ID: 1082954608

View in Genome Browser
Species Human (GRCh38)
Location 11:58856501-58856523
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1862
Summary {0: 1, 1: 16, 2: 344, 3: 661, 4: 840}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082954608 Original CRISPR ATGATTAAGCATAGGGAGGA AGG (reversed) Intronic
901751056 1:11409010-11409032 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
901949427 1:12730268-12730290 ATGATTAAACTTAGTGAGGAAGG - Intergenic
903097120 1:20987842-20987864 ATGACTAAACTTAGTGAGGAAGG + Intronic
903561100 1:24228479-24228501 ATCATTCAGCTTAGTGAGGAAGG - Intergenic
903656981 1:24955530-24955552 AAGATTCTGCATAGGTAGGAAGG + Intronic
904665386 1:32116739-32116761 ATGATTAAGCTTAGTGAGGAAGG - Intronic
904761223 1:32805625-32805647 ATGATTAAGCTTAGTGAAGAAGG - Intronic
904776932 1:32915329-32915351 ATGATTAAGCTTACTGAGGAAGG - Intergenic
905086192 1:35379660-35379682 ATGATTACTCTTAGTGAGGAAGG - Intronic
905188923 1:36217969-36217991 ATGATTAAGCTTAATGAGGAAGG + Intergenic
905545869 1:38800288-38800310 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
906558824 1:46738596-46738618 ATGATTAAGCTTAGTGACGAAGG - Intergenic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
907112978 1:51943497-51943519 ATAATTAAGCTTAGTGAGGAAGG + Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907548137 1:55280284-55280306 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
907685089 1:56602825-56602847 ATGATTAAGCTTAGCGAGGAAGG + Intronic
907766136 1:57412358-57412380 ATGATTAAGCTTAGTGGGGAAGG + Intronic
907802496 1:57784042-57784064 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
907874562 1:58473115-58473137 AGCATTAAGCATTGGGAGGTTGG - Intronic
908023403 1:59921993-59922015 ATTATTAAGTTTAGTGAGGATGG - Intronic
908091663 1:60692282-60692304 GTGATTAAACTTAGTGAGGAAGG + Intergenic
908221489 1:62011267-62011289 ATGATGAAACTTAGTGAGGAAGG - Intronic
908340769 1:63176504-63176526 ATGGTTAAGCTTAGTGACGAAGG - Intergenic
908464910 1:64383905-64383927 ATGATTAAGCTTTGTGAGAAAGG + Intergenic
908588470 1:65601651-65601673 ATAATTCAGCATAGCGATGATGG - Exonic
908849629 1:68362737-68362759 ATGATTAAACTTAGTGAGGGAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
908975401 1:69891161-69891183 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
909029082 1:70517495-70517517 AAGATTAATCTTAGTGAGGAAGG + Intergenic
909088450 1:71195604-71195626 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
909147287 1:71952158-71952180 ATGATTAAGGTTAGTGAGGAAGG + Intronic
909296889 1:73961554-73961576 ATGATTAGGCTTAGTGATGAAGG + Intergenic
909347269 1:74605480-74605502 ACGATTAGGCTTAGTGAGGAAGG - Intronic
909735600 1:78957310-78957332 ATAATTAAGCATAGTGAGGAAGG + Intronic
909767203 1:79371414-79371436 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
909844066 1:80368211-80368233 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
909916090 1:81321432-81321454 ATGATGAAGCTTAGTGAGAAAGG - Intronic
909964348 1:81889195-81889217 ATGATTAAGCTTAGTGAGGAAGG + Intronic
910054855 1:83021282-83021304 ATGATGAAGCTTAGTGAGAAAGG - Intergenic
910072021 1:83228096-83228118 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910076401 1:83284752-83284774 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910078440 1:83309025-83309047 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
910151519 1:84152945-84152967 ATGATTAAGCTTAGTAAGGATGG - Intronic
910200457 1:84692958-84692980 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910231726 1:84994875-84994897 GTGATTAAGCTTAGTGAGGAAGG - Intronic
910269832 1:85382074-85382096 ATTATGAAGCTTAGTGAGGAAGG + Intronic
910298403 1:85676496-85676518 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910640091 1:89451036-89451058 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
910718663 1:90260244-90260266 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
910782578 1:90955919-90955941 AGAATTAAGCTTAGTGAGGAAGG - Intronic
910918199 1:92314209-92314231 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910983082 1:92977932-92977954 AGGAGCAAGAATAGGGAGGATGG - Intergenic
910992475 1:93070398-93070420 ATGATTAGGCTTAGTGAGCAAGG + Intergenic
911199097 1:95026307-95026329 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911296628 1:96125347-96125369 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
911503115 1:98713590-98713612 ATGATTAAACTTAGTGAGGAAGG - Intronic
911513307 1:98835222-98835244 ATGTTTAAGCTTAGTGAAGAAGG - Intergenic
911591394 1:99752290-99752312 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911649627 1:100373107-100373129 ATGATTAAGCTTAGTGAAGAAGG - Intronic
911868406 1:103058526-103058548 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911897018 1:103449024-103449046 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
911969890 1:104419169-104419191 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
912032772 1:105270414-105270436 ATGAGTAAGCTTAGAAAGGAAGG + Intergenic
912307194 1:108580444-108580466 ATGATTAAGCTTAGTGAGGAAGG + Intronic
912731456 1:112110216-112110238 ATGATTAAGCTTGGGGAGGAAGG - Intergenic
912874002 1:113337254-113337276 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
912876764 1:113367821-113367843 ATGATTACACTTAGTGAGGAAGG + Intergenic
912902496 1:113667720-113667742 TTGATTAAGCTTAGTGAGGAAGG - Intronic
912954142 1:114141161-114141183 ATAATGAAGCTTAGTGAGGATGG + Intronic
913127018 1:115800927-115800949 ATGATTAAACTTAGTGAAGAAGG - Intergenic
913195792 1:116454959-116454981 CTCATTCAGCACAGGGAGGAAGG - Intergenic
913207322 1:116552062-116552084 ATGATTAAGCTTAGTGAGGAAGG - Intronic
913308019 1:117452329-117452351 ATAATTAAGCTTAGTGAGGAAGG + Intronic
913308021 1:117452360-117452382 GTAATTAAGCTTAGTGAGGAAGG + Intronic
913310816 1:117490668-117490690 GTAATTAAGCTTAGTGAGGAAGG + Intronic
913350942 1:117858402-117858424 ATGATTAAGCTTAGGGAGAAAGG + Intergenic
913530127 1:119727912-119727934 ATGATTATTCATAAGGAGGTGGG + Intronic
914436187 1:147661640-147661662 ATGATTAAGCTTAGTAAGGAAGG + Intronic
914690522 1:150021984-150022006 ATGATTAAGGAGAGAGAGAAAGG - Intergenic
914737830 1:150435375-150435397 AAGATTAAGCTTAGTGAGTAAGG + Intronic
914774559 1:150724610-150724632 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
914977169 1:152377323-152377345 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
915600039 1:156916617-156916639 ATGATTAAACTTAGTGGGGAAGG + Intergenic
915909571 1:159905396-159905418 ATGATTAAGCTCAGCAAGGAAGG - Intergenic
916553119 1:165868901-165868923 ATAATTAAGCTTAGTGAGGAAGG - Intronic
916566681 1:165985065-165985087 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
916799875 1:168206899-168206921 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
916831887 1:168501661-168501683 ATAATTAAGCTTAGTGATGAAGG - Intergenic
917115375 1:171597910-171597932 ATGATTAAGCTTAATGAGGAAGG + Intergenic
917192322 1:172431171-172431193 ATGATTAAGCTTAGTGAAGAAGG + Intronic
917238949 1:172926266-172926288 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
917362366 1:174190789-174190811 ATGATTAAGCTTACTGAGGAAGG - Intronic
917669467 1:177259013-177259035 ATGATTAGGCATAGTGAGGAAGG + Intronic
917766162 1:178219736-178219758 ATGATTAAGCTTAGTGAGGAAGG - Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
917950909 1:180034915-180034937 ATGATTAAGCTTAGTGACGAAGG + Intronic
917983969 1:180295951-180295973 ATGATTAAGCTTAGTAATGAAGG + Intronic
917993542 1:180409868-180409890 ATGATTAAGCTTAGTGAGGAAGG + Intronic
918130682 1:181625844-181625866 ATGATTAAGCTTAGTGAGGAAGG - Intronic
918361371 1:183762231-183762253 ATGATTACACTTAGTGAGGAAGG - Intronic
918411582 1:184263983-184264005 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
918606147 1:186428652-186428674 ATGATTAAGCTAAATGAGGAAGG - Intergenic
918632514 1:186734969-186734991 AAAATTAAGCTTAGTGAGGAAGG - Intergenic
918849574 1:189668960-189668982 ATGGTTAAACTTAGTGAGGAAGG + Intergenic
919113317 1:193247530-193247552 ATGATTAAGCTTAGTAAGGAAGG + Intronic
919185005 1:194134498-194134520 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
919211160 1:194488766-194488788 ATGATTAACCATTGTGAGGAAGG + Intergenic
919335684 1:196229579-196229601 ATGATTATGCTTAGTGAGGAAGG + Intronic
919415229 1:197300235-197300257 CTGATTAAGCTTATGGAGGAAGG + Intronic
919448816 1:197745294-197745316 GTGATAAAGCTTAGTGAGGAAGG - Intronic
919487863 1:198166457-198166479 ATGATTAAGCTTAGTGAGAAAGG - Intronic
919612826 1:199767228-199767250 ATGATTAGGCTTAGTGAGGTAGG + Intergenic
920024332 1:202982169-202982191 ATGATGAAGCTTAGCAAGGACGG - Intergenic
920538324 1:206756520-206756542 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
920887581 1:209946268-209946290 ATGATTAATCCTAGTGAGGAAGG + Intronic
921091029 1:211843270-211843292 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
921141901 1:212316177-212316199 ATGATTAAGCTTAGTGAGGAAGG + Intronic
921204167 1:212833911-212833933 ATGATTAAGCTTAGTGAGGAAGG - Intronic
921224385 1:213003390-213003412 ATGATTAAGCTTAGCAAGGAAGG - Intronic
921276182 1:213523011-213523033 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
921282021 1:213576776-213576798 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921292199 1:213669193-213669215 ACGATTAAGCTTAGTAAGGAAGG - Intergenic
921301709 1:213757212-213757234 ATAGTTAAGCTTAGTGAGGAAGG + Intergenic
921303944 1:213777253-213777275 ATGATTAAGCTTAGTGGGGAAGG - Intergenic
921307945 1:213815868-213815890 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921308238 1:213818242-213818264 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
921398735 1:214696441-214696463 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921402611 1:214742897-214742919 ATGACTAAGCTTAATGAGGAAGG - Intergenic
921408258 1:214805838-214805860 ATGCTTAAGCTTGGTGAGGAAGG + Intergenic
921492583 1:215796732-215796754 ATGATTAAGCTTATTGAGGAAGG + Intronic
921537981 1:216375754-216375776 ATGAGTAAGCTTAGTGAGGAAGG - Intronic
921571736 1:216787698-216787720 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
921576424 1:216840596-216840618 ATGATTTAGCTTACAGAGGAAGG - Intronic
921609796 1:217197913-217197935 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
921828868 1:219704460-219704482 ATGATTAAGTTTAGTGAGGAAGG + Intronic
922032482 1:221815019-221815041 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
922065582 1:222136307-222136329 ATGATTAAACTTAGTGAGGAAGG - Intergenic
922333165 1:224595617-224595639 ATGATTTAGCTTAGTGAGGAAGG + Intronic
922389533 1:225125828-225125850 ATGATTAAGCTTAATAAGGAAGG - Intronic
922495731 1:226056362-226056384 ATGATTTTGCTTAGTGAGGAAGG - Intergenic
922588659 1:226755367-226755389 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
922624164 1:227020833-227020855 ATGATTAAACTTAATGAGGAAGG - Intronic
922659047 1:227413334-227413356 ATGATTATGCTTAGTAAGGAAGG - Intergenic
922727948 1:227933562-227933584 ATGATTAAGATTAGTGAGGAAGG - Intronic
922823387 1:228500585-228500607 ATGATCAATCTTAGTGAGGAAGG - Intergenic
922850149 1:228726083-228726105 ATAATAAAACATAAGGAGGAAGG - Intergenic
922959213 1:229631478-229631500 ATAATTAAGCTTAGTGAGGAAGG - Intronic
923014678 1:230117425-230117447 ATGATTAAGCTTAGTGAGGAAGG - Intronic
923286312 1:232499221-232499243 ACGATTACGCTTAGTGAGGAAGG + Intronic
923371995 1:233323868-233323890 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
923717842 1:236440983-236441005 ATAATTAAGTTTAGAGAGGAAGG + Intronic
923763175 1:236866575-236866597 ATGATTAAGTTTAGTGAGGAAGG + Intronic
923898293 1:238297159-238297181 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
923936449 1:238765587-238765609 ATGATGAAGCTTAGTGAAGAAGG - Intergenic
924283318 1:242460248-242460270 ATGATTAAGTTTAGTGAGGGCGG - Intronic
924499838 1:244627000-244627022 ATGATTAAGCTTAGTGAGGAAGG - Intronic
924833386 1:247622540-247622562 ACTATTAAGCTTAGGGAGGAAGG + Intergenic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1062777214 10:162013-162035 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062890194 10:1053621-1053643 ATGATTAAGCATGGTGAGGAAGG - Intronic
1062893898 10:1088342-1088364 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062995635 10:1863732-1863754 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1063287080 10:4701334-4701356 ATAATAAACCACAGGGAGGAAGG + Intergenic
1063337616 10:5231592-5231614 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1063690741 10:8284739-8284761 AAGATTAAGCCAAGGAAGGATGG - Intergenic
1063788565 10:9412977-9412999 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1063821140 10:9837479-9837501 ATAATTAATCTTAGTGAGGAAGG + Intergenic
1063832411 10:9969211-9969233 ATGATTAAGCATAAGGTAAATGG - Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1064113839 10:12560820-12560842 ATGATGACACATAGGGAGGCAGG + Intronic
1064430304 10:15265009-15265031 ATGATTAAGCTCAGGAAGCAGGG + Intronic
1064788363 10:18925451-18925473 ATTATTAAGCTTAGTGAAGAAGG - Intergenic
1065059254 10:21881402-21881424 ATGATTAAGCTTAGTTCGGAAGG - Intronic
1065064818 10:21950584-21950606 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1065699982 10:28415485-28415507 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1066043377 10:31575773-31575795 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1066266903 10:33784815-33784837 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066478959 10:35776883-35776905 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1066479194 10:35779118-35779140 ATGATTAAGCTTGGTGGGGAAGG - Intergenic
1067186682 10:44035108-44035130 ATGACTAAGCTTAGTGAAGAAGG - Intergenic
1067275730 10:44832297-44832319 ACAATTAAGCTTAGTGAGGAAGG - Intergenic
1067301887 10:45019184-45019206 ATGGTTAAGCTTAGTGGGGAAGG - Intergenic
1067548145 10:47211355-47211377 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1068127105 10:52853919-52853941 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1068220279 10:54035756-54035778 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1068613285 10:59084571-59084593 ATTATAGAGCAAAGGGAGGATGG - Intergenic
1068748730 10:60566374-60566396 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1068870112 10:61934443-61934465 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1068940890 10:62680019-62680041 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1069043992 10:63723457-63723479 ATGATTAAGAACAGAGAGAATGG - Intergenic
1069087134 10:64153982-64154004 ATGATTAAGCTTAGTGAAGTAGG - Intergenic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1069207507 10:65710293-65710315 AGGATTATGCTTAGCGAGGAAGG - Intergenic
1069304008 10:66945691-66945713 ATGATAAAGCTTAATGAGGAAGG - Intronic
1069319047 10:67144913-67144935 ATGCTTAAGCTTAGTTAGGAAGG - Intronic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1070218524 10:74413788-74413810 ATGATTGAGTTTAGTGAGGAAGG - Intronic
1070420780 10:76235042-76235064 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1070944734 10:80380542-80380564 ATGGTTAGGCTTAGTGAGGAAGG - Intergenic
1070984384 10:80675609-80675631 ATGATTAAGCTTAGTAAGGAGGG + Intergenic
1071132726 10:82414135-82414157 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1071179572 10:82967369-82967391 ATAAATAAGCAACGGGAGGAGGG - Intronic
1071438841 10:85671684-85671706 ATGATTACACTTAGTGAGGAAGG + Intronic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071662990 10:87524593-87524615 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1071683324 10:87729671-87729693 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1071851634 10:89577597-89577619 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1071871819 10:89803882-89803904 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1071971195 10:90908837-90908859 ATGATTAAGCTTATTGAGAAAGG + Intergenic
1072094779 10:92167350-92167372 ATGATTAAGCTTAATGAAGAAGG - Intronic
1072166681 10:92820301-92820323 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1072325736 10:94296833-94296855 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1072344468 10:94489620-94489642 ATGAGTAAGCTTAATGAGGAAGG - Intronic
1072423775 10:95311662-95311684 ATGATTAAGGATGGAAAGGAGGG + Intergenic
1072473999 10:95741129-95741151 ATGATTAAGCTTAGCAAGGAAGG - Intronic
1072601024 10:96929724-96929746 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1072836305 10:98717441-98717463 ACGATTAAGCTTAATGAGGAAGG - Intronic
1072889651 10:99311761-99311783 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1072912665 10:99517842-99517864 AGGACTAAGCTTAGTGAGGAAGG - Intergenic
1073615096 10:104986570-104986592 ATGATTAAGCTCAGTAAGGAAGG - Intronic
1073681511 10:105709228-105709250 ATGATTAAGCTTAGTGAGCAAGG + Intergenic
1073696305 10:105872918-105872940 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1073781088 10:106839162-106839184 ATGATTAAACTTGGTGAGGAAGG + Intronic
