGG - Intronic
1194198240 X:90923021-90923043 GTACACTGAACAAAGGAGACAGG - Intergenic
1194428503 X:93770762-93770784 GTACACTGAACAAAGGAGACAGG + Intergenic
1194969237 X:100324737-100324759 GATAAGTGAAGAGGGGAGACAGG + Intronic
1194984928 X:100480079-100480101 AAGAACTCAGCAAAGGAGACTGG - Intergenic
1195396112 X:104412161-104412183 GAGCACTGAGCAGAGGTGAAAGG + Intergenic
1198423160 X:136487994-136488016 GAGAACAGAACAGAACAGAATGG - Exonic
1198549728 X:137732555-137732577 TAAAACTGAACAGAGGAGGGAGG - Intergenic
1199312129 X:146332767-146332789 GTACACTGAACAAAGGAGACAGG + Intergenic
1199332144 X:146574946-146574968 GTACACTGAACAAAGGAGACAGG + Intergenic
1200762434 Y:7052538-7052560 GTACACTGAACAAAGGAGACAGG + Intronic
1201107514 Y:10774149-10774171 AAGAATGGAACAGAGGAGAATGG - Intergenic