ID: 1082942842

View in Genome Browser
Species Human (GRCh38)
Location 11:58726406-58726428
Sequence GGTTCAAGGGGGACAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082942830_1082942842 13 Left 1082942830 11:58726370-58726392 CCTCTTGCTAGCTGTCAGGGCAG 0: 13
1: 22
2: 13
3: 31
4: 169
Right 1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG 0: 1
1: 0
2: 4
3: 39
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082942842 Original CRISPR GGTTCAAGGGGGACAGGGGG AGG Intronic
900345944 1:2210339-2210361 GGTGCTGGCGGGACAGGGGGTGG + Intronic
900466798 1:2829747-2829769 GGCTCAGGGGAGACAAGGGGAGG + Intergenic
900652314 1:3735721-3735743 GGGCCAAGGGGGACAGGCAGTGG + Exonic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
902927355 1:19704930-19704952 GGTCTAAGGAGGAAAGGGGGAGG - Intronic
905023795 1:34836346-34836368 CGTTCCTGGGGAACAGGGGGAGG + Intronic
905090951 1:35430997-35431019 GGTTCCAGGAGCACAGGAGGGGG - Intergenic
906725334 1:48040268-48040290 GGTTCAAGGAGTGCTGGGGGAGG - Intergenic
906741204 1:48187161-48187183 GGGCCAAGGGAGACAGGGGTGGG + Intergenic
907178948 1:52553190-52553212 GGTTGCCGGGGGAGAGGGGGAGG + Intronic
910313284 1:85852987-85853009 GGTTCAAGGGGTACATGTGCAGG + Intronic
910710881 1:90179041-90179063 GGTTCAGGGGGTACATGTGGAGG + Intergenic
911393971 1:97282597-97282619 GGTTCAAGGGGTACATGTGCAGG + Intronic
911583082 1:99657932-99657954 GGTTGAGGGGAGACAGGGAGAGG - Intronic
915362964 1:155296818-155296840 GGTTCAAGGGAGAATGGGGGAGG - Intronic
915595687 1:156895194-156895216 TGTTGAGGGGGGACAGAGGGTGG - Intronic
915707146 1:157855565-157855587 GGTTCAAGGGGTACATGTGCAGG - Intronic
915841061 1:159213330-159213352 GGTGCAAGGGGGTCAGGGGTGGG + Intergenic
916275752 1:162991428-162991450 GGTTCAAGAAGGAGAGTGGGGGG + Intergenic
916361145 1:163970704-163970726 GGTTCAAGGAGGGCGGGGGCGGG - Intergenic
916662716 1:166936815-166936837 GGTGAAAGGGGGAGAGGAGGAGG + Intronic
917167602 1:172129986-172130008 GAATCAAGGGTGACAGGGGCTGG + Intronic
919695505 1:200570769-200570791 GGTTCAAGGGGTACATGTGCAGG + Intronic
920413207 1:205778747-205778769 GGTTCAAGGGGTACATGTGCAGG + Intergenic
921458681 1:215403289-215403311 ACTTCAAGAGGGACATGGGGAGG - Intergenic
921603972 1:217135479-217135501 GGTTGAAGGGGCAGAGGCGGAGG + Intronic
922969162 1:229719867-229719889 GGTTGACAGGGGACAGGAGGAGG - Intergenic
923282350 1:232456075-232456097 GGTTCAAGGGGTACATGTGCAGG - Intronic
923451545 1:234122611-234122633 GGGCCATGGGGGACAAGGGGAGG - Intronic
924479287 1:244413132-244413154 GGGTCAAGGGGGGCAGCAGGTGG + Intronic
1062982488 10:1737009-1737031 GGGTGAAGGGGGGCAGGGGCCGG + Intronic
1062992920 10:1836812-1836834 GGTGCAGGTGGGAGAGGGGGCGG - Intergenic
1063872598 10:10434802-10434824 GGTTCAAGGGGTACATGTGTGGG - Intergenic
1063994480 10:11606041-11606063 GGTGCAAGAGGGAGAGGAGGAGG + Intronic
1064433276 10:15289654-15289676 GGTTTGAGGGAGACAGGGAGAGG - Intronic
1065081775 10:22136376-22136398 GGCTCACAGGGGACATGGGGAGG + Intergenic
1065488358 10:26255891-26255913 GGTGCAAGGAGGACTGGGGAGGG + Intronic
1065760113 10:28974152-28974174 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1065856959 10:29838848-29838870 GGGTGAAGGGGGAAGGGGGGAGG + Intergenic
1066213944 10:33267590-33267612 AGTGCAAGGGGGACGGGGGACGG - Intronic
1068765132 10:60755027-60755049 GGTTCAAGGGTGGAAGGAGGGGG - Intergenic
1069721667 10:70553776-70553798 GGCTCAAGGTGGGCAGGGAGAGG - Intronic
1070152727 10:73814972-73814994 GGTTGACGGGGGAGAGGGGCTGG - Intronic
1070571952 10:77646583-77646605 GGTCTAAGGGAGACAGGGGCAGG + Intergenic
1070807681 10:79279950-79279972 CGTGCAAAGGGGAGAGGGGGAGG + Intronic
1071120024 10:82266243-82266265 GGTTCAAGGGGCAGTCGGGGAGG + Intronic
1071463406 10:85919500-85919522 GGTTGATGGGGGACAGGGGGAGG - Intronic
1071866498 10:89740351-89740373 AGATTAAGGGGGACAGAGGGTGG + Intronic
1075069058 10:119308779-119308801 GGTTCCAGGGGGCCAGGAGGAGG + Intronic
1075179067 10:120194095-120194117 GGGGGATGGGGGACAGGGGGAGG - Intergenic
1075567517 10:123515406-123515428 GGCACAAGGGGGATAGAGGGGGG - Intergenic
1075778584 10:125003175-125003197 GGTTCAAGGGTGATAGGGCCAGG - Intronic
1077174051 11:1180774-1180796 GGCTCGAGGGGCTCAGGGGGCGG + Intronic