1074090918 10:110254520-110254542 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1074210714 10:111331679-111331701 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074605602 10:114961481-114961503 ATGCTTAAGAATAGGAAGAAAGG - Intronic
1074607248 10:114985531-114985553 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1074649848 10:115508424-115508446 GTGATTAAGCTTAGTGAGGAGGG + Intronic
1074691476 10:116008866-116008888 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074905253 10:117856686-117856708 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1075034716 10:119054798-119054820 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1075178940 10:120192356-120192378 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1075193356 10:120331706-120331728 ATTATTAAGCTTAGCGAGGAAGG + Intergenic
1075354532 10:121759067-121759089 ATGATTAAACATGGTGATGAAGG + Intronic
1075490750 10:122866905-122866927 ATGATTAAGCTTAGTGAGTAAGG + Intronic
1075596523 10:123734270-123734292 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1075751218 10:124773073-124773095 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1076095374 10:127730961-127730983 ATGATTAAATTTAGTGAGGAAGG - Intergenic
1076513453 10:131028669-131028691 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1076742701 10:132494930-132494952 ATTATTAAGCTGAGGGAGGAAGG + Intergenic
1076856858 10:133120873-133120895 ATCATTACGCTTAGTGAGGAAGG - Intronic
1078193648 11:9115752-9115774 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1078398931 11:11006912-11006934 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1079132905 11:17759515-17759537 ATGATTACGCTTAGTGAGGAAGG - Intronic
1079158424 11:17970548-17970570 ATGATTAATCTTAGGGAGGAAGG + Intronic
1079325866 11:19491805-19491827 ACTATTAAGCTTAGTGAGGAAGG - Intronic
1079408570 11:20165676-20165698 ATGATGGAGCATAGAGGGGAAGG - Intergenic
1079643931 11:22839776-22839798 ATTATTAATCTTAGTGAGGAAGG - Intergenic
1080143728 11:28953873-28953895 ATGATTAAACTTAGTGAGAAAGG + Intergenic
1080359110 11:31492564-31492586 ATGATTAAGCTTACCAAGGAAGG - Intronic
1080543878 11:33296911-33296933 ATGATTAAGTTTAGCGAGGAAGG + Intronic
1080842311 11:35996142-35996164 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
1080884801 11:36356931-36356953 GTGATTAAGTTTAGTGAGGAAGG + Intronic
1081178212 11:39954960-39954982 AGGATTAAGGCTAGGAAGGATGG + Intergenic
1081212013 11:40347527-40347549 ATGACTAAGCTTAGTAAGGAAGG - Intronic
1081233346 11:40614643-40614665 ATGATTAAGCTCAGTGAAGAAGG - Intronic
1081485721 11:43526647-43526669 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1081607418 11:44536093-44536115 ATGATGCAGAAGAGGGAGGAGGG + Intergenic
1081941619 11:46947397-46947419 ATGATTTATCAAAGAGAGGAGGG + Intronic
1082200019 11:49355223-49355245 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082230026 11:49752372-49752394 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1082686685 11:56246493-56246515 ATAATTGAGCTTAGTGAGGAAGG - Intergenic
1082761827 11:57134650-57134672 ATGATTAAGCTTAGTGAGCAAGG - Intergenic
1082923062 11:58516864-58516886 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082954608 11:58856501-58856523 ATGATTAAGCATAGGGAGGAAGG - Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083040116 11:59677723-59677745 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1083071436 11:59987382-59987404 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1083166979 11:60895679-60895701 ATGATTGAGCTTAGTGAAGAAGG - Intronic
1083976064 11:66121452-66121474 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1084011684 11:66353793-66353815 ATGATTACACATAGTGAGGAAGG + Intronic
1084369246 11:68728152-68728174 AAGATTAAGCTTAGTGAGGAAGG + Intronic
1084662613 11:70555334-70555356 ACAATTAAGCTTAGTGAGGAAGG + Intronic
1084668189 11:70588324-70588346 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1084738894 11:71125248-71125270 GTGATTAAGCTTAGCAAGGAAGG + Intronic
1084761556 11:71275416-71275438 ACAATTAAGCTTAGTGAGGAAGG + Intergenic
1084871953 11:72104386-72104408 AGGATTAAGCATAGGGAGCTGGG - Intronic
1085441187 11:76564395-76564417 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1085506701 11:77064939-77064961 ATGCTGCAGCACAGGGAGGAAGG + Intergenic
1085858152 11:80199122-80199144 ATGATTATGCTTACTGAGGAAGG + Intergenic
1086034530 11:82400685-82400707 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086121633 11:83310830-83310852 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086187156 11:84032201-84032223 ATGATTATGCTTAGTGAGGAAGG + Intronic
1086273353 11:85094879-85094901 ATGATTAAACTTAGTGAGGAAGG - Intronic
1086323553 11:85675261-85675283 ATGATTAAACTTAGTGAGGATGG - Intronic
1086620032 11:88876577-88876599 ATGATTAAGCTTAATGAGGAAGG - Intronic
1086646959 11:89234512-89234534 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1086655656 11:89350975-89350997 ACGATTAAACTTAGTGAGGAAGG + Intronic
1086775130 11:90821222-90821244 ATAATTAAGCTTAGTGAGAAGGG - Intergenic
1086896949 11:92324307-92324329 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1086957028 11:92943743-92943765 ATTATTAAGTTTAGTGAGGAGGG + Intergenic
1086957581 11:92949408-92949430 ATTATTAAGTTTAGTGAGGAGGG + Intergenic
1087156034 11:94904888-94904910 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1087651029 11:100867778-100867800 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1087665651 11:101044600-101044622 ATGATTAAGCTTAATTAGGAAGG - Intronic
1087913935 11:103786247-103786269 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1088010349 11:104993642-104993664 ATAATTTAGCATAGAAAGGAGGG - Intergenic
1088157004 11:106818623-106818645 ATGATTAAGCTTAGTAAGAAAGG + Intronic
1088439679 11:109855932-109855954 ATGATTAAGCTTAGTGAGAACGG - Intergenic
1088462845 11:110100890-110100912 ATGATTTAGCTTGGGGAGAAAGG + Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1089415271 11:118283916-118283938 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
1089724347 11:120462116-120462138 ATGATTAAGTTTAGTAAGGAAGG - Intronic
1089823736 11:121252545-121252567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1090260903 11:125319081-125319103 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1090523145 11:127500302-127500324 ATGATTAAATGTGGGGAGGAAGG + Intergenic
1090738041 11:129629468-129629490 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1090813157 11:130265507-130265529 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1091515568 12:1177332-1177354 AAGATTAAGCTTAGTGAGGAAGG - Intronic
1092152332 12:6259034-6259056 ACGATTAAGCTTAGCGAAGAAGG - Intergenic
1092464978 12:8723147-8723169 AAGATTAAGCTTAGTGAAGAAGG - Intronic
1092622937 12:10293302-10293324 ATGAATAAGCTTAGTGAGGAAGG - Intergenic
1093221881 12:16431396-16431418 ATGATTAAGTTCAGTGAGGAAGG - Intronic
1093252560 12:16825311-16825333 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
1093427557 12:19045529-19045551 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1093450935 12:19312873-19312895 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1093617170 12:21240321-21240343 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1093622799 12:21312552-21312574 ATCATTAAGCTCAGCGAGGAGGG - Intronic
1094112507 12:26876543-26876565 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1094210331 12:27883783-27883805 ATCATTTAGCATGGGGAGGAGGG - Intergenic
1094250395 12:28353461-28353483 ATAATTAACCTTAGTGAGGAAGG - Intronic
1094280096 12:28727412-28727434 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1094440161 12:30466430-30466452 ACGATTACGCTTAGTGAGGAAGG - Intergenic
1094632655 12:32192012-32192034 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1094637047 12:32236626-32236648 ATGATTATGCTTAGTGAGGAAGG + Intronic
1095168774 12:39007844-39007866 ATGATTTAGCTTAGTGAGAAAGG + Intergenic
1095255474 12:40030926-40030948 ATGCTTAAGGATTGGCAGGAGGG - Intronic
1095284743 12:40395553-40395575 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095308420 12:40664848-40664870 AGGATTAAGCTTAGTGAGGAAGG + Intergenic
1095435508 12:42183341-42183363 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1095518404 12:43033149-43033171 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095523096 12:43091806-43091828 AGTATTAAGCTTAGTGAGGAAGG + Intergenic
1095605972 12:44068375-44068397 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1095688108 12:45058740-45058762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095729051 12:45485691-45485713 ATCACTAAGCTTAGTGAGGAAGG + Intergenic
1095754577 12:45750090-45750112 ATGATTACGCTTAATGAGGAAGG - Intronic
1095764153 12:45876057-45876079 ATGATTAAGTTTAGTGAGAAAGG - Intronic
1095791207 12:46169437-46169459 TCGATTAAGCTTAGTGAGGAAGG - Intergenic
1095889320 12:47221271-47221293 AAGATATAGCTTAGGGAGGAGGG - Intronic
1095910568 12:47422409-47422431 AAAATTAAGCATAGAGAGGAAGG + Intergenic
1095936801 12:47692777-47692799 ATGATTAAACTTAGTGAGGACGG - Intronic
1096013268 12:48241985-48242007 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1096440344 12:51637345-51637367 ATGATTAAACTTAGTGAGGAAGG + Intronic
1097123651 12:56755417-56755439 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1097672018 12:62551209-62551231 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1097758474 12:63433980-63434002 ATGATTGAGCTTAGTGAGAAAGG + Intergenic
1097788554 12:63788881-63788903 ATAGTTAAGCTTAGTGAGGAAGG - Intronic
1097936419 12:65257144-65257166 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1097954745 12:65472122-65472144 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1098075184 12:66722204-66722226 ATGATTAAGCTTATTGAGGAAGG - Intronic
1098206639 12:68117837-68117859 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1098344451 12:69486608-69486630 GTGATTAAAGTTAGGGAGGAAGG + Intronic
1098364818 12:69691406-69691428 ATGATTAAGAACACGGAGTAAGG - Intronic
1098491325 12:71083359-71083381 ATGATTATTCATAAGGAGGTGGG + Intronic
1098577875 12:72064504-72064526 ATGATTAAACTTACTGAGGAAGG + Intronic
1098712792 12:73786910-73786932 ATTATTAAGCCTAAGGAGGAAGG - Intergenic
1098744225 12:74215305-74215327 ATAATTCAGCTTAGTGAGGAAGG - Intergenic
1098752066 12:74306199-74306221 ATGATTAATCTTAGTGAGGAAGG - Intergenic
1098800675 12:74953434-74953456 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1098921761 12:76309032-76309054 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1098936739 12:76488862-76488884 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1099003514 12:77209534-77209556 ATGATTAAGCTTTGTAAGGAAGG - Intergenic
1099162019 12:79253660-79253682 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1099218370 12:79881226-79881248 ATGATTAAGCTTGGTGAGAAAGG + Intronic
1099503106 12:83437880-83437902 ATGATTAAGCTTATTGAAGAAGG - Intergenic
1099609114 12:84843723-84843745 ATGATTAAGCTTATTGAGGAAGG + Intergenic
1099726601 12:86438032-86438054 ATGATTAACTTTAGTGAGGAAGG + Intronic
1099938065 12:89151790-89151812 ATGACTAAGCTTAGTTAGGAAGG + Intergenic
1100069242 12:90691148-90691170 ATAATTAAGTGTAGTGAGGAAGG + Intergenic
1100117480 12:91325004-91325026 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1100257005 12:92894386-92894408 ATGATTAAGCTTAATGAGGAAGG + Intronic
1100468287 12:94868270-94868292 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1100516422 12:95332636-95332658 ATGATTAAGCTTAGTGAGAAGGG - Intergenic
1100695616 12:97089572-97089594 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1100927280 12:99563308-99563330 ATAATTCAGCTTAGTGAGGAAGG - Intronic
1101562169 12:105867267-105867289 ATGATTAAGCTTAGTAAAGAAGG + Intergenic
1101620569 12:106383403-106383425 ATGATTAAGCTTAGAAAGGAAGG - Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1101934888 12:109049215-109049237 ATGATTAAGCTCAGTGAGGAAGG - Intronic
1102654059 12:114465393-114465415 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1103468737 12:121162875-121162897 GTGATCAAGGATAGGAAGGAAGG + Intronic
1104165155 12:126221162-126221184 ATGATTTAGCTTACTGAGGAAGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104534049 12:129601517-129601539 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1105325033 13:19363110-19363132 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1105547644 13:21362782-21362804 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1105589658 13:21779611-21779633 ATGATTAAGCTTAGTGACAAAGG + Intergenic
1105746995 13:23386713-23386735 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1105780077 13:23697912-23697934 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1105833549 13:24187927-24187949 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1105868253 13:24480440-24480462 ATGATTAGGCTTGGTGAGGAAGG + Intronic
1106987696 13:35374086-35374108 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1107143722 13:37034209-37034231 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1107175328 13:37393332-37393354 ATGATTAAGCTTAGCAAGGAAGG + Intergenic
1107287288 13:38808438-38808460 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1107299302 13:38948375-38948397 AAGATTAAACATAGGAAGGCAGG + Intergenic
1107459078 13:40583915-40583937 ATGATTCAGCTTAGTGAGGAAGG - Intronic
1108010334 13:46000792-46000814 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1108181372 13:47843163-47843185 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1108274439 13:48793233-48793255 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1108278059 13:48831468-48831490 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1108331127 13:49385566-49385588 ATGATTAGTCTTAGTGAGGAAGG - Intronic
1108381432 13:49858346-49858368 ATGCTTATGCACAGAGAGGAAGG + Intergenic
1108467987 13:50737854-50737876 ATGATTAAACTTAGTGAGCAAGG + Intronic
1108602029 13:52003205-52003227 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108701068 13:52944611-52944633 ATGGTTAAGCACAGGAAAGAAGG + Intergenic
1108770635 13:53696384-53696406 ATGATTAAGCTTAATGAAGATGG + Intergenic
1108845059 13:54668167-54668189 ATAAATAAGAATAGTGAGGAAGG - Intergenic
1108867804 13:54942467-54942489 ATGATTTTGCTTCGGGAGGAGGG + Intergenic
1108909245 13:55522368-55522390 ATGATTAAGCTTAGTCAGGAAGG - Intergenic
1108926475 13:55753469-55753491 ATGATTAAGCTTAGTAAGGTAGG + Intergenic
1109131283 13:58589389-58589411 ATGATTAATCTTAGTGAAGAAGG + Intergenic
1109241263 13:59892072-59892094 ATAAGTAAGCAGAGGGAGAAGGG + Intronic
1109254684 13:60064804-60064826 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1109265840 13:60199357-60199379 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109515465 13:63438202-63438224 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1109616531 13:64841233-64841255 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1109700831 13:66022653-66022675 ATGATTAAGCTCAGTAAGGAAGG + Intergenic
1109815616 13:67579313-67579335 ATGATTAAGTTTAGTGAGGATGG - Intergenic
1109853567 13:68100884-68100906 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109893475 13:68651054-68651076 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
1109953297 13:69531109-69531131 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1110379003 13:74828051-74828073 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1110382496 13:74869884-74869906 TTGATTAAGCTTAGTGAGGAAGG - Intergenic
1110411646 13:75210308-75210330 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1110447263 13:75599844-75599866 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1110735535 13:78931771-78931793 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110766513 13:79285297-79285319 ATAATTAAGCTTAGAGAGGAAGG + Intergenic
1110829560 13:80014699-80014721 ATGATCAAGCGTAGTAAGGAAGG + Intergenic
1110841477 13:80148455-80148477 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1111135132 13:84031787-84031809 ATGATTAAGTTTAGTGAAGAAGG - Intergenic
1111146304 13:84185377-84185399 ATGACTGAGCTTAGAGAGGAGGG - Intergenic
1111220173 13:85194593-85194615 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1111233683 13:85379475-85379497 ATGATTAAGCTTAGAGAGAAAGG + Intergenic
1111366028 13:87246100-87246122 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1111384424 13:87505538-87505560 ATGATTAAGCTTACTGAGGTAGG - Intergenic
1111530703 13:89534052-89534074 ATAATTAAGTTTAGTGAGGAAGG - Intergenic
1111571714 13:90096586-90096608 ATGATTAAACTTAGTGAGGATGG - Intergenic
1111575792 13:90152975-90152997 ATGATTGAGCTTAATGAGGAAGG - Intergenic
1111787385 13:92806524-92806546 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1111839959 13:93437326-93437348 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112208806 13:97352299-97352321 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1112521162 13:100096560-100096582 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1112543886 13:100345187-100345209 ATGATTAAGCTTAGTGGAGAAGG + Intronic
1112623064 13:101071820-101071842 ATGATTAAGCTTATGGAGGAAGG - Intronic
