ID: 1082942418

View in Genome Browser
Species Human (GRCh38)
Location 11:58721757-58721779
Sequence GGGGCTTTATTTACATTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 3, 2: 35, 3: 44, 4: 300}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082942418 Original CRISPR GGGGCTTTATTTACATTATA AGG (reversed) Intronic