1078004751 11:7524187-7524209 GGGACAAGGGGGACAGAGAGGGG + Intronic
1079145478 11:17847350-17847372 GGGGGAAGGGGGACAGGGAGGGG + Intronic
1079281741 11:19093500-19093522 GGCTCAAAGAGAACAGGGGGTGG - Intergenic
1079458785 11:20661426-20661448 GGTTCACGGGGGGCGGGGGCGGG - Intergenic
1081422744 11:42891012-42891034 GCCTCAAGGGAGACAGGGGCAGG - Intergenic
1081690583 11:45075111-45075133 GGCTCAGGGGGGGCAGCGGGAGG + Intergenic
1082064925 11:47892299-47892321 CGTGCAAAGGGGAGAGGGGGAGG - Intergenic
1082775848 11:57243914-57243936 GGTAAAAGGGTGACAGGAGGTGG - Intergenic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1084273205 11:68039692-68039714 GGACCAAGGGGGACAGGGGTAGG + Intronic
1084491563 11:69481414-69481436 GGTTCGAGGGGGTGAGTGGGAGG - Intergenic
1085038911 11:73315558-73315580 GGTTCTGGGGGGAAAGGAGGAGG + Intronic
1085175322 11:74481662-74481684 GGTTTACAGGGGAGAGGGGGAGG + Intergenic
1085788218 11:79473475-79473497 GGTTCCAGGGGGAAAGGGAAGGG + Intergenic
1086542744 11:87932123-87932145 GATTCAAGGGGGGCAAGGGGAGG + Intergenic
1087692123 11:101332874-101332896 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1088334867 11:108692706-108692728 ACTCCAAGAGGGACAGGGGGAGG - Intronic
1088541560 11:110919001-110919023 GGATCAAGGGGAACAGGTGAAGG + Intergenic
1089069121 11:115685516-115685538 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1089836101 11:121371985-121372007 GTTTCATGGGTGACAGTGGGTGG + Intergenic
1091364164 11:135003758-135003780 TGTTCCAGTGGGACAGGGTGTGG - Intergenic
1091790008 12:3266726-3266748 GCTTCATGGGGGACACGGGATGG - Intronic
1092000422 12:5027175-5027197 AGCTCATGGGAGACAGGGGGTGG - Intergenic
1092314442 12:7395443-7395465 GGTTGGTGGGGGACTGGGGGAGG + Intronic
1092441091 12:8505038-8505060 GGTTCAAGGGGTACATGTGAAGG + Intergenic
1092470221 12:8771360-8771382 GGTGAAAGGAGGACAGGGGAAGG + Intronic
1093100611 12:15024289-15024311 GGTTCAGGGGGTACATGTGGAGG + Intergenic
1093497014 12:19769688-19769710 GGTTCAAGGGGTACATGTGCTGG - Intergenic
1094411072 12:30169615-30169637 GGTTCAAGAGGGACAGGTTGGGG - Intergenic
1095276391 12:40288414-40288436 GGGTCAGGGGGGCCAGGGGAAGG - Intronic
1095688362 12:45061028-45061050 GGTAAAAGGAGGAGAGGGGGAGG + Intergenic
1098399769 12:70062050-70062072 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1098902729 12:76129773-76129795 GGTTCAAGGGGTACATGTGCGGG + Intergenic
1100210655 12:92395224-92395246 TGTTCAATAGGGACAGAGGGAGG - Intergenic
1100709076 12:97234850-97234872 GGAGGAAGGGGGAGAGGGGGAGG + Intergenic
1101372473 12:104141851-104141873 GGAGCAAGAGGGAGAGGGGGAGG - Intergenic
1101609772 12:106279807-106279829 AATTCTAGGGGGACAGGGGTGGG - Intronic
1102116287 12:110405575-110405597 GCTTCAAGTGGGATTGGGGGTGG + Intergenic
1102232902 12:111275827-111275849 GGTTCAAAGGGGAGAGCTGGTGG - Intronic
1103823763 12:123719691-123719713 TGTTAAAGGGGCTCAGGGGGAGG - Intronic
1103959368 12:124599033-124599055 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1104345289 12:127991210-127991232 AGTTTAAGGGGCAGAGGGGGAGG + Intergenic
1104576920 12:129974384-129974406 GGGTCAAAGGAGACAGGGTGAGG + Intergenic
1104781282 12:131422108-131422130 GGCTCAGAGGGGACAGGTGGAGG - Intergenic
1104978780 12:132563711-132563733 GGTTCAGGGGCGACGGGGGTGGG - Intronic
1105307628 13:19180304-19180326 GCTTCAAGGGGTAGAGGGGAGGG - Intronic
1105523735 13:21155045-21155067 GTTTAAAGGGGGACAGAGGCAGG + Exonic
1105607442 13:21938050-21938072 GGTACAAGGGGGTCTGAGGGTGG + Intergenic
1105974889 13:25464726-25464748 GGTTCAAGGGAGACAGAGAAGGG + Intronic
1106533433 13:30617294-30617316 GGCTCTAGGGAGACAGGGAGGGG + Intronic
1106792128 13:33166499-33166521 GGTGCAGGCAGGACAGGGGGTGG - Intronic
1106799366 13:33241550-33241572 CGTGCAAAGGGGAGAGGGGGAGG - Intronic
1107604364 13:42042995-42043017 GGAGCAAGGGGAAAAGGGGGTGG + Intronic
1107864787 13:44693226-44693248 GGGACAAGGGGGACAGAGGAGGG - Intergenic
1108979837 13:56496974-56496996 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1110430447 13:75417151-75417173 GGCTCTTGGGGGACAGGGTGTGG - Intronic
1110579654 13:77106766-77106788 GGTTCAAGGGGGACATGTGTAGG + Intronic
1111202877 13:84962241-84962263 GGGTCCAGGGGGACTGAGGGAGG - Intergenic