1112653418 13:101422870-101422892 ATGATTAAGTTTAGTGAGAAAGG - Intergenic
1112698486 13:101977212-101977234 CTGGTTAAGTTTAGGGAGGAGGG - Intronic
1112728824 13:102336132-102336154 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112978919 13:105356943-105356965 ATGATTAAGTTTAGTGTGGAAGG + Intergenic
1113041978 13:106114028-106114050 ATGATTCAGCACAGAGAGTAAGG + Intergenic
1113487013 13:110661654-110661676 ATGCTTAAGCTTAATGAGGAGGG - Intronic
1113554982 13:111225933-111225955 ACGATTAACCTTAGTGAGGAAGG + Intronic
1113713049 13:112483478-112483500 ATGACTAAGCTCAGCGAGGAAGG - Intergenic
1113722664 13:112572174-112572196 ATGGTTAAGCTTGGTGAGGAAGG - Intronic
1114137078 14:19865626-19865648 GTGTTTAACCATAGGGAGAATGG + Intergenic
1114223750 14:20720036-20720058 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1114585470 14:23808895-23808917 ATGAGTAAGCTTAGTAAGGAAGG + Intergenic
1114599677 14:23944245-23944267 ATTATTAAGTTTAGTGAGGATGG + Intergenic
1114601958 14:23963789-23963811 ACAATTAAGCTTAGTGAGGAAGG - Intronic
1114606130 14:23998913-23998935 ACAATTAAGCTTAGTGAGGAAGG - Intronic
1114611695 14:24046492-24046514 ATAATTGAGCTTAGTGAGGAAGG - Intergenic
1114815434 14:25952415-25952437 ATGATTAAGCATAGTAAGGAAGG - Intergenic
1114913188 14:27226755-27226777 ATGAATAAGGATAGTGAGCATGG - Intergenic
1114943317 14:27644327-27644349 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
1114977298 14:28117900-28117922 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1115308251 14:31953967-31953989 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1115709550 14:36035803-36035825 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1116091678 14:40315712-40315734 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1116101240 14:40439607-40439629 ATAATTAAGCTTAGTGAGAAGGG - Intergenic
1116141688 14:41004135-41004157 ATGATTAAGCTTACTGAAGAAGG + Intergenic
1116251419 14:42488053-42488075 AGGATTAAAGATAGAGAGGAAGG + Intergenic
1116562157 14:46394136-46394158 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1116592345 14:46794213-46794235 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1116626155 14:47266481-47266503 ATGATTGAGCATGAGGAGGCAGG - Intronic
1116646056 14:47530583-47530605 ATTATTAAGTTTAGTGAGGATGG - Intronic
1116687977 14:48066912-48066934 ATGATTAAGCTTAGTGATAAAGG - Intergenic
1116924907 14:50624656-50624678 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1117201706 14:53396423-53396445 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117231259 14:53721207-53721229 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117263415 14:54060620-54060642 ATGATTCAACTTAGTGAGGAAGG - Intergenic
1117269596 14:54128628-54128650 ATGATTAAGCTTAGTGATGAAGG + Intergenic
1117401439 14:55362062-55362084 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1117519558 14:56537236-56537258 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117586956 14:57217741-57217763 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118072234 14:62257702-62257724 ATGATGCAGCAGAGGGAGGCAGG + Intergenic
1118125018 14:62892079-62892101 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1118176693 14:63447738-63447760 GTGATTTAGCTTAGTGAGGAAGG - Intronic
1118507733 14:66432568-66432590 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1118518089 14:66548748-66548770 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1118553147 14:66979783-66979805 ATGACTAAGTTTAGTGAGGAAGG - Intronic
1118560446 14:67074622-67074644 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118692985 14:68357868-68357890 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1118927963 14:70211095-70211117 ATGATTAAGCCAAGTGAGGAAGG - Intergenic
1118959927 14:70519778-70519800 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1119170583 14:72532523-72532545 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1119883358 14:78119784-78119806 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1120049167 14:79845384-79845406 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1120264708 14:82234140-82234162 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1120318633 14:82930407-82930429 ATGATTAATCTTATTGAGGAAGG - Intergenic
1120430663 14:84410344-84410366 AAGATTAAGCTTACTGAGGAAGG + Intergenic
1120544139 14:85789491-85789513 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1120592546 14:86392731-86392753 ATCATTAAGCTTAGTGAAGAAGG - Intergenic
1121018673 14:90565370-90565392 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1121036389 14:90707459-90707481 ATAATTAAGATTAGTGAGGAAGG + Intronic
1121296261 14:92827646-92827668 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1121461480 14:94081975-94081997 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1121705082 14:95986538-95986560 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1121766583 14:96492631-96492653 ATAATTAAGCATAGTGAGGAAGG - Intergenic
1121910401 14:97785495-97785517 ATGATTTCGCTTAGTGAGGAAGG + Intergenic
1122001392 14:98658244-98658266 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1122054528 14:99084537-99084559 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122522735 14:102357054-102357076 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1123027022 14:105430162-105430184 ATGACTAAGCTTAGTTAGGAAGG - Intronic
1202907914 14_GL000194v1_random:88693-88715 ATAATTAAGCTTAGTGATGAAGG + Intergenic
1124093358 15:26626431-26626453 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1124100057 15:26684546-26684568 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1124255415 15:28137820-28137842 ATGATTAAGATTAGTGAGTAAGG + Intronic
1124397177 15:29312853-29312875 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1124568897 15:30841802-30841824 ATGATTAAGATTAGTGACGAAGG - Intergenic
1124670795 15:31636595-31636617 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1124901608 15:33828385-33828407 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1124950352 15:34313150-34313172 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1125000543 15:34765506-34765528 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1125367485 15:38933422-38933444 ATGATTAAGCTTAGAAAGCAAGG - Intergenic
1125651986 15:41324834-41324856 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1125875370 15:43139459-43139481 ATGATGAAGCTTGGTGAGGAAGG + Intronic
1126151405 15:45526460-45526482 ATTATTAACCATAGTGAGAAAGG - Intergenic
1126213246 15:46124620-46124642 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
1126391713 15:48163010-48163032 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1126419882 15:48460323-48460345 ATGATTAAACAAAGGTGGGATGG + Intronic
1126828277 15:52572621-52572643 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
1126971632 15:54119638-54119660 ATGATTAAGCTTAGCGGGGAAGG + Intronic
1127191215 15:56532566-56532588 ATGATTAAAAACAGGGAGGTGGG - Intergenic
1127206206 15:56721935-56721957 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1127447109 15:59074821-59074843 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1127705195 15:61539962-61539984 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1127948605 15:63781723-63781745 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1128173920 15:65536840-65536862 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1128189932 15:65682698-65682720 ATGATTAAGCTTAATGAGGAAGG - Intronic
1128629337 15:69247620-69247642 ATGATTAAGCTCAGTGAGGAGGG - Intronic
1128722593 15:69961734-69961756 ATGATTAAGCATAGTGAGAAAGG + Intergenic
1128938946 15:71771376-71771398 ATGATCATTCATAGCGAGGATGG + Intronic
1128969495 15:72095120-72095142 ATGATTAGGCTTAGTGAGAAAGG + Intronic
1129049189 15:72764155-72764177 ATGATTAAGCTTAGCGACGAAGG + Intronic
1129126423 15:73445539-73445561 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1129289797 15:74556110-74556132 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1129499314 15:76020322-76020344 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1129948835 15:79567554-79567576 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1130301749 15:82684901-82684923 ATGGTTAGGCTTAGTGAGGAAGG - Intronic
1130408132 15:83621279-83621301 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
1131169655 15:90168541-90168563 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1131756558 15:95569909-95569931 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1131974142 15:97925844-97925866 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1132032394 15:98449413-98449435 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1132420970 15:101668193-101668215 ATGATTAAGCTTGGTGAGGAAGG - Intronic
1133093018 16:3419736-3419758 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1134272967 16:12750301-12750323 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1135214410 16:20552433-20552455 ATGTTTAAGTATAAGTAGGAAGG + Intronic
1135506615 16:23043041-23043063 ATGAGTAAGCCTAGTGAGGGAGG - Intergenic
1135533585 16:23275395-23275417 AGGATGAAGGAAAGGGAGGAAGG + Intergenic
1135766385 16:25180939-25180961 ATGATTAAGCTTGGTGAGGAAGG + Intergenic
1136118959 16:28116527-28116549 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1136529276 16:30856487-30856509 ATAACAAAGCCTAGGGAGGAGGG - Intronic
1136594394 16:31237777-31237799 ATTATTAAGCTTAGCGAGGAAGG - Intergenic
1137416181 16:48282846-48282868 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1137740400 16:50765578-50765600 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138073028 16:54012041-54012063 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138255456 16:55554731-55554753 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1139002899 16:62535818-62535840 ATGATTTAGCTTGGTGAGGAAGG - Intergenic
1140157061 16:72441480-72441502 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1140162612 16:72513647-72513669 ATGATTAACCTTAATGAGGAAGG - Intergenic
1140168235 16:72576779-72576801 ATGATAAAGTATAAGCAGGAAGG + Intergenic
1140398983 16:74654641-74654663 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1140451591 16:75075191-75075213 TTGATTTAGCATAGGGGGAAAGG + Intronic
1140549096 16:75844646-75844668 GTCATTAAGCTTAGTGAGGAAGG - Intergenic
1140574659 16:76152573-76152595 ATGATTAAGCTTAGTGAGGACGG - Intergenic
1141100972 16:81197337-81197359 ATGTTTAAGCATGTGGAGGTGGG - Intergenic
1141304487 16:82848835-82848857 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1141393290 16:83682288-83682310 ATGATTATTCATAAGGAGGTGGG + Intronic
1141998643 16:87650514-87650536 ATGATAAAGCGTAGAGAGGAAGG + Intronic
1142616178 17:1136981-1137003 ATGATTTAGTGTAGTGAGGAAGG - Intronic
1142634874 17:1250806-1250828 ATTGTTAAGCATAAGGATGAAGG + Intergenic
1142918980 17:3167885-3167907 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1144149972 17:12433901-12433923 ATGCGTATGCATATGGAGGAGGG - Intergenic
1144165655 17:12607898-12607920 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1144265689 17:13566516-13566538 ATGATTAAACTTAGTGAGGAAGG + Intronic
1144324489 17:14165677-14165699 ATGATTAAGCTTAATGAGGAAGG + Intronic
1144530780 17:16036978-16037000 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1144706858 17:17374356-17374378 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1145277706 17:21444381-21444403 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145315541 17:21730259-21730281 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1145405929 17:22593797-22593819 TTTATTAAGCATATAGAGGAAGG + Intergenic
1145713972 17:27002197-27002219 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145726879 17:27137398-27137420 ATGATTGAGCTTAATGAGGAAGG + Intergenic
1146042957 17:29474400-29474422 GTGATTAAGCTTAGTGAGAAAGG - Intronic
1146106019 17:30038000-30038022 ATGATTAATCTTAGTAAGGAAGG + Intronic
1146115483 17:30133982-30134004 ATGATTAAGCTGATTGAGGAAGG - Intronic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1146538751 17:33676326-33676348 ATGATTATGCTTAGTGAGAAAGG + Intronic
1146578766 17:34017502-34017524 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1147049396 17:37780201-37780223 ACGCTTAAGCTTAGTGAGGAAGG + Intergenic
1147372120 17:39999625-39999647 ATGATTATGCTTAGTGAGGAAGG + Intergenic
1148660262 17:49325150-49325172 ATCATTAAGCTTAGTGAGCAAGG - Intronic
1148696238 17:49560810-49560832 ATGATTAAACTCAGTGAGGAAGG + Intergenic
1149390226 17:56182236-56182258 GTGATTCAGCTTAGTGAGGAAGG + Intronic
1149518438 17:57299379-57299401 AGGCTTAAGCTTAGTGAGGAAGG - Intronic
1150031581 17:61742458-61742480 ATGATTAAGCTTAGTGAGCAAGG - Intronic
1150918473 17:69459846-69459868 AGGATGAAGGAAAGGGAGGAAGG - Intronic
1151027441 17:70695095-70695117 GTGATTAAACTTAGGGAGGAAGG + Intergenic
1151377662 17:73702153-73702175 ATGATTAAGCTTAGCGAGAAAGG - Intergenic
1151410776 17:73926780-73926802 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152194197 17:78907009-78907031 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1152402232 17:80074014-80074036 ATGATTAAGCTTCATGAGGAAGG + Intronic
1152434437 17:80266838-80266860 ATGATTAAGCTTCTTGAGGAAGG + Intronic
1152497750 17:80686068-80686090 AAGATAAAGGATTGGGAGGATGG + Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1152971947 18:170409-170431 ATGATTAAGCTTAGTAAAGAAGG + Intronic
1152981462 18:281585-281607 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153270619 18:3317718-3317740 ACGATTAAGCTTACTGAGGAAGG - Intergenic
1153292785 18:3518079-3518101 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1153491276 18:5650747-5650769 ATGATTAAGCATATTGAGGAAGG + Intergenic
1153739048 18:8103826-8103848 ATTATTAAGCACAGTGAGGAAGG - Intronic
1153859682 18:9188989-9189011 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1153896346 18:9565439-9565461 ATGATTAAGCTTAGTGGGGAAGG + Intronic
1154096625 18:11422636-11422658 ATGATTAAGCTTAGTAAGAAGGG - Intergenic
1154127799 18:11708193-11708215 ATGATTAAGCTTACTGAGGAAGG - Intronic
1154227664 18:12522073-12522095 ATGATTAAGTTTGGTGAGGAAGG + Intronic
1154249490 18:12731662-12731684 ATGATTAAGCTTATTGAGGAAGG - Intergenic
1154341665 18:13507900-13507922 ATGATTAAACTTAGTGAGGAAGG + Intronic
1154953151 18:21229517-21229539 ATGATTAAACTTACTGAGGAAGG - Intergenic
1155095776 18:22554998-22555020 ACGATTCATCATAGGGAAGAAGG - Intergenic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155266145 18:24095799-24095821 ATGATTAAGCTTAATGAGGAAGG - Intronic
1155469978 18:26181529-26181551 ATTGTTAAGCTTAGTGAGGAAGG + Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155626397 18:27839879-27839901 ATGATTATGTTTAGTGAGGAAGG + Intergenic
1155686223 18:28555143-28555165 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1155694300 18:28666329-28666351 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1155853716 18:30805408-30805430 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1156085839 18:33400871-33400893 ATGATTAAACTTAGTGAGAAAGG - Intronic
1156629195 18:38946182-38946204 ATGATGAAGCTTAGCGAGGAAGG + Intergenic
1156635043 18:39017651-39017673 ATGATTAAATTTAGTGAGGAAGG - Intergenic
1156711567 18:39953160-39953182 ATGGTTAAACTTAGTGAGGAAGG - Intergenic
1156851978 18:41739214-41739236 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1156875950 18:42011737-42011759 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1156880996 18:42079132-42079154 ATGATTAAGCCTAGTGAGAAAGG - Intronic
1157960458 18:52148190-52148212 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1158212049 18:55062543-55062565 ATGATTAAGCTTCATGAGGAAGG - Intergenic
1158919201 18:62170703-62170725 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159191228 18:65045497-65045519 ATGATTAAGCCTATTGAGGAAGG + Intergenic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159656877 18:71040433-71040455 GTGATTAAGCTTAGTGAGGAAGG + Intergenic
1159695037 18:71546484-71546506 ATGATTAGGCTTAGTGAGTAAGG - Intergenic
1159700517 18:71620935-71620957 ATGTTTAAGCTTAATGAGGAAGG - Intergenic
1159895543 18:73992238-73992260 CTGAAAAAGCATAGGGATGAAGG + Intergenic
1159906249 18:74095335-74095357 GTGATTAAGTTTAGTGAGGAAGG - Intronic
1160117389 18:76093493-76093515 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1160218093 18:76951773-76951795 ATGATTAAGCTTAATGAGGAAGG - Intronic
1160320555 18:77889581-77889603 ATGACTAAGATTAGTGAGGAAGG - Intergenic
1160450505 18:78961011-78961033 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1160546470 18:79660081-79660103 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1161676248 19:5651681-5651703 GTGAGAAAGCACAGGGAGGAGGG - Intronic
1162288994 19:9764557-9764579 ATTATTAAGCTTAGTGAGGGCGG - Intronic
1162843769 19:13375463-13375485 ATGATTAAACACAGTGAGGAAGG + Intronic
1162892682 19:13745364-13745386 ATAATAAAGCATGGGGAGGCCGG + Intronic
1164490173 19:28703662-28703684 ATGATTAAGCCTAGTGAGAAAGG - Intergenic
1164858976 19:31547486-31547508 AGGAGGAAGCATAGGAAGGATGG + Intergenic
