ID: 1082952499

View in Genome Browser
Species Human (GRCh38)
Location 11:58832320-58832342
Sequence GAAACACTTGGAATGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082952495_1082952499 27 Left 1082952495 11:58832270-58832292 CCTGCTTACCTCTTGGGATAGTT No data
Right 1082952499 11:58832320-58832342 GAAACACTTGGAATGCTGCCTGG No data
1082952496_1082952499 19 Left 1082952496 11:58832278-58832300 CCTCTTGGGATAGTTGTGAGTAC No data
Right 1082952499 11:58832320-58832342 GAAACACTTGGAATGCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082952499 Original CRISPR GAAACACTTGGAATGCTGCC TGG Intergenic
No off target data available for this crispr