1112639790 13:101260009-101260031 GGTACTGGGGGGACGGGGGGAGG - Intronic
1114406294 14:22459463-22459485 GGTGCAAGGGAGACAGTGGGAGG + Intergenic
1114410632 14:22497284-22497306 GGTTCAAGGGTGAAGGTGGGGGG - Intergenic
1115284707 14:31704212-31704234 GGTCCAAGGGAGACAGGGGCAGG + Intronic
1116024735 14:39501462-39501484 GGTTCAAGGGGTGCAGGTGCAGG + Intergenic
1118442911 14:65828153-65828175 AGTTCAAGGTGGTCAAGGGGCGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118869292 14:69727834-69727856 GGTTGAAGGGGGACAGAGATCGG - Intronic
1119352451 14:73977256-73977278 CGTTCCAGGGGGAGAGGGGCAGG - Intronic
1119410452 14:74426724-74426746 GGGGGAAGGGGGACAGGGGGAGG - Intergenic
1119432292 14:74576127-74576149 GGGCCAAGGGGCACAGGGTGAGG + Intronic
1119842603 14:77804584-77804606 GGTTCAGGGGAGGCAGGGGCTGG + Intronic
1120044402 14:79790296-79790318 GGAGCAAGGGAGACAGGAGGAGG + Intronic
1121760364 14:96439803-96439825 GGTTCAAGAGGAACAGCTGGAGG + Intronic
1121956400 14:98217515-98217537 GGTTTCAGGGGGAAAGGGAGAGG - Intergenic
1122464125 14:101918623-101918645 GGGTCAGGGGGGAGAGGGGGAGG - Intronic
1122647639 14:103205988-103206010 GACTCCAGGGGGACAGGGAGGGG + Intergenic
1122840743 14:104461561-104461583 GGTGGACGGGGGACATGGGGGGG + Intergenic
1122909314 14:104819345-104819367 GCTTCAGGGGTGACAGGGGTGGG - Intergenic
1123065685 14:105618152-105618174 GGTCCCAGGTGGAAAGGGGGCGG + Intergenic
1123074521 14:105661375-105661397 GGTTCCAGGTGGAAAGGGGGAGG + Intergenic
1123090427 14:105739799-105739821 GGACAAAGGGGGACAGGGTGGGG + Intergenic
1123094869 14:105762342-105762364 GGTCCCAGGTGGAAAGGGGGCGG + Intergenic
1123780580 15:23623024-23623046 GGTTCAAGGGGTACATGTGCAGG + Intronic
1124436257 15:29651893-29651915 GGTTCCTGGGTGGCAGGGGGTGG + Intergenic
1124640521 15:31393424-31393446 GGTCTGAGGGGGACGGGGGGGGG - Intronic
1124943187 15:34237352-34237374 GATTCAAGGAAGACAGGGAGAGG + Intronic
1125341834 15:38683077-38683099 GGTCCCAGGAGGATAGGGGGTGG + Intergenic
1129671681 15:77611133-77611155 GGAGCACGAGGGACAGGGGGAGG - Intergenic
1129743335 15:78000897-78000919 GGCTCTAGGGGGAGAGGTGGTGG - Intronic
1129763139 15:78143497-78143519 GCTTCAAGGGAGACAGTGGTGGG + Intronic
1132016392 15:98321007-98321029 TGTTAACGGGGGACAGGAGGTGG - Intergenic
1132694296 16:1195137-1195159 GGTTCAAGGCGGAGTGGGGCGGG + Intronic
1132879087 16:2153402-2153424 GGTTCAAGGGCGGCAGCAGGAGG - Exonic
1133220802 16:4318350-4318372 GGTGGAGGGGGGTCAGGGGGAGG + Intronic
1133324800 16:4936320-4936342 GGGTCGAGGGGCACAGGGGGAGG - Intronic
1133383164 16:5347902-5347924 GGTTGATGGGGGGGAGGGGGTGG - Intergenic
1134341778 16:13353127-13353149 GCTTCAAGCGGGATTGGGGGCGG + Intergenic
1136005701 16:27327308-27327330 GGTGGCAGGGGGGCAGGGGGCGG - Intronic
1136069576 16:27779651-27779673 GGCTGAAGGGGGAGAAGGGGTGG - Exonic
1136072749 16:27798150-27798172 GGTTCAGGGGGTACAGGTGCAGG - Intronic
1136556244 16:31009591-31009613 GGTTTTGGGGGGACAGGGGAAGG - Intronic
1137357668 16:47782247-47782269 GGTTCAAGGGGTACAAGTGCAGG + Intergenic
1137724212 16:50646120-50646142 GGGGGAAGGGGGCCAGGGGGCGG + Intergenic
1138216069 16:55206613-55206635 GGGTCAGGAGTGACAGGGGGTGG + Intergenic
1138262420 16:55634657-55634679 GGTCCAAGAGAGACAGGGGCAGG - Intergenic
1138356855 16:56388794-56388816 CGTTCCAGTGGGACAGGAGGTGG - Intronic
1138729621 16:59180848-59180870 GGTTCAAGGGGTACATGTGTGGG + Intergenic
1139287655 16:65829988-65830010 GGTTCAAGGGGGGCCAGTGGTGG + Intergenic
1139305033 16:65977940-65977962 GGTTCAAGGGTTACACGGGCAGG - Intergenic
1140451688 16:75075860-75075882 GGTTCAAGAGGAACTGGGAGAGG + Intronic
1140536125 16:75711632-75711654 GGTCTAAGGGAGACAGGGGCAGG - Intronic
1140626644 16:76802792-76802814 GGTTGAAGAGGGAAAGGGTGAGG - Intergenic
1141667740 16:85474601-85474623 AGAGCAAGGGGGACTGGGGGAGG - Intergenic
1141937817 16:87253555-87253577 GGGTGAAAGGGAACAGGGGGAGG + Intronic
1142147136 16:88497404-88497426 GGTTCAGAGGGGTCAGGGTGGGG + Intronic
1142147155 16:88497449-88497471 GGTTCAGAGGGGTCAGGGTGGGG + Intronic
1142147175 16:88497494-88497516 GGTTCAGAGGGGTCAGGGTGGGG + Intronic
1142147195 16:88497539-88497561 GGTTCAGCGGGGTCAGGGCGGGG + Intronic
1142373558 16:89695831-89695853 GGTTCAGGGCAGACAGTGGGAGG - Exonic