1165125029 19:33588373-33588395 ATGATTAACCTTAGTGAAGAAGG + Intergenic
1165985396 19:39764425-39764447 ATGATTATTCATAAGGAGGTGGG + Intergenic
1166392255 19:42415365-42415387 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1166557696 19:43712246-43712268 ATGATTAAGCTCAGTGAAGAAGG - Intergenic
1166580164 19:43890049-43890071 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1167626850 19:50596063-50596085 ATGATTAAGTTCAGTGAGGAAGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168652847 19:58103774-58103796 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1202634473 1_KI270706v1_random:31956-31978 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1202651407 1_KI270707v1_random:8089-8111 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1202660717 1_KI270708v1_random:67627-67649 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
924989673 2:301832-301854 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925153024 2:1629034-1629056 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
925168568 2:1736247-1736269 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925200452 2:1964010-1964032 ATGCTTAAGCTTAGAGAGGAAGG - Intronic
925215522 2:2092153-2092175 ATGATTAAGCTTAGTAAGGAAGG - Intronic
925234616 2:2267018-2267040 GTGCTTCAGCACAGGGAGGATGG + Intronic
925360062 2:3272390-3272412 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925854074 2:8112661-8112683 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925871424 2:8274831-8274853 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
925954294 2:8946963-8946985 ATGATTAAGCTTAGTGACGATGG + Intronic
926031947 2:9598900-9598922 ATAATTAAACTTAGTGAGGAAGG + Intronic
926387956 2:12356475-12356497 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
926449997 2:12991360-12991382 ATGATTAAGCTTGGTGAGGTAGG + Intergenic
926493531 2:13555426-13555448 ATGATTAAGCTTACTGAGGAAGG - Intergenic
926608410 2:14921031-14921053 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
926649441 2:15325843-15325865 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926818525 2:16826612-16826634 ATGATTAAGATTAGTGAGGAAGG - Intergenic
926822800 2:16871659-16871681 ATGATTAAGGAAAGGGAGAGAGG + Intergenic
926895361 2:17681457-17681479 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926979154 2:18548720-18548742 ACTATTAAGCTTAGTGAGGAAGG + Intergenic
927324609 2:21789783-21789805 ATGATTACGCTTAGTGAGAAAGG - Intergenic
927396413 2:22656104-22656126 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
927616694 2:24604876-24604898 ATGATTAAGCTTAGAGAAAAAGG - Intronic
927657325 2:24960486-24960508 ATGATTAAGCTTAGTGAGGAAGG + Intronic
927755335 2:25704062-25704084 GTGATTAAGCTTAGCAAGGAAGG + Intergenic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928227189 2:29460851-29460873 ATGATTAAGCTTGGTAAGGAAGG + Intronic
928450135 2:31371266-31371288 AGGATTAAGCATTTGGAAGATGG - Intronic
928586672 2:32766132-32766154 ATGATTAAGTTTAGTGAGAAAGG - Intronic
928631240 2:33194315-33194337 ATGATTAACCTTAGTGAGGAGGG + Intronic
928657248 2:33465047-33465069 ATGATAAAGCCTAGTGAGGAAGG + Intronic
928716243 2:34063969-34063991 ATAATTAATCTTAGTGAGGAAGG - Intergenic
928720087 2:34110445-34110467 ACGATTAAGCTTAGTGAGAAAGG + Intergenic
928852088 2:35760402-35760424 ATGATTATGCTTAGTGAAGAAGG + Intergenic
929024417 2:37585838-37585860 ATGATTGAGCATGGGGAGAGGGG - Intergenic
929097471 2:38277712-38277734 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
929338144 2:40777557-40777579 ATGATTAAGCTTTGTGAAGAAGG - Intergenic
929375097 2:41276098-41276120 ATAATTAAGATTAGTGAGGAAGG - Intergenic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
930471712 2:51824138-51824160 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
930492016 2:52086069-52086091 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
930559236 2:52939502-52939524 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
930667967 2:54118083-54118105 ATGATTGTGCAAAGGGAGGTAGG + Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930948710 2:57110275-57110297 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
931013685 2:57949724-57949746 ATGATTAAGCTTAATGAGGAAGG + Intronic
931022356 2:58062438-58062460 ATAATTAAGCTTAGTGAGGAAGG + Intronic
931050713 2:58411393-58411415 ATGATTAAGATTAGTGAGGAAGG + Intergenic
931683880 2:64776324-64776346 ATGAATAAACTTAGTGAGGAAGG - Intergenic
931799296 2:65742832-65742854 AGGAGTAAGAATATGGAGGAGGG + Intergenic
931960981 2:67482591-67482613 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
932033339 2:68213252-68213274 ATGATGAAGCTTATTGAGGAAGG - Intronic
932052579 2:68413658-68413680 ATGATTACTCTTAGTGAGGAAGG + Intergenic
932186096 2:69697598-69697620 ATGATTAAGCTTAGTAAGCAAGG - Intronic
932469932 2:71948121-71948143 ATGATCAAGATTAGTGAGGAAGG - Intergenic
932803999 2:74767517-74767539 ATGAGTAAGTATTGGGAGTAGGG - Intergenic
933075963 2:77927021-77927043 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933171010 2:79125167-79125189 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
933280322 2:80325835-80325857 ATGATAAATGCTAGGGAGGATGG - Intronic
933328380 2:80867116-80867138 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
933387019 2:81623856-81623878 ACAATTAAGCTTAGTGAGGAAGG - Intergenic
933630131 2:84646435-84646457 ACGATTAAGCTTAGTGAGGAAGG + Intronic
933873604 2:86595532-86595554 ATGATTAAGATTAGTGAGGAAGG + Intronic
933896839 2:86818800-86818822 ATGATTAAGTTTAGTGAGGAAGG + Intronic
933906272 2:86896689-86896711 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
934061668 2:88299990-88300012 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
934548312 2:95237635-95237657 ATGATCAAGCTTAGTGAGGAAGG + Intronic
934715974 2:96543817-96543839 ATAATTAAACTTAGTGAGGAAGG + Intronic
935168894 2:100594466-100594488 ATGATTAAGCTTTGTGAGAAAGG - Intergenic
935228347 2:101074072-101074094 ATGATTAAGCTTAATGAGAAAGG - Intronic
935289090 2:101594130-101594152 ATGATGAAGCTTAGTCAGGAAGG - Intergenic
935460212 2:103322213-103322235 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
935608250 2:104992566-104992588 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
935776270 2:106475068-106475090 ATGATTAAGCTTCGTGAGGAAGG - Intergenic
935990371 2:108713740-108713762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
936257043 2:110925824-110925846 GTAATTAAGCCTAGTGAGGAAGG - Intronic
936365894 2:111854993-111855015 ATGATTAAGCTTAGTGAGGAAGG - Intronic
936409573 2:112244985-112245007 ATGATTAAGCTTAGTGAGGAAGG + Intronic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
937109973 2:119358148-119358170 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937174047 2:119908722-119908744 ATGATTAAGTTCAGTGAGGAAGG + Intronic
937461747 2:122094861-122094883 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
937678331 2:124616671-124616693 ATGATTAACCTTAATGAGGAAGG - Intronic
937767049 2:125673671-125673693 ATGATTAAACTTAGTGAGGAAGG + Intergenic
937818547 2:126281155-126281177 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
937979264 2:127604604-127604626 ATGATTAAGCTTCGTGAGGAAGG - Intronic
938396323 2:130951312-130951334 ATGATTCAGCTTAGTAAGGAAGG - Intronic
938562528 2:132486931-132486953 ATGATTAAGCTTAGTAAGAAAGG - Intronic
938621328 2:133057326-133057348 ATAATTAATCTTAGTGAGGAAGG + Intronic
938678628 2:133665261-133665283 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
938681961 2:133701291-133701313 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
938872002 2:135487974-135487996 ATGATCATGCTTAGTGAGGAAGG - Intronic
938946931 2:136221106-136221128 ATAATTAATATTAGGGAGGAAGG + Intergenic
938987215 2:136589015-136589037 ATGATTAAGCTTAATGAGGGAGG - Intergenic
939035545 2:137126751-137126773 ATGATTAAGCTTAGAAAGGAAGG - Intronic
939186015 2:138861590-138861612 GTGATGAAGCTTAGTGAGGAAGG - Intergenic
939285444 2:140123227-140123249 ATGATAAAGCTTAATGAGGAAGG - Intergenic
939308941 2:140447743-140447765 ATTATTAAGCTTAGTGAGAAAGG - Intronic
939437833 2:142201422-142201444 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
939509161 2:143085324-143085346 ATGACTAACCTTAGTGAGGAAGG + Intergenic
939556172 2:143676427-143676449 AGGATTGAGCTTAGTGAGGAAGG - Intronic
939653349 2:144791243-144791265 ATGTTTAAGCTTAGTGAGAAAGG - Intergenic
939663682 2:144922637-144922659 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
939704770 2:145439144-145439166 AAGATTAAGTTTAGTGAGGAAGG - Intergenic
939786912 2:146525972-146525994 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939817403 2:146912608-146912630 ATAATTAAGCTCAGTGAGGAAGG + Intergenic
940037452 2:149325760-149325782 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
940049357 2:149445931-149445953 ATGATTAAGACTGGTGAGGAAGG - Intronic
940126864 2:150335861-150335883 ATGATTAAACTTGGTGAGGAAGG + Intergenic
940184796 2:150972060-150972082 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
940356900 2:152753263-152753285 ATTCTTAGGAATAGGGAGGAAGG + Intronic
940495983 2:154429205-154429227 AAGATTAAGCTTAGTGAGGAAGG + Intronic
940537187 2:154960191-154960213 AAGATTAGGCTTAGTGAGGAAGG - Intergenic
941259995 2:163285720-163285742 ATAATTAAGATTAGTGAGGAAGG - Intergenic
941371302 2:164668283-164668305 ATGATCAAGTTTAGTGAGGAAGG - Intronic
941386200 2:164855568-164855590 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
941503740 2:166313815-166313837 ATGATTAAGCTTAGTGAGGAAGG - Intronic
941733036 2:168940173-168940195 ATGACTAAGCTCAGTGAGGAAGG + Intronic
941941717 2:171046052-171046074 ATGATTAAGACCAGGAAGGAAGG - Intronic
941974583 2:171389113-171389135 AAGATTAAGCTTAGTGAGGAAGG + Intronic
942177866 2:173352219-173352241 ATGATTACACTTAGTGAGGAAGG - Intergenic
942258955 2:174138181-174138203 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942614861 2:177781040-177781062 ATGATTAAGCTTAGTGAGAAAGG - Intronic
942747804 2:179255251-179255273 ATGATTAAGCTTACTCAGGAAGG + Intronic
942833175 2:180261316-180261338 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
942876875 2:180811065-180811087 ATGATCATGCTTAGTGAGGAAGG + Intergenic
942999302 2:182304527-182304549 ATGATTAAGTTTAACGAGGAAGG - Intronic
943034503 2:182725361-182725383 ATGATTAAGCTTAGTGAGGGAGG + Intronic
943087416 2:183329390-183329412 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943123423 2:183766555-183766577 ATGACTAAGCTTAGTGAGAAAGG - Intergenic
943169218 2:184374556-184374578 ATTATTAATCTTAGTGAGGAAGG + Intergenic
943213371 2:184998684-184998706 ATGACTAAGCTTAGTGAAGAAGG - Intergenic
943251687 2:185529636-185529658 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
943330888 2:186557855-186557877 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
943420828 2:187667175-187667197 ATTATCAAGCTTAGTGAGGAAGG + Intergenic
943616545 2:190099225-190099247 ATGATCAAGCTTAGTGAGGAAGG - Intronic
943723341 2:191228246-191228268 ATGATAAAGGGTGGGGAGGAGGG - Intergenic
943740815 2:191406427-191406449 ATGATTAAGCTTAGTGAGGAAGG - Intronic
943935468 2:193909797-193909819 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943940941 2:193995503-193995525 ATGATTAAGTTTAGTCAGGAAGG + Intergenic
943957341 2:194209081-194209103 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
943985793 2:194616459-194616481 ATGATTAAGCTTAGTGAAGCAGG - Intergenic
944025851 2:195166485-195166507 ATGATTAAACCTAGTGAGGAAGG + Intergenic
944138210 2:196424407-196424429 GTGATTAAACTTAGAGAGGAAGG + Intronic
944273967 2:197814613-197814635 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944338510 2:198566474-198566496 ACAATTAAGCTTAGTGAGGAAGG + Intronic
944449272 2:199824559-199824581 ATGATTAAACTTAGTGAAGAAGG - Intronic
944529589 2:200654144-200654166 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944623147 2:201539839-201539861 ATGATTAAGCTTACTGAGGAAGG + Intronic
944720015 2:202414474-202414496 ATGATTAGGCTTAGGGAAGAAGG + Intronic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
945646803 2:212506383-212506405 ATGATTAAGTTTAGCAAGGAAGG + Intronic
945690911 2:213034396-213034418 ATGATGAGGCTTAGTGAGGAAGG - Intronic
945772208 2:214058198-214058220 ATGATTAAGCTGGAGGAGGAAGG - Intronic
946524236 2:220500853-220500875 ATGGTTAAGCCTAGTGAGGAAGG + Intergenic
946713580 2:222530835-222530857 ATGATTAACCTTAGTGAGGAAGG - Intronic
946853169 2:223927769-223927791 ATGATTAAGCTTAGTGAGGAAGG - Intronic
947020709 2:225672651-225672673 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
947035472 2:225849095-225849117 ATGATTAAGCTAAGTGAGCAAGG - Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947786322 2:232824256-232824278 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948418406 2:237835390-237835412 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1169032815 20:2424756-2424778 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1169432717 20:5553494-5553516 ATGATTAAGATTAGTGAGGAAGG + Intronic
1169485212 20:6024626-6024648 ATTATTAAGCTTAGTGAGGAGGG + Intronic
1169548945 20:6681486-6681508 ATGAATAAGCAAAGAGAGAAAGG - Intergenic
1169653903 20:7900797-7900819 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1170174327 20:13451842-13451864 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1170280577 20:14642492-14642514 ATAATTAAGCCTAGTGAGAAAGG - Intronic
1170397148 20:15938734-15938756 ATGTTTAAGCTTAATGAGGAAGG + Intronic
1170659284 20:18320758-18320780 AAGATTAATCAGTGGGAGGAGGG + Intergenic
1171108655 20:22459996-22460018 TTGATTAAGCATAGGAAGTATGG + Intergenic
1171146001 20:22783211-22783233 ATAATTGAGCTTAGTGAGGAAGG + Intergenic
1173381433 20:42546624-42546646 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1173483835 20:43425602-43425624 ATGATTAAGCAAAGACAGCAAGG + Intergenic
1173707350 20:45121586-45121608 ATGATTAACCTTAGTGAGGAAGG - Intergenic
1173766790 20:45618465-45618487 ATAATTAATCTTAGTGAGGAAGG - Intronic
1173772514 20:45674527-45674549 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1173882641 20:46428547-46428569 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1173942058 20:46919809-46919831 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1174025696 20:47572501-47572523 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1174253077 20:49233877-49233899 GCGATAAAGCAAAGGGAGGAAGG - Intronic
1174650553 20:52121247-52121269 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1174692522 20:52521750-52521772 ATGATGATGCTTAGTGAGGAAGG - Intergenic
1175025563 20:55898856-55898878 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1175088363 20:56480608-56480630 ATGATTAAGCTTAGGGAGGAAGG - Intronic
1175167960 20:57059433-57059455 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1175250399 20:57606035-57606057 ATGATTAAGCTTGGTGAGGGAGG + Intronic
1176627274 21:9103380-9103402 ATAATTAAGCTTAGTGATGAAGG + Intergenic
1176646694 21:9357731-9357753 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1176726206 21:10435542-10435564 ATGATTAATCTTAGTGGGGAAGG - Intergenic
1176946058 21:14983126-14983148 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1177167608 21:17620177-17620199 ATGATTAAGTTTAGCGTGGATGG - Intergenic
1177391341 21:20477042-20477064 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
1177413731 21:20767768-20767790 ATTATAAAGCTTAGTGAGGAAGG - Intergenic
1177432853 21:21013143-21013165 ATAATTAAGTTTAGTGAGGAAGG + Intronic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1177512376 21:22105547-22105569 ATGATTAAGCTTGGCGAGGAAGG - Intergenic
1177869236 21:26550444-26550466 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1178070688 21:28962713-28962735 ATGATGAAGCTTAGCAAGGAAGG + Intronic
1178519425 21:33275741-33275763 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1178684410 21:34700040-34700062 TTGATAAAGCAAAGGGAAGATGG + Intronic
1178735634 21:35147451-35147473 ATGATTAATCATAGAGAGAGAGG + Intronic
1178967542 21:37136279-37136301 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1179360226 21:40699438-40699460 ATGATTAAACTTAGTGATGAAGG + Intronic
1179395443 21:41036005-41036027 ATGATTAAGGTTAGAGAGGAAGG - Intergenic
1179429171 21:41307543-41307565 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1179965133 21:44799821-44799843 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1180113340 21:45677093-45677115 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1180288165 22:10771569-10771591 ATGATTAATCTTAGTGGGGAAGG + Intergenic
1180328204 22:11451220-11451242 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1180366232 22:11941271-11941293 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180417622 22:12782989-12783011 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180887786 22:19259837-19259859 ATGATTAGGCTTTGTGAGGAAGG + Intronic
1180900099 22:19364813-19364835 ATGATTAAGCTTAAAGAGGAAGG + Intronic
1180932563 22:19603073-19603095 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1181043471 22:20203786-20203808 ATAATTGATCAGAGGGAGGAGGG + Intergenic
1181520305 22:23444681-23444703 ATAATTAAGTTTAGTGAGGAAGG - Intergenic
1181656538 22:24305310-24305332 ATGATTAAGCAGAGGCACGGTGG - Intronic
1181930617 22:26398170-26398192 ATGATTAAGCTTAGTGAAGTAGG - Intergenic
1182182135 22:28361181-28361203 ATGATTATGCTTAGTGAGGAAGG + Intronic
1182734675 22:32523750-32523772 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1183234041 22:36602997-36603019 ACAATTAAGCTTAGTGAGGAAGG + Intronic
1183612534 22:38919871-38919893 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681468 22:39332737-39332759 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681483 22:39332876-39332898 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1183757897 22:39787404-39787426 ACAATTAAGCTTAGTGAGGAAGG + Intronic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1185262132 22:49873217-49873239 ATGATTAAGCTTAGTGATGAAGG - Intronic
1185353761 22:50353235-50353257 ATGCTTAAGCTTAGTGAAGAAGG - Intronic
949270206 3:2207323-2207345 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949438346 3:4053046-4053068 ATGATTAAGCTTAGTGAGGAAGG - Intronic
949623218 3:5839349-5839371 ATGATTAAGCTTAGTGAAAAAGG - Intergenic
949626436 3:5871964-5871986 ATGATTAAGTTTAGTAAGGAAGG + Intergenic
949728713 3:7081620-7081642 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950112679 3:10429704-10429726 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950632436 3:14291728-14291750 ATGATTAAGCTTAGTGAGGGAGG + Intergenic
950700312 3:14740147-14740169 ATGATTAACCTTAGTGAGGAAGG - Intronic
950817891 3:15726236-15726258 ATGACTAAGCTTAGTGAGAAAGG + Intronic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
950983442 3:17333582-17333604 ATGCTTAAGCAGAGGGATAAGGG + Intronic
950988879 3:17409495-17409517 ATGATTAAGCTTAGTGAGGAAGG + Intronic
951306643 3:21071265-21071287 ATGATTCAGCTTAATGAGGAAGG + Intergenic
951333061 3:21388394-21388416 ATGATGAAGCTTAGTAAGGAAGG + Intergenic
951373324 3:21880693-21880715 ATGATTAAGCTTAATGAAGAAGG + Intronic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951748697 3:26009152-26009174 ATGAGAAAGCAAAGGAAGGAAGG - Intergenic
951851811 3:27149804-27149826 ATGATAAAGCTTAGTGAGGAAGG + Intronic
951862405 3:27267827-27267849 ATGATGAAGCTTAGTGAGAAAGG + Intronic
952003658 3:28815657-28815679 ATAATTAAGCTTAGAGAGGTAGG - Intergenic
952119420 3:30224176-30224198 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
952347970 3:32506259-32506281 ATGATTATTCATAAGGAGGTGGG + Intergenic
952365478 3:32671119-32671141 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
952635673 3:35527343-35527365 ATGATTAAACTTAATGAGGAAGG - Intergenic
952809980 3:37393243-37393265 ATGATTAAGCTTAGTGAGGAGGG + Intronic
952899916 3:38103639-38103661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953174454 3:40537165-40537187 ATGATTAAGCTTAGTGAGGAAGG + Exonic
953211855 3:40882881-40882903 ATAATTAAACTTAGTGAGGAAGG - Intergenic
953367232 3:42355545-42355567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953436052 3:42878291-42878313 ATGATTAAGCTTAGTGAGGAAGG + Intronic
953445731 3:42964111-42964133 ATGATTAAGCTTAGTGAAGATGG + Intronic
953483987 3:43277158-43277180 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953591973 3:44266431-44266453 ATGATTAAGCTTAGTGAGGAAGG - Intronic
954782413 3:53071458-53071480 AGGATCAGGCATAGCGAGGAGGG - Intronic
954854558 3:53632597-53632619 ATGATTAAGCTTAGTGAGGGAGG - Intronic
954944616 3:54409544-54409566 GTGATTAAGCTTAGTGAGGAAGG + Intronic
955211174 3:56942652-56942674 ATGATTAAGCTTAGTGAGGAAGG + Intronic
955373873 3:58377831-58377853 CTGATTAAGCAAATGTAGGAAGG + Intronic
955459738 3:59168733-59168755 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
955473329 3:59310019-59310041 ATGATTAAGAATATGAAGTATGG + Intergenic
955604101 3:60681504-60681526 ATGATTAAGCTTGGCGAGGAAGG + Intronic
955969825 3:64427216-64427238 ATGATTAAGCTTAGTGAAGAAGG + Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956163077 3:66374917-66374939 ATGATTAAATTTAGTGAGGAAGG + Intronic
956973926 3:74558248-74558270 AGGATTAAGAAGAGGGAGGAAGG - Intergenic
957093575 3:75756420-75756442 ATAATTAAGCTTAGTGAGGAAGG + Intronic
957400897 3:79712178-79712200 ATGATTAAGCTTGGTGAGGAAGG + Intronic
957499712 3:81038725-81038747 AAGATTAAGCTTAGTGAGGATGG - Intergenic
957518647 3:81289948-81289970 ACGATTAAGCTTAGTGAGAAAGG - Intergenic
957536757 3:81515620-81515642 ATGATTAAGCTTAGTGAGAAAGG + Intronic
957572920 3:81971171-81971193 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
957647742 3:82954851-82954873 ATGATTAAGCTTAGTAAGTAGGG - Intergenic
957707107 3:83803187-83803209 ATGATTAAGGTTAGTGAGAAAGG - Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
957955733 3:87184761-87184783 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
957996735 3:87699408-87699430 AGGATGAAGCTTAGTGAGGAAGG + Intergenic
958050983 3:88345862-88345884 ATGATTAAGTTTAGAGAGAAAGG + Intergenic
958091946 3:88887822-88887844 ATGATTCAGCTTAGTGAAGAAGG + Intergenic
958452128 3:94286560-94286582 ATGATTAAGGTTAGTGAGGAAGG + Intergenic
958492956 3:94801472-94801494 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958530066 3:95316883-95316905 ATGATTAAGCTTAGTGAGGACGG - Intergenic
958628643 3:96658898-96658920 CTTATTAAGCATTGGGTGGAGGG + Intergenic
958655516 3:96997386-96997408 ATGATTAAACTTAGTGAGGAAGG - Intronic
958661631 3:97076137-97076159 ATGATTAGGCTTAATGAGGAAGG + Intronic
958841165 3:99207282-99207304 ATGATTGAGAGTAGAGAGGAAGG + Intergenic
958933095 3:100228631-100228653 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959014333 3:101115701-101115723 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959109774 3:102108474-102108496 ATGATTAAGCTTAGTTAGAAAGG - Intronic
959390342 3:105764676-105764698 ATGATTAAGTTTAGTGAGAAAGG + Intronic
959413099 3:106049298-106049320 ATGATTAAGCTTAGTGAGGATGG + Intergenic
959546360 3:107601335-107601357 ATGATTAAGCTTATTGAGGAAGG + Intronic
959721681 3:109497875-109497897 ATGATTAAGCTTACTGAGGAAGG - Intergenic
959771616 3:110105746-110105768 ATGACTGAGCACAGGGAAGATGG - Intergenic
959773099 3:110123545-110123567 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
959784327 3:110276080-110276102 ATGATTAAGCTTAGCAAGGAAGG + Intergenic
959799971 3:110481564-110481586 ATATTTAAGCTTAGTGAGGAAGG + Intergenic
959821140 3:110736994-110737016 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
959888784 3:111531294-111531316 TTGTTTAGGCATTGGGAGGATGG + Intronic
959898511 3:111633047-111633069 ATAATTAAGCTTAGTGAGGAAGG - Intronic
959988389 3:112602412-112602434 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
960154599 3:114286038-114286060 ATGATTAAGCTTAGTGAAGAAGG - Intronic
960179829 3:114562639-114562661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960242243 3:115358744-115358766 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
960401535 3:117205484-117205506 ATGATTACACTTAGTGAGGAAGG + Intergenic
960549324 3:118956401-118956423 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960648068 3:119912049-119912071 ATGATTAAGCTGAGCAAGGAAGG - Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961411596 3:126726112-126726134 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961530136 3:127535659-127535681 ATGTTTGACCAAAGGGAGGAAGG - Intergenic
961613164 3:128156925-128156947 ATGATTAAGCTTAGTGATGAAGG + Intronic
962028931 3:131578534-131578556 ATGATTAAACTTAGTGAGGAAGG + Intronic
962157414 3:132962803-132962825 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
962711878 3:138094037-138094059 ATGATTAAGTTTAGTGATGAAGG - Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963081367 3:141397555-141397577 ATGATTAAGCTTCATGAGGAAGG - Intronic
963183823 3:142390783-142390805 ATGATTAAGCTTAGTGAAGAAGG - Intronic
963195240 3:142520369-142520391 ATGACTAAGCCTAGTGAAGAAGG + Intronic
963198636 3:142563728-142563750 ATGATTAAGCCTACTGAGGAAGG + Intronic
963243036 3:143029690-143029712 ATGATTAAGCTTAGTTAGGAAGG + Intronic
963283952 3:143414830-143414852 ATGATTAAGCTTAGCGAGGAAGG + Intronic
963293209 3:143514985-143515007 ATGATTAAGCTTAGTGAGGAAGG - Intronic
963472414 3:145757741-145757763 ATGTCTAAGGATAGGTAGGATGG + Intergenic
963507379 3:146203968-146203990 ATGATTTAGCTTAATGAGGAAGG - Intronic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
963608786 3:147439144-147439166 ATGATTAAGCTTAGCGAGGAAGG - Intronic
963746736 3:149131731-149131753 ATGATTAAGCTTAGTGAGGAAGG + Intronic
963773237 3:149411019-149411041 ATTATTAAGCTTAGTGACGAAGG - Intergenic
963946495 3:151151442-151151464 ATGATTAAGCTCAGCGAGGAAGG - Intronic
964146614 3:153471704-153471726 ATGATGAAGATTAGTGAGGAAGG - Intergenic
964398807 3:156276991-156277013 ATTATTAAGCTTAGTGAAGAAGG - Intronic
964439951 3:156697858-156697880 ATGATTAAGCTTAGTGGGGAAGG + Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
964575029 3:158156544-158156566 ATGATTAAGCTTTGCAAGGAAGG - Intronic
964599142 3:158475878-158475900 GTGACTAAGCTTAGTGAGGAAGG + Intronic
964823311 3:160797512-160797534 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964930148 3:162009613-162009635 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
964942183 3:162172201-162172223 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
965005406 3:163016449-163016471 ATGATTTAGCTTAGTGAAGAGGG + Intergenic
965224198 3:165966813-165966835 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
965255657 3:166406513-166406535 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
965276374 3:166688015-166688037 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
965424504 3:168505136-168505158 ATGATTAAGTTTAATGAGGAAGG - Intergenic
965438695 3:168685872-168685894 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
965595527 3:170406932-170406954 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
965782666 3:172304288-172304310 ATAATAGAGCAGAGGGAGGAAGG - Intronic
966006137 3:175014355-175014377 ATGATTAAGAATAGGGAGTAAGG - Intronic
966023985 3:175252623-175252645 ATGATTAAGCTTAGTAAGGAAGG + Intronic
966070330 3:175869612-175869634 ATGACTAAGCTTAGAGAGGAAGG + Intergenic
966098198 3:176231687-176231709 ATGATTACGCTTATTGAGGAAGG - Intergenic
966106114 3:176335930-176335952 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
966116309 3:176467477-176467499 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
966214310 3:177486262-177486284 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
966282562 3:178249629-178249651 ATGATTACGCTTAGTGAGGAAGG - Intergenic
966644707 3:182231522-182231544 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
966717412 3:183027371-183027393 ATGATTAAGTTTAGTGAGGAAGG + Intronic
966750855 3:183320833-183320855 ACGATTAAGCTTAATGAGGAAGG - Intronic
966814057 3:183874689-183874711 ATAATTAAGCTTAGTGAAGAAGG + Intronic
967237657 3:187402713-187402735 ATGATGGTGCATAGGGAGGATGG - Intergenic
967259727 3:187630285-187630307 ATGATTCAGCATAGGGAATATGG + Intergenic
967325816 3:188238454-188238476 ATGGTTAAGTTTAGTGAGGAAGG - Intronic
967491864 3:190101281-190101303 ATGATTAAGTTTACTGAGGAAGG + Intronic
967661459 3:192115587-192115609 ATAACTAAGCTTAGTGAGGAAGG - Intergenic
967710772 3:192705216-192705238 ATGATTAAACTTAGTGAGGAAGG - Intronic
967766572 3:193286800-193286822 ATGGGTAAGCTTAGTGAGGAAGG + Intronic
968153616 3:196359474-196359496 ATGATGAAGCTTAGTGAGAAAGG + Intronic
968154029 3:196363497-196363519 ATGATTAAGCTTAGTGAGAAAGG + Intronic
969152736 4:5184146-5184168 ATAATTAAGCTTAGTGAGGAAGG - Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
970332045 4:14996609-14996631 ATAATTAGGCTTAGTGAGGAAGG + Intergenic
970390392 4:15604176-15604198 ATGATTAGGCTTAGTGAGCAAGG - Intergenic
970479211 4:16456676-16456698 ATGATTTAGCTCAGTGAGGAAGG - Intergenic
970528797 4:16960865-16960887 ATGATCAAGCTTAGTGAGGAAGG + Intergenic
970538138 4:17050899-17050921 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
970578815 4:17454338-17454360 ATGATTAAGCTTAGGGAAGAAGG + Intergenic
970605369 4:17676102-17676124 ATGATTAAGCGTAGCAAGGAAGG - Intronic
970751031 4:19361680-19361702 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
971071179 4:23093987-23094009 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
971295447 4:25385715-25385737 ATGATTAGGCTTAGAGAGGAAGG - Intronic
971441282 4:26689912-26689934 ATGATTATGCCTAGTGAGGACGG + Intronic
971609719 4:28707632-28707654 ATGATTAGGCTTAATGAGGAAGG + Intergenic
971679890 4:29684160-29684182 ATGATTACACTTAGTGAGGAAGG + Intergenic
971881291 4:32377191-32377213 ATAATTAAACTTAGTGAGGATGG - Intergenic
971921308 4:32943201-32943223 ATGTTTAAGCTTAATGAGGAAGG + Intergenic
972099418 4:35394306-35394328 ATGATTAAACATAGTGAGGAAGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972203380 4:36742378-36742400 AGGATTGAGGATAGGGAGAAAGG - Intergenic
972451697 4:39206590-39206612 TAGATTGATCATAGGGAGGAAGG + Intronic
972615365 4:40693078-40693100 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
972776233 4:42243553-42243575 ATAATTAGGCTTAGTGAGGAAGG + Intergenic
972952353 4:44343151-44343173 ATGATTAAACATACTGAGGTAGG - Intronic
972954669 4:44374588-44374610 ATGATTAGGATTAGTGAGGAAGG - Intronic
973000714 4:44945769-44945791 ATTATTAAGCTTAGTAAGGAAGG + Intergenic
973128182 4:46615048-46615070 ATGATCAAGCATGGTGAGGAAGG + Intergenic
973165169 4:47068428-47068450 ATGATTAAGCTTAGCCAGGAAGG - Intronic
973223944 4:47761241-47761263 ATGATTAAGTTTAGTGAGGAAGG - Intronic
973364174 4:49194304-49194326 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
973396909 4:49602439-49602461 ATAATTAAGGTTAGTGAGGAAGG + Intergenic
973901215 4:55474051-55474073 GTGATTAAGCTTAGTGAGGAAGG + Intronic
974212089 4:58791251-58791273 ATGATTAAACTTAGTGAAGAAGG + Intergenic
974336900 4:60559690-60559712 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
974397044 4:61350963-61350985 ATGATTAAGCTTAGTGAGGAAGG + Intronic
974412867 4:61564699-61564721 ATGATTAGGTTTAGTGAGGAAGG - Intronic
974448725 4:62022001-62022023 ACCATTAAGCTTAGTGAGGAAGG + Intronic
974564118 4:63561895-63561917 ATAATTAAGCTTATCGAGGAAGG + Intergenic
974613331 4:64245951-64245973 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
974670901 4:65028576-65028598 AAGATTTAGCATAGGAAGGCTGG + Intergenic
974816931 4:67017106-67017128 ATGATTAAGCTAAGTGAGAAAGG - Intergenic
974859300 4:67499793-67499815 ATGATTAAGCTTAGTGAGGAAGG - Intronic
975169698 4:71219138-71219160 ATGATTAAGCTTAGTGAGGAAGG + Intronic
975240727 4:72055613-72055635 ATAATTAAGCTTAGTGAGGAAGG + Intronic
975475506 4:74818813-74818835 ATGATTAAGTTTACTGAGGAAGG - Intergenic
975501451 4:75090044-75090066 GTGATTAAGCTTAGTGAAGAAGG + Intergenic
975900366 4:79144513-79144535 ATTACTAAGCTTAGTGAGGAAGG - Intergenic
975940680 4:79641619-79641641 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
976058529 4:81098506-81098528 ATTATTAAGCTTAGTGAAGAAGG - Intronic
976154481 4:82127830-82127852 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
976415339 4:84767477-84767499 ATGATTAAGTTCAGAGAGGAAGG + Intronic
976468512 4:85399509-85399531 ATGACTAAGCTTAGTGAGAAAGG + Intergenic
976991563 4:91373734-91373756 ATTATTAAGCTTAGTGAAGAAGG + Intronic
977056364 4:92197866-92197888 ATAATTAAGCAAAGAGAGAATGG - Intergenic
977194434 4:94042029-94042051 ATGATTTAGCTTAGTGAGGAAGG - Intergenic
977289766 4:95151781-95151803 ATGATTTAGGATAGGGAGGAGGG + Intronic
977351266 4:95890783-95890805 ATGATTAAAAATAGTGATGATGG - Intergenic
977356039 4:95948089-95948111 ATGATTAAGCTTAATGAGGAAGG - Intergenic
977568063 4:98601808-98601830 ATGATTAAGCTTAGTGAGGAAGG - Intronic
977715102 4:100173382-100173404 ATAATTAAGCTTAGTGAAGAAGG - Intergenic
977852863 4:101851054-101851076 ATAATTAAGCTTAGTGAGAAAGG + Intronic
977887121 4:102265141-102265163 ATGATTAGGCTTAGTGAGGAGGG - Intronic
977915753 4:102590826-102590848 ATGATTAAGCTTAGTGAGGAAGG + Intronic
977981246 4:103325088-103325110 ATTATTAAGCTTAGAGGGGAAGG - Intergenic
977999275 4:103537222-103537244 ATGGTTAATGATAGGGATGAGGG - Intergenic
978083056 4:104618073-104618095 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
978102771 4:104863278-104863300 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
978204160 4:106059749-106059771 AAGATTAAGATTAGTGAGGAAGG + Intronic
978212110 4:106149365-106149387 ATGATTAAGCTTAGTGAGGAAGG - Intronic
978260520 4:106752086-106752108 ATAATTAAGCTTAGTGAAGAAGG - Intergenic
978275394 4:106943063-106943085 ATGATGAAGTAAATGGAGGAAGG - Intronic
978286887 4:107089496-107089518 ATGATTAAGCTTACTGAGAAAGG + Intronic
978304132 4:107303663-107303685 ATGATTAAACTTAGTGAGGAAGG - Intergenic
978523518 4:109640910-109640932 ATAATTAAGCTTAGTGAGGAAGG - Intronic
979123685 4:116937573-116937595 ATGATTATGCTTAGTGAGGAAGG - Intergenic
979190073 4:117845944-117845966 ATGATTAAATTTAGTGAGGAAGG + Intergenic
979198031 4:117942982-117943004 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
979282762 4:118885861-118885883 ATGATTAAGAATAGGTATTAGGG + Intronic
979314018 4:119238211-119238233 ATGACTAAGCTTGGTGAGGAAGG - Intronic