1143682924 17:8491107-8491129 GGGTCAAAGGGCACAGGAGGTGG - Intronic
1144425597 17:15138407-15138429 GATCCAATGTGGACAGGGGGTGG - Intergenic
1145981183 17:29012670-29012692 AGTTCAAGGAGGAGTGGGGGAGG - Intronic
1146547313 17:33750167-33750189 GGTTCAAGGAGGTCAGGTGAGGG + Intronic
1146821240 17:35984929-35984951 GGTTCAATGGGGACATGGGCAGG - Intronic
1149867646 17:60159582-60159604 GGGTGGAGGGGGACAGGGTGGGG - Intronic
1150124462 17:62627570-62627592 GGTTCGAGGGGTAGAGGGGAAGG - Exonic
1150282099 17:63934672-63934694 GGGACAAGGGGCTCAGGGGGTGG + Intergenic
1151381235 17:73727143-73727165 GGTTCACAGGGGACATGGGGAGG + Intergenic
1152039732 17:77894948-77894970 AGTTTAGGGGGGACAGGGGCAGG - Intergenic
1152110537 17:78355336-78355358 GGTGCAAGGGGGCCAGGAAGAGG + Intergenic
1152335735 17:79699510-79699532 GGGTCCAGGGTGACAGTGGGTGG - Intergenic
1152477147 17:80525894-80525916 GGTACAAGTGGGGCAGGGTGGGG - Intergenic
1152984554 18:309930-309952 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1153342621 18:3991008-3991030 GGTTCAAGGGGTACATGAGCAGG + Intronic
1154194440 18:12255021-12255043 GGAGCAGGGGGGACAAGGGGCGG + Intronic
1156360274 18:36378564-36378586 GGTCCAGGGGGGACAGGGGTTGG - Intronic
1156483277 18:37449326-37449348 GGATCATGGGGGACAGGGAAAGG + Intronic
1157331206 18:46705096-46705118 GGATCAAGTGGGAAAGGGGCAGG - Intronic
1157818422 18:50748187-50748209 GCTGAAAGGGGGACATGGGGTGG - Intergenic
1157880023 18:51312770-51312792 AGTTCAAGGGGGAGAGTGTGGGG - Intergenic
1157893118 18:51437757-51437779 AGTTCCAGGGAGACAGGGGAAGG + Intergenic
1159351136 18:67274179-67274201 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1159539911 18:69761660-69761682 AGTCCAAGGGAGACAGGGGCAGG + Intronic
1161040968 19:2110593-2110615 GGGACAAAGGGGACATGGGGAGG + Intronic
1161264941 19:3359762-3359784 AGATCTGGGGGGACAGGGGGCGG + Intronic
1161285994 19:3468538-3468560 GGCTCCAGGGGGACAGGATGGGG + Intronic
1161664215 19:5565147-5565169 GGAGCAAGGGGGAGAGAGGGAGG - Intergenic
1161854274 19:6754479-6754501 GGGTGAGGGGGGACAGGAGGTGG + Intronic
1161943217 19:7418778-7418800 GATTCAAGGGGGAGAGAGGGAGG + Intronic
1162311979 19:9913378-9913400 GGGTAGAGGGGGACAGGTGGGGG + Intronic
1162332552 19:10039112-10039134 GGTTCTGTGGGGATAGGGGGTGG - Intergenic
1162337581 19:10071257-10071279 AGTTGAAGGGGGACTGGGCGTGG + Intergenic
1162373013 19:10290142-10290164 GGTTCGGGGTGGACAGGGCGGGG + Intronic
1162561058 19:11418511-11418533 GGTAGAAAGGGGACTGGGGGCGG - Intronic
1162744757 19:12792129-12792151 GGTGCAGGGGGCGCAGGGGGCGG + Exonic
1163100408 19:15092381-15092403 GGTTTAAGGAGGATAGGGGGTGG + Intergenic
1163154797 19:15433802-15433824 GGTTCAGAGAGGACAGGGGCTGG - Intronic
1163369535 19:16894191-16894213 GGTGCAGGGGGGACAGCTGGAGG - Intronic
1163458101 19:17420510-17420532 GGTGGAAGGGGGACACGGCGAGG - Intronic
1164454033 19:28392173-28392195 AAGTCAAGGGGAACAGGGGGTGG + Intergenic
1164504165 19:28845200-28845222 GGTTGAAGAGGGGAAGGGGGTGG - Intergenic
1164822065 19:31257972-31257994 AGTGCAAGGGAGACAGGGAGGGG + Intergenic
1164898479 19:31897898-31897920 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1165572489 19:36787046-36787068 TGTTCAAAAGGGACAGGGAGTGG + Intergenic
1165780866 19:38433628-38433650 GGTCCAATGGGGCCCGGGGGCGG + Intergenic
1165873485 19:38989516-38989538 GGCTGGAGGGGGACAGAGGGAGG + Intergenic
1166068986 19:40376914-40376936 GGGTCATGGGGCACAGGGAGAGG + Intronic
1166819478 19:45568705-45568727 GGTTCAAGGGATTCAGGAGGAGG + Intronic
1166861764 19:45815534-45815556 GGCTCGAGGGGGAAAGGGGGTGG - Exonic
1167509296 19:49887853-49887875 AGCTCAGGGGGGACAGGGCGGGG - Intronic
1167648670 19:50718665-50718687 GGCTGTGGGGGGACAGGGGGCGG + Intronic
1168097653 19:54124679-54124701 GGCTCCAGGGGGGCCGGGGGAGG - Intronic
1168273328 19:55262289-55262311 GGTGCATGGGGGACGGGAGGAGG - Exonic
1168282343 19:55312235-55312257 GGTTCTAGGGGAACAGGGGGCGG + Exonic
1168317821 19:55491678-55491700 GGTCCAAGGGGTACAGGAGAGGG - Intronic
926072040 2:9904139-9904161 GGTTCAAGGGGCACATGGGCAGG + Intronic
926531291 2:14049535-14049557 GGTTCAAGGGGTACATGAGCAGG + Intergenic
927291391 2:21408318-21408340 GGGTCAAAGGGGACGGGGAGAGG + Intergenic