979345622 4:119583584-119583606 ATGAATAAGCTTAGTGAGGAAGG - Intronic
979625978 4:122845957-122845979 ATGATTAAGCCTAGTGGAGAAGG - Intronic
979667610 4:123329485-123329507 ATGATTAAGCTTCACGAGGAAGG + Intergenic
979694902 4:123602250-123602272 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
979729430 4:124006246-124006268 ATGGTTAAGCTTGGTGAGGAAGG - Intergenic
979744453 4:124193915-124193937 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
979759483 4:124383399-124383421 ATGATTAAGTTTAGTGAAGAAGG - Intergenic
979843110 4:125470923-125470945 ATGAATAAGCTTAGTGACGAAGG - Intronic
979918839 4:126473888-126473910 CTGATTATGGATAGGGAGGGAGG + Intergenic
979973836 4:127171013-127171035 ATAATTAAGCTTAGTGAAGAAGG + Intergenic
980187855 4:129484696-129484718 ATGATTAACCTTGGTGAGGAAGG - Intergenic
980221331 4:129919783-129919805 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
980436471 4:132782026-132782048 ATCATTAATCTTAGCGAGGATGG - Intergenic
980546601 4:134271463-134271485 ATAATTAAGCTTAGTGAGTAAGG + Intergenic
980549702 4:134318622-134318644 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
980594765 4:134939386-134939408 ATGATTAAGTTTAGTGAAGAAGG + Intergenic
980635678 4:135498791-135498813 ATGATTAAACCTGGTGAGGAAGG - Intergenic
980719651 4:136678230-136678252 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
981191381 4:141868837-141868859 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981391918 4:144200967-144200989 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
981439338 4:144765306-144765328 AGGATTAAGCTTAATGAGGAAGG - Intergenic
981493028 4:145361326-145361348 ATGATTAAGCTTGGGGAAGAAGG + Intergenic
981575860 4:146204586-146204608 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
981806633 4:148723598-148723620 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
981898401 4:149832852-149832874 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
982021731 4:151211487-151211509 ATGGTTAAGTTTAGTGAGGAAGG + Intronic
982152783 4:152480532-152480554 ATAATTAAGCTTAGTGAGGAAGG + Intronic
982156809 4:152531462-152531484 AGGATTAAGGATTGTGAGGAAGG - Intronic
982169956 4:152651821-152651843 ATGATTAAGCCTTGTGAGGAAGG - Intronic
982300442 4:153873197-153873219 AGGATAAAGCCTAGTGAGGAAGG + Intergenic
982344624 4:154343894-154343916 ATGATTAAGCATAGTGACGAAGG - Intronic
982520641 4:156412495-156412517 ATGATTAAGCTTACTGAGGAAGG - Intergenic
982575713 4:157107310-157107332 ATGATTAAGCTTAATGAGGAAGG + Intronic
982681710 4:158438914-158438936 ATGATCAAGTTTAGTGAGGAAGG + Intronic
982697098 4:158614843-158614865 ATGATTAAACATAGTAAGGAAGG - Intronic
982842030 4:160201090-160201112 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
983086680 4:163453792-163453814 ATAATTAAGATTAGTGAGGAAGG - Intergenic
983124664 4:163935934-163935956 ATAATTAAGCTTAGTGAGGAAGG - Intronic
983154790 4:164333748-164333770 ATGATTAAACTTAGTGAGAAAGG + Intronic
983333129 4:166357188-166357210 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
983652787 4:170050353-170050375 ATAATTAAGCTTAGTGAGAAAGG - Intergenic
983658473 4:170107449-170107471 ATGATTCAGCTTAGTGAGGAGGG - Intergenic
983758207 4:171369138-171369160 ATGGTTAAGTGTAGTGAGGAAGG + Intergenic
983963260 4:173779541-173779563 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
984038580 4:174700580-174700602 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
984246802 4:177284557-177284579 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
984258590 4:177416871-177416893 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984299378 4:177895348-177895370 ATGATTAAGCTTAGTGATGATGG + Intronic
984326241 4:178255219-178255241 ATGATTAATCTTAGTGAGGAAGG - Intergenic
984438975 4:179741474-179741496 AGGATTAAGCCTAGGGAGAAAGG + Intergenic
984545117 4:181092338-181092360 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984637123 4:182123374-182123396 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984685571 4:182664554-182664576 ATGATTAAGCTTAGTGGGGAAGG + Intronic
984822970 4:183899336-183899358 ATGATTAGGCTTTGCGAGGAAGG + Intronic
984899122 4:184569044-184569066 ATGATTAGGCTTAATGAGGAAGG - Intergenic
984971737 4:185197803-185197825 ATGATTAAGCTTAGTGAGGAAGG + Intronic
985088089 4:186334972-186334994 ATAATTAAGCTTACTGAGGACGG + Intergenic
985188324 4:187342913-187342935 ATGATTAAGCTTAATGAGGAGGG - Intergenic
985311092 4:188600293-188600315 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985345886 4:189003599-189003621 ATTGTTAAGCTTAGTGAGGAAGG + Intergenic
985430261 4:189872412-189872434 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1202761489 4_GL000008v2_random:115431-115453 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
985481732 5:116048-116070 ATGATTAAGCTTTGTGAGAAAGG - Intergenic
985487117 5:158158-158180 AGGATAGAGCAGAGGGAGGAGGG - Intronic
985732785 5:1559200-1559222 ATGATTCAGCTTAGCAAGGAAGG - Intergenic
985900453 5:2785106-2785128 ATGATTAAGCTGAGCAAGGAAGG + Intergenic
986408418 5:7450157-7450179 ATGATTAAGCTTAGTGAGGAAGG + Intronic
986506162 5:8454252-8454274 ATGATTAAGCTTCGCAAGGAAGG + Intergenic
986682176 5:10243956-10243978 ATTATTAAGCTTAGTGAAGAAGG - Intronic
986752824 5:10804864-10804886 ATGATTACGCTTAGTGAGGAAGG + Intergenic
986776456 5:11018440-11018462 ATGATTAAGCTTAGCGAGGAAGG + Intronic
986928528 5:12790198-12790220 ATGATTGAGCTTATTGAGGAAGG - Intergenic
986941593 5:12957274-12957296 ATGATTAAGCTTATTGAGAAAGG + Intergenic
987058651 5:14220490-14220512 ATGATTAAACCTAGTGAAGAAGG + Intronic
987454719 5:18129394-18129416 ATGATTAAGCTTGGTGAGGACGG - Intergenic
987529393 5:19097773-19097795 ATGATTAAGCTTCATGAGGAAGG + Intergenic
987655828 5:20804730-20804752 ATTATTCAGCTTAGTGAGGAAGG + Intergenic
987665331 5:20931143-20931165 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
987668845 5:20982464-20982486 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
987726675 5:21709547-21709569 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
987731969 5:21785403-21785425 ATGATTAAGCTCAGTGAAGAAGG + Intronic
987741370 5:21913157-21913179 ATGATTCATCTTAGGGAAGATGG + Intronic
987791261 5:22571297-22571319 ATGATTAAGCTTAGTGAGGAAGG - Intronic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
987851061 5:23355137-23355159 ATGTTTAAGCTTACTGAGGAGGG + Intergenic
987935522 5:24458932-24458954 ATAATTAAGCTTAAAGAGGAAGG - Intergenic
987978088 5:25042294-25042316 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
988330354 5:29830136-29830158 ATGATTAAGATTAGTGAGAATGG - Intergenic
988431662 5:31126012-31126034 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
988655539 5:33207453-33207475 ATGATTAAGCTTTATGAGGAAGG + Intergenic
988757365 5:34271041-34271063 ATAATTAAGCTCAGTGAGGAAGG + Intergenic
988767726 5:34399177-34399199 ATTATTCAGCTTAGTGAGGAAGG - Intergenic
989001071 5:36761364-36761386 ATGATTAAGCTTAGTGATGAAGG - Intergenic
989287808 5:39722525-39722547 ATGATTAAGCGTAGTGAGGAAGG - Intergenic
989303470 5:39922888-39922910 GTGATTAAGCTTAATGAGGAAGG - Intergenic
989324660 5:40178059-40178081 ATGATTAAGCTTATTGAGGAAGG - Intergenic
989532723 5:42526037-42526059 TTAATTAAGCTTAGTGAGGAAGG + Intronic
989654091 5:43725760-43725782 ATGATTAAGCTAAGTGAGGAAGG - Intergenic
989802286 5:45557985-45558007 ATGATTGAGCTTAGTGAGGAAGG + Intronic
990003013 5:50917097-50917119 ATAATTAAGCTTAGCAAGGAAGG - Intergenic
990112124 5:52339555-52339577 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
990481596 5:56216463-56216485 ATGATTAAGCTCAATGAGGAAGG + Intronic
990523161 5:56599372-56599394 ATGATTAAGCTTAGCGAGGAAGG - Intronic
990571894 5:57087324-57087346 ATGATTAAGCTTCGTGAAGAAGG + Intergenic
990697470 5:58436733-58436755 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
990835922 5:60019975-60019997 ATGATTAATCTTAGTGAGGAAGG - Intronic
990874605 5:60469969-60469991 ATGAATAAGCTTAGTGAGGAGGG + Intronic
990979404 5:61588354-61588376 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991188631 5:63841536-63841558 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991473797 5:66998697-66998719 AATATTAAGCAAAGGGAGAAAGG - Intronic
991651368 5:68858246-68858268 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
991729818 5:69574701-69574723 ATGATTGAGCTTAGTGAGGAAGG + Intronic
991806250 5:70429842-70429864 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
991865136 5:71053173-71053195 ATGATTGAGCTTAGTGAGGAAGG - Intronic
992216732 5:74532128-74532150 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
992271291 5:75065941-75065963 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
992426628 5:76664134-76664156 ATTATTAAGCTTAGTGAAGAAGG - Intronic
992462794 5:76977776-76977798 ATGATTAAGCTTAGTGAAGAAGG + Intronic
993082149 5:83314972-83314994 ATGATTAAGCTTAGTGAGGAAGG + Intronic
993124317 5:83813860-83813882 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993126368 5:83840902-83840924 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
993349601 5:86832330-86832352 ATGAGAAAGCTTAGTGAGGAAGG - Intergenic
993709383 5:91209107-91209129 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993805736 5:92406803-92406825 ATGATTAAGCTTAGTGAGGAGGG + Intergenic
993897851 5:93559559-93559581 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993906434 5:93629018-93629040 ATGATTAAGCTTAGTGAGGAAGG - Intronic
994253631 5:97566758-97566780 ATGATTAATCGTAGGTAGGAAGG + Intergenic
994431279 5:99664710-99664732 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
994807852 5:104475251-104475273 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
994851433 5:105058643-105058665 ATAATTAGGCTTAGTGAGGAAGG + Intergenic
994961071 5:106603490-106603512 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
994967141 5:106688595-106688617 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
994985109 5:106923045-106923067 ATTATTAAGGACAGGGAGTATGG + Intergenic
994996668 5:107072452-107072474 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
995001597 5:107137842-107137864 ATGATTAAGCTCAGTAAGGAAGG - Intergenic
995296172 5:110525183-110525205 TTGATTAAAAATAGTGAGGATGG - Intronic
995339562 5:111042593-111042615 ATGATTAAACTTAGTGAGGAAGG - Intergenic
995407483 5:111815664-111815686 ATGATTAAGGACATGGAAGATGG + Intronic
995431260 5:112080461-112080483 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
995505788 5:112859668-112859690 ATGATTAAGCTTAGTGAGGAAGG - Intronic
995658653 5:114455601-114455623 ATGATTAAGCTTAATGAGGAAGG + Intronic
995670073 5:114593210-114593232 ATGATTAAGCTTAAAGAGGAAGG - Intergenic
995802131 5:116008461-116008483 ATGATTAAGTTTAGTGAGGAAGG + Intronic
995886965 5:116906041-116906063 ATTACTAAGCTTAGTGAGGAAGG + Intergenic
995989635 5:118221722-118221744 ATAATTAAGTTTAGTGAGGAAGG - Intergenic
996045788 5:118872380-118872402 ATGATTAAGCTTATTGAGGAAGG - Intronic
996067329 5:119093647-119093669 ATGATTAAGTTTAGTGAGGAGGG + Intronic
996177937 5:120382171-120382193 ATTATTAAACTTAGTGAGGAAGG - Intergenic
996194493 5:120586856-120586878 ATGATTAAACTTAGTGAGGAGGG + Intronic
996464905 5:123788892-123788914 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
996482924 5:123995904-123995926 ATGATTACGCTTAGTGAGGAAGG - Intergenic
996512497 5:124332652-124332674 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996526369 5:124484445-124484467 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
996807432 5:127472483-127472505 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996841952 5:127856590-127856612 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
997703453 5:135923973-135923995 ATGATTAAGCTTGGTGATGAAGG - Intronic
998719211 5:144924493-144924515 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
998814531 5:145999481-145999503 ATGATTAATCTTAATGAGGAAGG - Intronic
998831447 5:146163788-146163810 ATGATTAAGCTTAGTGAGGAAGG - Intronic
998863720 5:146473045-146473067 ATGATTAAGCTTAGTAAGGAAGG + Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999551535 5:152692788-152692810 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
999575868 5:152976024-152976046 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
999801188 5:155038646-155038668 TTGATTATGCTTAGTGAGGAAGG - Intergenic
999835133 5:155362036-155362058 ATAATTAAGCTTAATGAGGAAGG - Intergenic
999856883 5:155604861-155604883 AGAATTAAGCTTAGTGAGGAAGG - Intergenic
999882630 5:155883368-155883390 ATGATTAAGCCTAGTGAGGAAGG - Intronic
999897116 5:156046841-156046863 ATGATTAAGCTTAGCAAGGAAGG + Intronic
999950184 5:156640985-156641007 AGGATTAAGCACAGGGAAGGTGG - Intronic
1000532318 5:162438527-162438549 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000542513 5:162557843-162557865 ATGATCAAGCTTAGTCAGGAAGG - Intergenic
1000622005 5:163496422-163496444 ATGATTAATCATAAGGGGGTGGG - Intergenic
1000657490 5:163898434-163898456 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1000821274 5:165987406-165987428 ATAATTGAGCTTAGTGAGGAAGG + Intergenic
1000863388 5:166483869-166483891 ATGATTAAGCTTAGCAAGGAAGG - Intergenic
1000886704 5:166755886-166755908 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
1001117777 5:168954099-168954121 ATGATCAAGCGTCGGGAGGAAGG + Intronic
1001373144 5:171227155-171227177 ATGATTAAGCTTAGCGAAGAAGG + Intronic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001655893 5:173349356-173349378 ATGATTAAGCTTAGTGAGGATGG + Intergenic
1002487130 5:179546833-179546855 ATGATTAAGCTTAATGAGGTAGG - Intergenic
1002822720 6:742056-742078 ATAATTAAGCTTATTGAGGAAGG - Intergenic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003404027 6:5813891-5813913 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1003706102 6:8532169-8532191 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1003822901 6:9919916-9919938 ATGATTAAACTTAGTGAGGAAGG + Intronic
1003830928 6:10010630-10010652 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1003996162 6:11541728-11541750 ATGATAAAGCTTAATGAGGAAGG - Intronic
1004053412 6:12110848-12110870 ATGATTAAGCTTACTGAAGAAGG - Intronic
1004125079 6:12865220-12865242 AGGACTAGGCAGAGGGAGGAAGG + Intronic
1004437483 6:15610518-15610540 ATAATCAAGCTTAGTGAGGAAGG + Intronic
1004550352 6:16640807-16640829 ATGATTAAGCTTAGCGAGGAAGG + Intronic
1004569299 6:16829971-16829993 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1004857189 6:19763256-19763278 ATGATTAGGCATAGTGAGGAAGG + Intergenic
1004922801 6:20392727-20392749 ATGATTAAGCCTAATGAGGAAGG - Intergenic
1004972303 6:20924017-20924039 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1004972340 6:20924371-20924393 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1005085393 6:22001229-22001251 ATGATGAAGCAAAGGGACCAAGG + Intergenic
1005246779 6:23895154-23895176 ATGTTTAAGCTTAGCAAGGAAGG + Intergenic
1005689901 6:28293951-28293973 GTGATTAAGTATAGTAAGGAAGG + Intronic
1005790749 6:29297167-29297189 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1005914203 6:30338295-30338317 ATGTTTAAGCTTAGTGAGAAAGG - Intronic
1006035856 6:31211515-31211537 ATGATTATTCATAAGGAGGTGGG - Intergenic
1006287181 6:33105542-33105564 GTCATTAAGCAGGGGGAGGATGG + Intergenic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006875684 6:37293684-37293706 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1006959639 6:37915428-37915450 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1007017754 6:38486397-38486419 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1007166963 6:39835608-39835630 ATGAACAAACATATGGAGGAAGG + Intronic
1007651021 6:43421859-43421881 ATGATCAAACTTAGTGAGGAAGG + Intergenic
1007863840 6:44945377-44945399 ATGATTAAGCTTAGTGAAGGAGG + Intronic
1007876810 6:45112530-45112552 CTGATTAAGAATAGAGGGGAAGG + Intronic
1008120761 6:47614274-47614296 ATGACTAAGCTCAGAGAGGAAGG - Intronic
1008255030 6:49287891-49287913 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1008299086 6:49812168-49812190 ATGAGTAAGCTTAGTGAGGAAGG - Intergenic
1008390766 6:50948761-50948783 ATGATTAATCTTAGCGAGGAAGG + Intergenic
1008622520 6:53285102-53285124 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1008805662 6:55424284-55424306 ATGATTATGCTTAGTAAGGAAGG - Intergenic
1008812556 6:55521847-55521869 ATGATTAAGTTTAGTGAGAAAGG + Intronic
1008831616 6:55770675-55770697 ATGATTACGCTTATTGAGGAAGG - Intronic
1008916853 6:56797420-56797442 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1009479361 6:64137453-64137475 ATGATCAAGCATCGTGAGGAAGG - Intronic
1009558937 6:65213843-65213865 ATAATTAAGCATGGTGAGGAAGG + Intronic
1009590035 6:65656306-65656328 ATGATTATGCTTAGTGAGGAAGG + Intronic
1009960790 6:70518026-70518048 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1009963313 6:70551275-70551297 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1010067423 6:71700643-71700665 ATAATTAAACTTAGTGAGGAGGG + Intergenic
1010608455 6:77921610-77921632 ATCATTAAGCTTAGTGAAGAAGG - Intronic
1010693120 6:78933967-78933989 ATGATTAAGCTTAGTGAAAAAGG - Intronic
1010724578 6:79318809-79318831 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1011019803 6:82799822-82799844 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1011069804 6:83367923-83367945 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1011115682 6:83888759-83888781 ACGATTAAGCTTAGTGAGGAAGG + Intronic
1011218048 6:85026236-85026258 ATGATTAAGCTTAGAGAGGAAGG + Intergenic
1011495146 6:87930147-87930169 ATGATTAAAGACAGGGAGGCAGG + Intergenic
1011856504 6:91699505-91699527 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1012012745 6:93810896-93810918 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1012109048 6:95203110-95203132 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1012284482 6:97372315-97372337 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1012287661 6:97412675-97412697 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1012340055 6:98109751-98109773 ATGGGTAAGCTTAGTGAGGAAGG - Intergenic
1012564906 6:100636575-100636597 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1012664116 6:101944053-101944075 ATGAGACAGCATTGGGAGGACGG - Intronic
1012702556 6:102479116-102479138 ATGATTAAGATTAGTGAAGAAGG - Intergenic
1012836712 6:104278780-104278802 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1012918455 6:105196387-105196409 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1012930969 6:105316149-105316171 ATTATTATGCTTAGTGAGGAAGG - Intronic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013088804 6:106880318-106880340 ATGATTATGCTTAGTGAGAAAGG - Intergenic
1013172661 6:107650856-107650878 GTGATTAAACTTAGTGAGGAAGG + Intronic
1013202834 6:107917505-107917527 ATGACTAAGCTTAGTGAAGAAGG + Intronic
1013261271 6:108445480-108445502 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1013266451 6:108504241-108504263 ATGATTATGCTTAGTGGGGAAGG - Intronic
1013347378 6:109274819-109274841 ATGATTAAGCTTAGCAAGGAAGG - Intergenic
1013381898 6:109581288-109581310 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1013493501 6:110674382-110674404 ATGATTGAGCTTACTGAGGAAGG + Intronic
1013569209 6:111403778-111403800 ATGATTAAGCTTACCAAGGAAGG + Intronic
1013922780 6:115428798-115428820 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1014262457 6:119235234-119235256 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1014319619 6:119910689-119910711 ATGATTAAGATTAGTGAAGAAGG + Intergenic
1014403667 6:121022474-121022496 ATGATTTGTCATAGGTAGGAAGG - Intergenic
1014590607 6:123263031-123263053 ATGATTAAGTTTAGTGAGAAAGG + Intronic
1014618019 6:123628179-123628201 ATAATTAAGCTTACTGAGGAAGG - Intronic
1014741413 6:125151748-125151770 ATGATTAAATTTAGTGAGGAAGG + Intronic
1014742426 6:125161482-125161504 ATGATTAAACTTAGCAAGGAAGG - Intronic
1014775157 6:125500368-125500390 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1014975539 6:127877407-127877429 ATGATTAAGCTTAGTGTGGAAGG - Intronic
1015009967 6:128333858-128333880 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015144858 6:129974170-129974192 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1015259586 6:131221023-131221045 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1015304196 6:131688402-131688424 ATGATTAAGCTTAATGAGGAAGG + Intronic
1015337035 6:132051178-132051200 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
1015640744 6:135328731-135328753 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1015939744 6:138436176-138436198 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016022656 6:139252413-139252435 ATGATTACGCATAGGGATTCAGG + Intronic
1016081618 6:139864153-139864175 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1016148468 6:140705941-140705963 ATGATTAAATTTAGAGAGGAAGG - Intergenic
1016220344 6:141661559-141661581 ACAATTAAGCTTAGTGAGGAAGG - Intergenic
1016490864 6:144600274-144600296 ATGATTAAGCTTAGCAAGGAAGG + Intronic
1016564117 6:145433274-145433296 ATTATTAAGTTTAGTGAGGAAGG - Intergenic
1016794079 6:148099152-148099174 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1016831369 6:148436572-148436594 AAGAGTAAGCATATGGAGAAAGG - Intronic
1016836398 6:148481476-148481498 ATGATTAAGCTTAGTGAGGAGGG - Intronic
1016848021 6:148588190-148588212 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016867409 6:148781118-148781140 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016903284 6:149123328-149123350 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016931573 6:149415879-149415901 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1016946185 6:149536360-149536382 ATGATTAAGCATAGTGAGAAAGG + Intronic
1017104150 6:150872320-150872342 ATAATTAAACTTAGTGAGGAGGG - Intronic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1017461017 6:154650499-154650521 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1017799585 6:157881495-157881517 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1018224173 6:161611787-161611809 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1018271439 6:162082644-162082666 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1018294764 6:162333776-162333798 ATGATAAAGCTCAGTGAGGAAGG + Intronic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018599228 6:165521402-165521424 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1018843619 6:167538163-167538185 ATGATTAAGCTTAGTGTGAAAGG - Intergenic
1018881393 6:167885358-167885380 TTGATTAAACATAGTGAGAAAGG - Intronic
1019035614 6:169054685-169054707 ATGACTCAGCTTAGTGAGGAAGG - Intergenic
1019061679 6:169261991-169262013 CTAATTAAGCTTAGTGAGGAAGG + Intergenic
1019629213 7:2037915-2037937 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1019821984 7:3251016-3251038 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1019895745 7:3981469-3981491 ATGATGAAGCTTAGTAAGGAAGG + Intronic
1020090893 7:5340087-5340109 ATGATTAAACTTAGTGAGGAAGG + Intronic
1020423824 7:8040998-8041020 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020571385 7:9867648-9867670 ATGATTAAACTTATTGAGGAAGG + Intergenic
1020596857 7:10217507-10217529 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1020664563 7:11023936-11023958 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020833349 7:13118595-13118617 ATGATTAAGCTTATCAAGGAAGG + Intergenic
1020859778 7:13477072-13477094 ATGATTAAGCTTAATGAGAAAGG - Intergenic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1021015585 7:15527158-15527180 ATGATTAAGCTTAAGAAGGAAGG + Intronic
1021132781 7:16931365-16931387 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1021267960 7:18548002-18548024 ATGATTAAGCTGAGTTAGGAAGG - Intronic
1021285361 7:18774897-18774919 ATGATTAAGCTTAGCGAAGAAGG - Intronic
1021678132 7:23101726-23101748 ATGACTATGCTTAGTGAGGAAGG + Intergenic
1021733032 7:23615575-23615597 ATGATTAAATTTAGTGAGGAAGG - Intronic
1021934091 7:25613186-25613208 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1022063269 7:26822981-26823003 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1022066720 7:26865935-26865957 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022144995 7:27528334-27528356 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022197171 7:28080517-28080539 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1022419929 7:30210723-30210745 ATGAGTCTGCATAGGGAGGAAGG + Intergenic
1022548879 7:31217504-31217526 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022917643 7:34975173-34975195 ATGATTAAACTTAGAGAAGAAGG + Intronic
1022951390 7:35341590-35341612 AAGGTTAAACTTAGGGAGGAAGG + Intergenic
1023026095 7:36051107-36051129 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1023032931 7:36106896-36106918 TAGATTAAGGATAGGGAGAAGGG + Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023253379 7:38289539-38289561 ATGATTAATCATTGGGTGGTTGG - Intergenic
1023711657 7:42999937-42999959 ATGGTTAAGCTTAGAAAGGAAGG - Intergenic
1023724380 7:43127077-43127099 ATGATCAAGCTTAGTGAGGACGG + Intronic
1023773233 7:43579144-43579166 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1024133320 7:46379623-46379645 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1024549327 7:50548301-50548323 ATGATTCAGCTGAGTGAGGAAGG + Intronic
1024786131 7:52910400-52910422 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1025017759 7:55453392-55453414 ATGATTAAGTCTAGTAAGGAAGG - Intronic
1025029168 7:55542492-55542514 ATGATTAAGAACAGGCAGGCTGG + Intronic
1025195928 7:56933396-56933418 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
1025676020 7:63643540-63643562 ATGATTAAGCTCAGCGAGGAAGG - Intergenic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026415349 7:70174018-70174040 ATGATTTAGCTTAGTAAGGAAGG + Intronic
1026489946 7:70854447-70854469 ATGATTCTGCTTAGTGAGGAAGG - Intergenic
1026507741 7:71000206-71000228 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027289735 7:76693075-76693097 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027294178 7:76750049-76750071 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027296223 7:76774293-76774315 ATGATTAAGCTTAGTGAGAGAGG - Intergenic
1027379256 7:77588202-77588224 ATGATTAAGCTTAGTAAAGAAGG - Intronic
1027490320 7:78815940-78815962 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1027512065 7:79095467-79095489 ATGATTAGGCTTAGTGAGGAAGG - Intronic
1027573458 7:79901769-79901791 ATGTTTAAGCTTAGTGAGAAAGG + Intergenic
1027623128 7:80517484-80517506 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1027631999 7:80618443-80618465 GTGATTAAACTTAGTGAGGAAGG + Intronic
1027782225 7:82534127-82534149 ATGATTTGGCATAGGCTGGATGG + Intergenic
1028064958 7:86372230-86372252 ATTACTAAGCTTAGTGAGGAAGG + Intergenic
1028210058 7:88062703-88062725 ACAATTAAGCTTAGTGAGGAAGG - Intronic
1028300110 7:89188514-89188536 ATTATTAAGCTTAGTCAGGAAGG + Intronic
1028344865 7:89767265-89767287 ATGATTAAGAATAATAAGGAAGG + Intergenic
1028408605 7:90503482-90503504 ATGATTAAACTTAGTGAGGAAGG - Intronic
1028578205 7:92377114-92377136 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1028660951 7:93274183-93274205 ATGATTAAGCTTAGTGAAGATGG + Intronic
1029619763 7:101682838-101682860 ATGTGTGAGCATAGGGATGATGG - Intergenic
1029674181 7:102055758-102055780 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1030022510 7:105289820-105289842 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1030038289 7:105426918-105426940 ATGATTAATCTTAGTGAGAAAGG - Intergenic
1030136859 7:106260629-106260651 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1030151097 7:106405956-106405978 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030387330 7:108880223-108880245 ATAATTAAGCTGAGTGAGGAAGG + Intergenic
1030426011 7:109379282-109379304 ATCATTAAGTTTAGTGAGGAAGG + Intergenic
1030491304 7:110238407-110238429 ATCATTAAGATTAGTGAGGAAGG + Intergenic
1030495010 7:110287935-110287957 GTGATTAAGCTTAGTGAGAAAGG - Intergenic
1030505104 7:110411751-110411773 ATAATTAAGCTTAGTAAGGAAGG - Intergenic
1030587688 7:111441273-111441295 ATTATTCAGCTTAGTGAGGAGGG - Intronic
1030789979 7:113712567-113712589 ATAATTAAGCAAAGAAAGGAGGG - Intergenic
1030992982 7:116323691-116323713 ATGATGAAGCTTAGTGAAGAAGG + Intronic
1031057336 7:117007119-117007141 ATGATTAAGCTTAATGACGAAGG + Intronic
1031062617 7:117069236-117069258 ATAATTCTGCAAAGGGAGGAAGG - Intronic
1031234635 7:119159074-119159096 ATGATTGAGCTTATTGAGGAAGG - Intergenic
1031281740 7:119811572-119811594 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1031588637 7:123563236-123563258 ACGATTAAGCTTAGTGAGGGAGG - Intergenic
1031735868 7:125360749-125360771 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1031815267 7:126426009-126426031 ATAATTAAACTTAGTGAGGAAGG - Intergenic
1032180868 7:129676344-129676366 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1032235501 7:130118640-130118662 TTGACTAAGCTTAGTGAGGAAGG - Intronic
1032374888 7:131403563-131403585 ATAATTAAACTTAGGGAGGAAGG - Intronic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032622360 7:133548959-133548981 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1032701616 7:134385326-134385348 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1032712963 7:134478202-134478224 ATGACTAAGCCTAGCAAGGAAGG - Intergenic
1032730366 7:134636195-134636217 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1032769025 7:135029745-135029767 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032778899 7:135146033-135146055 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032861774 7:135886600-135886622 ATGACTAAGCTTAGTGAGAAAGG + Intergenic
1032927800 7:136628908-136628930 ATGATCATGCTTAGCGAGGAGGG + Intergenic
1033080558 7:138293036-138293058 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1033107558 7:138542240-138542262 ATGAGTAAGCTTACTGAGGAAGG - Intronic
1033112484 7:138593558-138593580 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1033241608 7:139684392-139684414 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1033386496 7:140881663-140881685 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1033388440 7:140902509-140902531 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1033393870 7:140955627-140955649 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1033538948 7:142338462-142338484 CTGATTAAGCAAAGGGAGCCAGG + Intergenic
1034028181 7:147730730-147730752 ATCATTAAGCTTAGTGAAGAAGG + Intronic
1034134112 7:148749772-148749794 ATGATTAAGCCAAATGAGGAAGG + Intronic
1034611712 7:152376363-152376385 ATGATTAATCTTAGTGGGGAAGG + Intronic
1034743314 7:153498368-153498390 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034743319 7:153498424-153498446 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034790056 7:153959900-153959922 ATGATTATGCTGAGTGAGGAAGG - Intronic
1034873254 7:154702346-154702368 ATGAGTAAGCTTAATGAGGAAGG + Intronic
1035167096 7:156997939-156997961 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1036469129 8:9034761-9034783 ATGATTAATCTTAAAGAGGAAGG + Intronic
1036735688 8:11313507-11313529 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1037145908 8:15572629-15572651 ATGATTAAACTTAGTGAGGAAGG - Intronic
1037218530 8:16487801-16487823 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1037263390 8:17033175-17033197 ATGATTAAGCTTAATGAGGAAGG + Intronic
1037447676 8:18983459-18983481 ATGATTAAGCTTAGTGAGAAGGG - Intronic
1038025640 8:23587113-23587135 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1038056533 8:23863642-23863664 ATGAAGCAGCTTAGGGAGGAGGG + Intergenic
1038392884 8:27221412-27221434 ATAATTAAGCTTAGTGAAGAAGG - Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1039076781 8:33697621-33697643 ATGATTAGGCTTAGTAAGGAAGG - Intergenic
1039192316 8:34990628-34990650 ATGATTAAATTTAGTGAGGAAGG + Intergenic
1039221754 8:35339477-35339499 ATGATTTAGGATTGGAAGGAAGG + Intronic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039381980 8:37094005-37094027 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1039556198 8:38476980-38477002 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1039815185 8:41087409-41087431 ATGAGTAAGCCTAGTGAGAAAGG + Intergenic
1039983866 8:42431105-42431127 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1040033758 8:42849136-42849158 ATGATCAAGTGTAGTGAGGAAGG - Intergenic
1040068138 8:43165503-43165525 ATGATTAAACTTAGTGAGAAAGG + Intronic
1040425624 8:47282817-47282839 ATGATTAAGCTTAGGTAGGAAGG - Intronic
1040459808 8:47636460-47636482 GTGATTAAGCTTAGTGGGGAAGG + Intronic
1040774104 8:51018243-51018265 ATGATTACGCTTAATGAGGAAGG - Intergenic
1040833101 8:51699655-51699677 ATGATTATGCTTAGTGAGGAAGG - Intronic
1041372534 8:57177939-57177961 ATCATTAAGCTTGGTGAGGAAGG - Intergenic
1041404084 8:57478268-57478290 ATGATTAGGCTTAGTAAGGAAGG + Intergenic
1041475994 8:58266556-58266578 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
1041770037 8:61463447-61463469 ATGATTAAGCTTGGGGAGGAAGG - Intronic
1041822295 8:62050772-62050794 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1042045525 8:64646988-64647010 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042099975 8:65265186-65265208 ATAATTAAGCTTATTGAGGACGG - Intergenic
1042299441 8:67260737-67260759 ATAATTGAGCTTAGTGAGGAAGG + Intronic
1042419401 8:68567885-68567907 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1042441010 8:68826609-68826631 ATGATTAAGCTCGGTGAGGAAGG - Intergenic
1042548029 8:69968219-69968241 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1042785813 8:72545721-72545743 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1042795464 8:72658108-72658130 ATGATTAAGCTTAGTAAGAAAGG + Intronic
1042851768 8:73223880-73223902 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1042882397 8:73508216-73508238 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043099024 8:76016341-76016363 ATGATTAAGCTGAGTGATGAAGG + Intergenic
1043275732 8:78389878-78389900 ATGATTAGGTTTAGTGAGGAAGG + Intergenic
1043338871 8:79212470-79212492 ATGATTAGGCACAGGAATGATGG + Intergenic