927572020 2:24168165-24168187 AGTTCAGGGGAGACTGGGGGTGG + Intronic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
930021177 2:47003120-47003142 GGTCTAGGGTGGACAGGGGGAGG + Intronic
931948680 2:67337018-67337040 GCTTCAAGCGGGACTAGGGGCGG - Intergenic
933978064 2:87527891-87527913 GGTGCTAGGGGGCCAGGGTGGGG - Intergenic
934158954 2:89230154-89230176 GGTGCCAGGGAGACAGGCGGTGG + Intergenic
934208321 2:89952274-89952296 GGTGCCAGGGAGACAGGCGGTGG - Intergenic
934636588 2:95994771-95994793 TGTTCAAGGAAGACAGAGGGAGG - Intergenic
934636902 2:95997985-95998007 GGTTCAAGGGGTACATGCGAAGG + Intergenic
937096191 2:119236755-119236777 TGTTCCAGGGGGAGTGGGGGAGG - Intronic
937643818 2:124243783-124243805 GGTTCAAGGGGTACATGGGCAGG - Intronic
937875607 2:126823205-126823227 GGGTCCAGGGGGCCAGGAGGAGG - Intergenic
939529290 2:143337060-143337082 TGGTCAAGGAGGACAGAGGGAGG + Intronic
939591628 2:144071283-144071305 GTTTCGAGGGGGATAGGGGTTGG + Intronic
940858771 2:158751088-158751110 GGTGGAAGGGACACAGGGGGAGG + Intergenic
941225336 2:162840077-162840099 GGTTCAAGGGGGTGGGTGGGGGG - Intergenic
941310765 2:163928008-163928030 GGTTCAGGGGGTACACGGGCAGG - Intergenic
941845868 2:170131912-170131934 GGGTTTAGGGGGACAGGGGAGGG + Intergenic
944090826 2:195909211-195909233 GGTTCCAGGGGTACAGGTGCAGG - Intronic
944940271 2:204617580-204617602 GGTTCAAGGGGTACATGTGCAGG + Intronic
946029973 2:216695792-216695814 GGGGCAAGGGGGACAGGCTGGGG + Intergenic
946362517 2:219228030-219228052 TGGTCAAGGTGGACAGGGGGCGG - Exonic
946399668 2:219461699-219461721 GGTTCCAGGGGCTCAGGGAGGGG + Intronic
947702627 2:232247520-232247542 GGTTAAATGAGGACACGGGGTGG - Intronic
947777492 2:232725382-232725404 GGATAAAGGGGGACAGGGGGAGG - Intronic
947952068 2:234156753-234156775 GGCAGAAGGGGGACAGGGAGTGG - Intergenic
948920596 2:241064286-241064308 GGACCAAGGGAGACAGGCGGAGG - Intronic
1170968755 20:21100237-21100259 GGTGGGAGGGGTACAGGGGGCGG + Intergenic
1172107866 20:32527518-32527540 GGTTGAAGGGGGTGAGAGGGAGG - Intronic
1172146805 20:32762891-32762913 GGTGGAACGGGGACAGCGGGTGG + Intronic
1172162685 20:32879404-32879426 GGTTCAGTGGGCACAGCGGGTGG - Intronic
1172274639 20:33673060-33673082 CGTCCAAGGGGGAGTGGGGGTGG + Intronic
1172768023 20:37361426-37361448 GCTTGAACGGGGCCAGGGGGTGG + Intronic
1172786283 20:37470827-37470849 GGGGCATGGGGGACATGGGGCGG + Intergenic
1172902728 20:38346697-38346719 GGTACAGTGGGGACAGGGAGTGG + Intronic
1174281041 20:49439540-49439562 GGTTGACAGGGGACAGGGGCGGG - Intronic
1174396568 20:50250514-50250536 GGAAGAAGGGGGACAGAGGGCGG - Intergenic
1174488332 20:50874962-50874984 TGGTCAAGGAGGACAGAGGGAGG - Intronic
1175139347 20:56848471-56848493 GCCTCAAGGGGGACAGGAGCTGG + Intergenic
1175373422 20:58508355-58508377 GGATCAAGGAGCACAGGGAGGGG + Intronic
1175732793 20:61365466-61365488 GGAGCAAAGGGGACAGGAGGCGG + Intronic
1176258186 20:64164645-64164667 GGTGCAGGGTGGACTGGGGGAGG - Exonic
1177489864 21:21808729-21808751 GGATTAAGGGGGACCGGGTGCGG + Intergenic
1177576398 21:22962197-22962219 GGATAAAGGGGGATAGGTGGAGG - Intergenic
1178486976 21:33025615-33025637 GGCTCAAGGGGGATGGAGGGAGG - Intergenic
1180557833 22:16592016-16592038 GGTCCATGGGGGACAGGGTGTGG + Exonic
1180980995 22:19877911-19877933 GGTTTTAGGGGGACAAGAGGCGG - Intronic
1181886977 22:26029283-26029305 GGGTCAAGGAGGCCTGGGGGTGG - Intronic
1182098363 22:27640937-27640959 GGTTAATAGGGGGCAGGGGGAGG - Intergenic
1182377092 22:29856586-29856608 GGTACAAGGGGAACAGGAGTAGG - Intergenic
1182848118 22:33448076-33448098 GGTCAATGGGGGACAGGGAGAGG + Intronic
1184247174 22:43241640-43241662 GGTCCCAGGGGGAGAGGAGGGGG - Intronic
1184955812 22:47885318-47885340 TGTTCCAGGTGGGCAGGGGGCGG - Intergenic
1184962558 22:47942008-47942030 GGTTTAAGGGGGCTTGGGGGAGG + Intergenic
1184968568 22:47998867-47998889 GGCTGATGGGGGACAGGGGCTGG - Intergenic
1185078925 22:48698682-48698704 GGTGCCTGGGGGTCAGGGGGAGG + Intronic
1185138245 22:49086017-49086039 GGTTCGAGGGAGACAGGGTCTGG + Intergenic
1185161220 22:49230925-49230947 GGTACAAGGGGGGCCGGGCGCGG - Intergenic
950125330 3:10506732-10506754 GGTGCATGGGGGACAGGGGCAGG + Intronic
950465358 3:13150004-13150026 GGTTCTAGAGGGAGAGTGGGAGG + Intergenic
950794043 3:15496221-15496243 GGGTCAAGGGGGAAAGGGTGAGG - Intronic