1043420832 8:80096924-80096946 ATGATTAAGCTTAGCGAGAAAGG + Intronic
1043862736 8:85339607-85339629 ATGATTAAGCTCAGTGAAGAAGG + Intronic
1044044121 8:87409075-87409097 ATGATTAAGCTTAATGAGGAAGG + Intronic
1044089770 8:87984839-87984861 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1044259600 8:90102172-90102194 ATGGGTAAGCCTAGTGAGGAAGG - Intergenic
1044287861 8:90430489-90430511 ATGATGAAGCTTAGAGAGAAAGG + Intergenic
1044431520 8:92113089-92113111 AAAATTAAGCATAGGAAGGGAGG - Intergenic
1044449379 8:92315994-92316016 ATGTTTGAGCTTAGTGAGGAAGG + Intergenic
1044639972 8:94368943-94368965 AGAATTAAGCTTAGTGAGGAAGG + Intergenic
1044668996 8:94659592-94659614 ATGATTAAGCTTAGTCAGGAAGG + Intronic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044807752 8:96025632-96025654 AGGATTAAACTTAGTGAGGAAGG + Intergenic
1044889491 8:96818018-96818040 ATGGTTAGGCTTAGTGAGGAAGG - Intronic
1045038669 8:98199343-98199365 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1045073155 8:98532164-98532186 ATGATTAAACTTAGTGAGGAAGG - Intronic
1045129527 8:99133557-99133579 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1045158320 8:99505339-99505361 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1045232925 8:100322650-100322672 ATGATTAAGCTTAATGAGGAAGG - Intronic
1045381131 8:101627633-101627655 ATAATTAAGCTTAGGGAGGAAGG + Intronic
1045465594 8:102466723-102466745 ATGATTAGGCTTAGTGAAGACGG - Intergenic
1045563523 8:103289829-103289851 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045728611 8:105206011-105206033 ATGATTAAGCTTAGGAAGGAAGG - Intronic
1045889586 8:107139109-107139131 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045907808 8:107369562-107369584 ATAATTAAGCATAGTGAAGAAGG - Intronic
1045948342 8:107823383-107823405 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1045967065 8:108037120-108037142 GTGATTAAGCTTAGTGAGCAGGG + Intronic
1046130328 8:109959730-109959752 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1046545499 8:115644707-115644729 ATGATTATGCTTAGTGAGGAAGG - Intronic
1046571739 8:115974800-115974822 ATGATTAAGCTTAATGAGGAGGG - Intergenic
1046743822 8:117855998-117856020 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1046844510 8:118900893-118900915 ATGAATCAGCCTGGGGAGGAAGG + Intergenic
1046927660 8:119809548-119809570 ATGGTTAAGCTTAGGGAGGAAGG - Intronic
1047009882 8:120660730-120660752 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1047348803 8:124053954-124053976 ATGAGTCAGGATAGGGAGGACGG - Intronic
1047400663 8:124543931-124543953 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1047560415 8:125981648-125981670 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1047630743 8:126705127-126705149 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1047703642 8:127475152-127475174 ATGATTAAGCTTAGTAAGTATGG + Intergenic
1047794933 8:128245534-128245556 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1047827890 8:128597621-128597643 ATGATTATGCTTTGTGAGGAAGG + Intergenic
1047897247 8:129380437-129380459 ATGATTAAGCTTAGAAAGGAAGG + Intergenic
1048079441 8:131109477-131109499 ATAATTCAGCTTAGTGAGGAAGG - Intergenic
1048164779 8:132052944-132052966 ATGATTCAGCAGAGGCAGCAGGG - Intronic
1048798390 8:138172698-138172720 ATAATTATGCAGAGGGAGGGAGG + Intronic
1048824319 8:138409097-138409119 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1048902484 8:139052094-139052116 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1049629102 8:143642559-143642581 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1049739481 8:144230473-144230495 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050298699 9:4234254-4234276 ATGCTTAAGCCTATTGAGGAAGG - Intronic
1050321409 9:4456631-4456653 AAGATTAATCCTAGTGAGGAAGG - Intergenic
1050349578 9:4727777-4727799 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050383772 9:5061810-5061832 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050437296 9:5624632-5624654 ATGATTAAACTAAGTGAGGAAGG - Intergenic
1050565093 9:6873819-6873841 ATGATTTAGCTTAGTAAGGAGGG - Intronic
1051064420 9:13085183-13085205 ATGATTAGGCTGAGTGAGGAAGG + Intergenic
1051085008 9:13338284-13338306 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1051114023 9:13673748-13673770 AGGAGTAAGGATAGAGAGGAAGG - Intergenic
1051123770 9:13780530-13780552 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
1051254149 9:15195009-15195031 ATAATTAAGCGTAGTGAGGAAGG + Intronic
1051298258 9:15619244-15619266 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1051601678 9:18881290-18881312 ATGATTAAGCTTAGTGGGGAAGG - Intronic
1051721638 9:20043111-20043133 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1051753633 9:20370840-20370862 ATGATTAGGCTTAGTGAGAAAGG + Intronic
1051797617 9:20891348-20891370 ATGATTAAGATTAGCGAGGAAGG + Intronic
1051836877 9:21348824-21348846 ATGATTATCCATAAGGAGGTGGG - Intergenic
1051852987 9:21530514-21530536 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1051967921 9:22851651-22851673 ATTACTAAGCTTAGTGAGGAAGG - Intergenic
1052186613 9:25604539-25604561 AAGATTAAGCTTAGTGAGGAAGG + Intergenic
1052200557 9:25773767-25773789 ATGATTAATCATAAGGAGGTGGG + Intergenic
1052210005 9:25892915-25892937 CTGATTAAGTATAAGGAGTAAGG + Intergenic
1052446132 9:28563904-28563926 ATTGTTATGCATAGGTAGGAGGG - Intronic
1052591900 9:30507926-30507948 AGGATTAAGCTTTGTGAGGAAGG - Intergenic
1052690758 9:31814008-31814030 ACGATTAAGCTTAGTGAGAAAGG - Intergenic
1052734580 9:32327836-32327858 GTGATTAAGCTTAGTGAGAAAGG - Intergenic
1053132545 9:35625103-35625125 AGGATTAAGGTTAGTGAGGAAGG + Intronic
1053172474 9:35899241-35899263 ATTATTAACCTTAGTGAGGAAGG - Intergenic
1053225115 9:36348100-36348122 ATGATTAAGCTTAGTAAGAAAGG + Intronic
1053250341 9:36568924-36568946 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053296494 9:36918180-36918202 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1053465614 9:38305922-38305944 ATGATCAAGCTTAGTGAGGAAGG - Intergenic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1054839431 9:69720116-69720138 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1054994516 9:71370277-71370299 ATAATTAAGCTTAGTGAGGATGG + Intronic
1055039448 9:71853279-71853301 ATTGTTAAGCTTAGTGAGGAAGG - Intergenic
1055150690 9:72995406-72995428 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1055297094 9:74844821-74844843 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1055434637 9:76280417-76280439 TTGATTAAGCTTAGTGAGGAAGG + Intronic
1055534421 9:77223371-77223393 ATAATTAAGCTTAGTGAGAAAGG + Intronic
1055557162 9:77486570-77486592 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1055760480 9:79601828-79601850 ATGATTAACCTTAGAGTGGAAGG + Intronic
1055807378 9:80111727-80111749 AGGATTAAGTTTAGGGAGGAAGG - Intergenic
1055873965 9:80920389-80920411 ATGATTAAGCTTAGTAAAGAAGG - Intergenic
1055906537 9:81301009-81301031 GTGATTAAGCTTAGTGAGAAAGG + Intergenic
1056058447 9:82855052-82855074 ATGATTAAACATAGTAAGGAAGG - Intergenic
1056262365 9:84861922-84861944 ATGAACAAGCATAGGGTGGATGG - Intronic
1056569744 9:87804873-87804895 ATGATTATTAATAGGGAGGTGGG + Intergenic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056959604 9:91111437-91111459 ATGATTAAGCTTAGTGAGTAAGG - Intergenic
1056979265 9:91293268-91293290 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1057240277 9:93401706-93401728 ATGATTCATCTTAGTGAGGAAGG + Intergenic
1057287353 9:93768741-93768763 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1057309823 9:93935148-93935170 GAGATGCAGCATAGGGAGGAGGG + Intergenic
1057370578 9:94469153-94469175 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057539007 9:95947101-95947123 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1057727509 9:97578615-97578637 ATGAATAAGCCGAGGGAGCATGG + Intronic
1057823695 9:98354938-98354960 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058348764 9:103996713-103996735 ATGATTAAGCTTATTGAGGATGG - Intergenic
1058628130 9:106957113-106957135 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059092984 9:111381139-111381161 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059158128 9:112007849-112007871 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1059264837 9:113017304-113017326 ATGATTAAGTTTGGAGAGGAGGG + Intergenic
1059290087 9:113215217-113215239 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1059558912 9:115311931-115311953 ATGATTAAACTCAGTGAGGAAGG + Intronic
1059629167 9:116101035-116101057 ATGACTAAGCATAGGGTTTATGG - Intergenic
1059711862 9:116875114-116875136 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1059833665 9:118126807-118126829 ATTATTAACCTTAGTGAGGAAGG + Intergenic
1059917506 9:119119761-119119783 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1060066465 9:120505534-120505556 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1060843963 9:126819723-126819745 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1061121500 9:128645729-128645751 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1062142604 9:134967880-134967902 CTGATTAATCAGGGGGAGGAAGG + Intergenic
1203750117 Un_GL000218v1:71066-71088 ATAATTAAGCTTAGTGATGAAGG + Intergenic
1203483861 Un_GL000224v1:33295-33317 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1203708833 Un_KI270742v1:77266-77288 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1203542260 Un_KI270743v1:100308-100330 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1186304075 X:8235199-8235221 ATGATTAAGCTTAGTGACTAAGG - Intergenic
1186311514 X:8324353-8324375 ATAATTTAGCATAAGGAGAAAGG - Intergenic
1186969852 X:14829957-14829979 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1187026669 X:15442499-15442521 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1187516629 X:19977252-19977274 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1187524358 X:20040492-20040514 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1187662912 X:21570600-21570622 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1187760134 X:22574079-22574101 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1187800421 X:23056187-23056209 ATGATTACACTTAGTGAGGAAGG + Intergenic
1187814933 X:23221250-23221272 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1187908787 X:24091380-24091402 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1188095683 X:26018570-26018592 AGGATTAAACATTGGAAGGAGGG + Intergenic
1188231091 X:27664103-27664125 ATGATCAAACTTAGTGAGGAAGG + Intronic
1188278859 X:28238072-28238094 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1188425168 X:30037812-30037834 ATCATTAAGCTTAGTGGGGAAGG + Intergenic
1188448232 X:30280125-30280147 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1188583316 X:31742341-31742363 ATGATTAAGATTGGTGAGGAAGG - Intronic
1188591418 X:31840994-31841016 ATGATTAAGCTTGGTTAGGAAGG + Intronic
1188705376 X:33322219-33322241 ATGATTATGTTTAGTGAGGAGGG - Intronic
1188822111 X:34788279-34788301 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1188833576 X:34930648-34930670 ATGATTAAGCCTAATGAGAAAGG + Intergenic
1188855604 X:35191538-35191560 ATGATTGAGCTTGGTGAGGAAGG - Intergenic
1189014552 X:37083290-37083312 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189060140 X:37744981-37745003 ATGATTAAGTTTAGTGAAGAAGG - Intronic
1189174577 X:38942806-38942828 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189708638 X:43785607-43785629 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1189788029 X:44577193-44577215 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189827790 X:44937768-44937790 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1189830240 X:44965404-44965426 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1190141911 X:47854493-47854515 ATGATTGAGCTTATTGAGGAAGG - Intronic
1190189494 X:48265315-48265337 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190460801 X:50671885-50671907 ATGCTTAAGCTTAGTGAGGAAGG - Intronic
1190482977 X:50896197-50896219 TTGATTAAGCTTAGTGAGAAAGG - Intergenic
1190486624 X:50932637-50932659 ATGATTAAGCTTAGTGAAGGAGG + Intergenic
1190658254 X:52631816-52631838 ATGGCTAAGCTTAGTGAGGAGGG - Intergenic
1190660187 X:52646834-52646856 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190663396 X:52675978-52676000 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190676027 X:52782504-52782526 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190715679 X:53101267-53101289 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191957757 X:66664729-66664751 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1192084593 X:68083684-68083706 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1192091681 X:68165298-68165320 ATGATTAAGCTTAATGAGGAAGG - Intronic
1192388635 X:70700689-70700711 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1192676357 X:73200852-73200874 ATGATTAAGCTTGGTGAGAAGGG + Intergenic
1192720300 X:73689070-73689092 ATGATTAAGTTTAGCAAGGAAGG - Intergenic
1192754474 X:74032649-74032671 ATGATTGAACTTAGTGAGGAAGG + Intergenic
1192754541 X:74033647-74033669 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1193020178 X:76783175-76783197 AGGATTAAGCTTACTGAGGAAGG + Intergenic
1193023843 X:76822328-76822350 ATTATTAAGCTTAGTGAGGGCGG + Intergenic
1193652177 X:84150411-84150433 ATTATTAAGCTTGGTGAGGAAGG - Intronic
1193867256 X:86749320-86749342 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1193971277 X:88057009-88057031 ATGATTAAGCTTTGTGAGGAAGG + Intergenic
1194120809 X:89961404-89961426 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1194167851 X:90542648-90542670 ATATTTAAGCTTAGTGAGGAAGG - Intergenic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194588637 X:95769492-95769514 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194591241 X:95802520-95802542 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194759820 X:97782671-97782693 ATGATTAAGCTTAGTGACAAAGG + Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1194862285 X:99015026-99015048 ATAATTAAACTTAGTGAGGAGGG + Intergenic
1194940228 X:100000321-100000343 ATGATTAAGCTTGGTGAAGAAGG + Intergenic
1195253208 X:103068163-103068185 ATTATTAAGTGTAGTGAGGAAGG + Intergenic
1195253211 X:103068215-103068237 ATTATTAAGTGTAGTGAGGAAGG + Intergenic
1195338748 X:103883608-103883630 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1195792609 X:108605202-108605224 ATAATTAAACTTAGTGAGGAAGG - Intronic
1195818975 X:108921914-108921936 ATGATTGAGCTTAGGGAGGAAGG + Intergenic
1195987907 X:110651206-110651228 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
1196029342 X:111078713-111078735 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1196260351 X:113572017-113572039 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1196564072 X:117183949-117183971 AGGATTAAGTTTAGTGAGGAAGG + Intergenic
1197114065 X:122811182-122811204 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197129334 X:122986612-122986634 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197263114 X:124337298-124337320 AGGATTATGCATAGGGGAGAGGG - Intronic
1197456359 X:126680699-126680721 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197484074 X:127025275-127025297 ATGATTATTCATAAGGAGGTGGG - Intergenic
1197561567 X:128028994-128029016 AAGATTAAGTTTAGTGAGGAAGG - Intergenic
1198034622 X:132788587-132788609 ATGATTAAACTTAGTGAGGAAGG + Intronic
1198199699 X:134403131-134403153 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1198323126 X:135539646-135539668 ATGATTAAACTTAGTGAGGAAGG - Intronic
1198363718 X:135920715-135920737 ATGATTATTCATAAGGAGGTGGG + Intergenic
1198542915 X:137659307-137659329 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198621341 X:138514108-138514130 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198690349 X:139276623-139276645 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198818866 X:140623875-140623897 ATGATTAAGTTTAGGGATGAAGG + Intergenic
1198883743 X:141310384-141310406 ATGATTAAGCTTAGGGAAGAAGG - Intergenic
1198983128 X:142422179-142422201 ATGATCTACCTTAGGGAGGACGG - Intergenic
1199023240 X:142907539-142907561 ATAATTAAGCTTAGTGAGAAAGG + Intergenic
1199103033 X:143828128-143828150 ATCATTAACCTTAGTGAGGAAGG + Intergenic
1199260182 X:145764061-145764083 ATGATTAAGCTTAGGGAGGAAGG + Intergenic
1199343776 X:146714348-146714370 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1199916829 X:152351752-152351774 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1200013786 X:153142754-153142776 ATTATTAAGCTCAGTGAGGAGGG + Intergenic
1200025815 X:153257201-153257223 ATTATTAAGCTCAGTGAGGAGGG - Intergenic
1200367402 X:155681513-155681535 GTGATTAAGCTTAGGGAGGAAGG + Intergenic
1200389207 X:155926746-155926768 ATAATTAAGCTTAGTGAGTAAGG - Intronic
1200473675 Y:3618909-3618931 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1200514107 Y:4120438-4120460 ATATTTAAGCTTAGTGAGGAAGG - Intergenic