951766831 3:26208977-26208999 GGTTCAAGGGGTACATGTGCAGG + Intergenic
952277792 3:31894292-31894314 GGAACAAGGAGGACAAGGGGAGG + Intronic
952360745 3:32627828-32627850 CGTCCAAGGAGGTCAGGGGGTGG + Intergenic
952828803 3:37545878-37545900 GGTTCCAGGAGGAAAGGGGCAGG - Intronic
953695909 3:45159012-45159034 GGTTCAAGGGGTACATGTGCAGG + Intergenic
953749797 3:45600530-45600552 GAGGCAACGGGGACAGGGGGTGG - Intronic
954431195 3:50471658-50471680 GGGTGGAAGGGGACAGGGGGAGG + Intronic
954579795 3:51697043-51697065 GGATCAAGGGAGACAGAGGATGG - Intronic
955272086 3:57510726-57510748 GATTCAGTGGGGACGGGGGGAGG + Intronic
955351506 3:58196759-58196781 CCTTCAATGGGGACAGAGGGGGG - Intronic
956084687 3:65597266-65597288 GGCTGAATGGGGACTGGGGGTGG - Intronic
956597975 3:70989172-70989194 GGAAGAAGGGGGACAGGGGTCGG + Intronic
958605471 3:96352877-96352899 GGTTCATGAGGGAGTGGGGGGGG + Intergenic
960709249 3:120511122-120511144 GGTCCAAGGGAGAGAGGGGCAGG - Intergenic
961697250 3:128713966-128713988 GGACCAAGAGGGACAGGGAGGGG + Intergenic
962316956 3:134364964-134364986 AGTTCAAGAGGTACATGGGGTGG - Intronic
962955263 3:140260091-140260113 GGTTCAAGGGGTACATGGGCAGG - Intronic
963458162 3:145573471-145573493 GGTCCAAGGGAGACAGGGGCAGG + Intergenic
963952140 3:151214542-151214564 GGGTAAAGGGGGAAAGAGGGAGG - Intronic
964038062 3:152222897-152222919 GGTTCAAGGGGTACATGTGCAGG + Intergenic
965291465 3:166887242-166887264 GGTTCAAGTTTGACAAGGGGTGG - Intergenic
965714496 3:171588076-171588098 GGTGTGAGGAGGACAGGGGGAGG - Intergenic
966362173 3:179141988-179142010 GGTTCAAGGGGTACATGTGCAGG - Intergenic
966837785 3:184062335-184062357 GGTTCAAGGGGTACATGTGCAGG + Intergenic
967744647 3:193041814-193041836 GGTTCAAGGGTGACAGAGAAGGG - Intergenic
967858638 3:194135684-194135706 GGTTAAAAGGGGGCGGGGGGAGG - Intergenic
968003632 3:195224715-195224737 AGTTCTAGGGAGCCAGGGGGAGG - Intronic
969384925 4:6837900-6837922 CGTGCAAAGGGGAGAGGGGGAGG + Intronic
970379747 4:15494934-15494956 GGTTCAAGGGGTACATGTGCAGG + Intronic
971566895 4:28156122-28156144 GGTTCAAGGGGTACATGTGTAGG + Intergenic
971742531 4:30539069-30539091 AGATCAAGGGGGACATGAGGAGG - Intergenic
972987033 4:44777556-44777578 GGTCCAAGGGAGAGAGGGGCAGG - Intergenic
972992046 4:44832404-44832426 GGTTGGTGGGGGACAAGGGGAGG + Intergenic
973958646 4:56088169-56088191 GGTTCAAGGGGTACATGTGCAGG + Intergenic
977956749 4:103036485-103036507 GGTTCAAGGGGTACATGTGCAGG - Intronic
978686752 4:111454685-111454707 GCTCCAAGGGGGACAGGTTGGGG - Intergenic
979754975 4:124328916-124328938 GGCTGAAGGTGGAGAGGGGGTGG + Intergenic
979941602 4:126770593-126770615 CGTGCAAAGGGGAGAGGGGGAGG - Intergenic
980024434 4:127748413-127748435 GGTCCATGGGTGACAGGGGCTGG - Intronic
980419917 4:132546338-132546360 GGTCCAAGGGAGATAGGGGCAGG - Intergenic
982069431 4:151682684-151682706 GGTTCACGGGGGGTCGGGGGTGG - Intronic
982738547 4:159033284-159033306 GGAGCTAGGGGGAAAGGGGGAGG + Intronic
982977354 4:162081309-162081331 CGTTCAAGGGGCACTAGGGGAGG + Intronic
984705491 4:182844623-182844645 GGTCCAACGGGGACGGTGGGGGG - Intergenic
985284305 4:188319401-188319423 GGGGCATGGGGGACAAGGGGAGG + Intergenic
985760837 5:1747738-1747760 GGTTGTAGCGGGGCAGGGGGCGG - Intergenic
986715530 5:10521160-10521182 GGGGCAGGGGGGCCAGGGGGTGG - Intronic
988058463 5:26133545-26133567 GGGGCATGGGGGACAAGGGGAGG - Intergenic
988182579 5:27816487-27816509 GGTTCAGGGGGGGAAGGGGGCGG - Intergenic
989143775 5:38228169-38228191 AGTGCAGGGGGGACAGTGGGGGG + Intergenic
989506193 5:42229831-42229853 GGTTCAAGGGAGTCAGGGGCAGG + Intergenic
989607266 5:43256570-43256592 GGCCCAAGGGGGAATGGGGGAGG - Intronic
991083059 5:62621568-62621590 GGTTTAAGGGGGAAGGGGAGTGG + Intronic
991274755 5:64831689-64831711 GGTTCAAGGGGTACATGAGCAGG - Intronic
991315773 5:65304442-65304464 GGTGCAAGGGGGCCAGGGTCTGG + Intronic
991419381 5:66425980-66426002 GGCTTAAGGGGGACAGAGGCTGG + Intergenic
992049426 5:72929277-72929299 GGTTCAGAGAGGACAGAGGGTGG + Intergenic
993753354 5:91697785-91697807 GGTTATAGGGGAACAGGTGGTGG - Intergenic
994464823 5:100112938-100112960 GGTTCAGGGGGTACAGGTGCAGG - Intergenic
994765112 5:103905645-103905667 GGTTCAAGGGGTACATGTGCAGG - Intergenic
996190848 5:120539636-120539658 GGTTCAAGGGGCACATGTGCAGG - Intronic
999153407 5:149441647-149441669 GGTTGAAGGTGGACTCGGGGAGG + Intergenic
999581752 5:153046243-153046265 GGTGGAAGGGGGAGAGGGAGAGG - Intergenic
1001045236 5:168366108-168366130 AGTTCCTGGGGGACGGGGGGTGG + Intronic
1001831759 5:174794892-174794914 GGGGCAGGGGGGACGGGGGGGGG - Intergenic
1003038747 6:2668136-2668158 GGTTCAAGGGGTACATGTGCAGG + Intronic
1003815715 6:9837883-9837905 GGTTCAGGGGTAACATGGGGAGG - Intronic
1005021302 6:21421855-21421877 GGTTGTAGGGGGATAGGGGAGGG - Intergenic
1005803666 6:29452302-29452324 GTTTCAAGGGGCACAGGTGCAGG - Intronic
1005909664 6:30297404-30297426 GGTTCAAGGGGTACATGTGTAGG + Intergenic
1007093406 6:39198801-39198823 AGTCCAAGGGGGAGATGGGGTGG + Intronic
1008551561 6:52637515-52637537 GTTTCAAGTGGGGCAGGGAGTGG + Intergenic
1009389330 6:63126653-63126675 GGTTCAGGGGGGACAGAGGTGGG + Intergenic
1009899791 6:69796981-69797003 GGTTAAAGGGGCGGAGGGGGAGG + Exonic
1010477293 6:76303757-76303779 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1011341234 6:86316883-86316905 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1011797783 6:90976306-90976328 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1012236253 6:96819517-96819539 GGGTGCAGGGGGACAGGGGAGGG + Intronic
1013040929 6:106432704-106432726 GGGTTAAGGAGGACAGGCGGAGG - Intergenic
1013109169 6:107051410-107051432 GGATCAAGGTGGGCAGGGGGTGG - Intergenic
1013490828 6:110644784-110644806 AGGTGAAGGGGGCCAGGGGGAGG + Intronic
1014529845 6:122545762-122545784 GGTTCAAGGGATACAGGTGCAGG - Intronic
1016200308 6:141398690-141398712 GGTTCAAGAGGCACAGTGTGTGG + Intergenic
1017106187 6:150890399-150890421 GGTTCAAGGGAGACAGGGGCAGG + Intronic
1017929843 6:158942230-158942252 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1018710688 6:166496477-166496499 GTTTCTGGGGGGACAGGGGGAGG - Intronic
1019491914 7:1318208-1318230 GGGTCCTGGGGGTCAGGGGGAGG - Intergenic
1019595081 7:1854691-1854713 GGTTCTGTGGGGACAGGGGCAGG - Intronic
1020230959 7:6318095-6318117 GGCTCTAGAGGGAGAGGGGGCGG + Intergenic
1020322350 7:6948715-6948737 GCTTCAAGGGGGATTAGGGGTGG + Intergenic
1021512705 7:21451610-21451632 GGTCCAAGGGAGACAGGGGCAGG + Intronic
1021750251 7:23791590-23791612 GGTTCAAGGGGTACATGTGCAGG - Intronic
1021998016 7:26200153-26200175 GGTTCCCGGGAGAGAGGGGGAGG + Intronic
1022353569 7:29588894-29588916 GGTGCATGGGGGGCTGGGGGAGG - Intergenic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1024881815 7:54095371-54095393 GGTAAAAGGGGAACAGAGGGAGG + Intergenic
1026487567 7:70834701-70834723 GGTTACCAGGGGACAGGGGGAGG - Intergenic
1027229166 7:76262117-76262139 TGTTCAGGGTGGACTGGGGGAGG + Intronic
1027887193 7:83923928-83923950 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1028571340 7:92290884-92290906 GGTTGAAGGGGAACTGGGGATGG + Intronic
1028833758 7:95351818-95351840 GGTCCAAGGGAGACAGGGGCAGG - Intergenic
1029444164 7:100603609-100603631 GGTGCGGGGGGGACGGGGGGGGG - Intronic
1029611960 7:101631189-101631211 GGGGAAAGGGGGACAGGGGAAGG - Intergenic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1030099202 7:105930214-105930236 GGTCCAAGGAGGAGATGGGGTGG - Intronic
1030511384 7:110486555-110486577 GGATGACGGGGGGCAGGGGGTGG + Intergenic
1030688278 7:112508227-112508249 GGGGCAGGGGAGACAGGGGGAGG + Intergenic
1030837896 7:114311438-114311460 GGTCCAAGAGAGACAGGGGCAGG + Intronic
1032371377 7:131356612-131356634 GGCCCAAGGGAGACAGGGGCAGG + Intronic
1032386505 7:131529317-131529339 GGGGCCAGGGGGACAGTGGGAGG + Intronic
1033217188 7:139501625-139501647 GATTCAAGGGGTACAGGTGCAGG - Intergenic
1033444086 7:141405122-141405144 GGTTCAAGTAGGAGAGGGGAGGG - Intronic
1034282145 7:149861907-149861929 GGTTCCAGGCGGATAGGGAGAGG + Exonic
1034619481 7:152445989-152446011 GGTTCATGGGGGGCAGGGTGTGG - Intergenic
1034879237 7:154750839-154750861 GGTTCAAGAGGCACAGTGGGAGG + Intronic
1037787866 8:21913054-21913076 GGTTCAAGGAGGCCAGGGAAGGG + Intronic
1037816725 8:22116472-22116494 GGGACCAGGGGGACAGGGAGAGG - Intronic
1040434953 8:47381177-47381199 GGTACAATGGGTACAGAGGGAGG - Intronic
1040542938 8:48376150-48376172 GAATCATGGGGTACAGGGGGAGG - Intergenic
1040907980 8:52488297-52488319 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1041543574 8:59014032-59014054 GGGGTAAGGGGGACAGGGAGAGG + Intronic
1044363019 8:91310369-91310391 AGTCCAAGGGGGACAGGGACAGG + Intronic
1044806996 8:96018460-96018482 GGATCAAGGGGTACATGGTGTGG + Intergenic
1044848078 8:96401231-96401253 GGTTCACAGGGGTTAGGGGGAGG + Intergenic
1045171044 8:99668667-99668689 GGTACAAGGGGAAAAGGTGGGGG - Intronic
1046229017 8:111328661-111328683 GATTCAAGAGGTACAGGGGCAGG + Intergenic
1046577209 8:116045478-116045500 GGTGGAAGGGGGACAAGGGCTGG - Intergenic
1046827083 8:118703267-118703289 GGTTCAAGGTGGACGGGCAGAGG - Intergenic
1047363848 8:124194487-124194509 AGGTCAAGGCGGGCAGGGGGCGG + Intergenic
1047501747 8:125446943-125446965 TGCTCAAGCGGGACTGGGGGAGG + Intergenic
1049113111 8:140661926-140661948 AGTACAATGGGGACAGGAGGAGG + Intronic
1049744223 8:144256397-144256419 TGGCCAAGGGGGGCAGGGGGAGG - Intronic
1050525614 9:6543875-6543897 GGGGCAAGGAGGACAGGAGGGGG + Intronic
1051327340 9:15987393-15987415 GGTTCAAGGGGTACATGTGCAGG - Intronic
1051889926 9:21931124-21931146 GGTCTAAGGGAGACAGGGGCAGG - Intronic
1052532157 9:29700149-29700171 GATTCAAGGGGTACAGGTGGAGG - Intergenic
1052956014 9:34253874-34253896 GGTGCTAGGGGGACAGGGGTGGG - Exonic
1052970383 9:34373741-34373763 GTCTCAAGGGGGACTGGGCGAGG - Intronic
1053263545 9:36693627-36693649 GGTAGTAGGGGGGCAGGGGGAGG + Intergenic
1055900586 9:81229651-81229673 GGTTCAAGGGGTACATGCGTAGG + Intergenic
1056298922 9:85221824-85221846 GGTTCAAGGGGCACATGTGCAGG - Intergenic
1056959519 9:91110484-91110506 GGTTCAAGGGGTACATGTGCAGG - Intergenic
1057215096 9:93223635-93223657 GGTTCCAGGAGGACAGGGTTTGG - Intronic
1057930275 9:99187039-99187061 GGTCCATGGGGGACAGGAAGAGG - Intergenic
1058318748 9:103602586-103602608 GGTTCAGGGGGTACATGGGCTGG - Intergenic
1059316599 9:113430801-113430823 GGTTCAAGGGGGTAAGAGGAGGG + Intergenic
1060306251 9:122414968-122414990 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1060901795 9:127264427-127264449 AATTAAAGGGGGACAGAGGGTGG + Intronic
1061255198 9:129451228-129451250 GTTTCCAGGGGGACCGGGGATGG + Intergenic
1061407099 9:130398500-130398522 GGTGCAGGGGGCACAGGGGCTGG - Intronic
1061766643 9:132885860-132885882 GGTTCAGGGAGGGCAGGGGAGGG - Intronic
1062133942 9:134914898-134914920 GGTTCAAGGCAGAGTGGGGGAGG - Intronic
1062225485 9:135447244-135447266 CGTGGCAGGGGGACAGGGGGTGG + Intergenic
1062274446 9:135724129-135724151 GGCTCGAGAGGCACAGGGGGAGG + Intronic
1062525128 9:136975159-136975181 TGTGCAAGGTGGACAGGGGCAGG - Intergenic
1062572446 9:137191889-137191911 GGTCCAAGGGGGAAGTGGGGTGG - Exonic
1185452618 X:290859-290881 GAAGCAAGGGGGACAGCGGGAGG + Intronic
1185452638 X:290921-290943 GAAGCAAGGGGGACAGCGGGAGG + Intronic
1185736671 X:2501020-2501042 GGTTCGGGGCGGGCAGGGGGCGG - Intronic
1185881960 X:3749272-3749294 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1187487210 X:19715913-19715935 GGTGCCAGGGGCTCAGGGGGTGG + Intronic
1187918427 X:24177464-24177486 GGGTCTAGGGGGACGGGAGGAGG + Intronic
1189444537 X:41068241-41068263 GCTTGAAGGTGGACAGAGGGAGG - Intergenic
1190652161 X:52577897-52577919 GGTTCTTGGGAGAAAGGGGGAGG - Intergenic
1192937109 X:75871584-75871606 GGATCAGGAGAGACAGGGGGAGG - Intergenic
1193204218 X:78728923-78728945 AGTTAAAAGGGGACAGTGGGTGG - Intergenic
1194169805 X:90566800-90566822 GGGTCTAGGGAGACAGGGGCAGG + Intergenic
1194215358 X:91124227-91124249 GGTCCAAGGGGTACAGGGGCAGG - Intergenic
1194398866 X:93419087-93419109 GTTGCAAGGGAGACAGGGGAAGG + Intergenic
1194904276 X:99554272-99554294 GGTTCAAGGGGTACACGTGCAGG + Intergenic
1194959914 X:100223331-100223353 GGTTCAGGGGGTACAGGTGAAGG + Intergenic
1196176770 X:112646720-112646742 GATTGATGGGGGACTGGGGGTGG + Intronic
1196804964 X:119575171-119575193 GGTTCTAGGGGGGCGGGGCGGGG + Intronic
1197812232 X:130455513-130455535 GGAGCAAAGGGGGCAGGGGGAGG - Intergenic
1199366579 X:146992740-146992762 GGTTCAAGGGGTACATGTGCAGG + Intergenic
1199650699 X:149944402-149944424 GGTTCAAGGAGGGAAGGAGGAGG + Intergenic
1200505805 Y:4010142-4010164 GGTCCTAGGGAGACAGGGGCAGG + Intergenic
1200516045 Y:4144573-4144595 GGGTCTAGGGAGACAGGGGCAGG + Intergenic