ID: 1082960885

View in Genome Browser
Species Human (GRCh38)
Location 11:58917796-58917818
Sequence TCCCTTTGTGGAGGGAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 7, 3: 62, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082960885 Original CRISPR TCCCTTTGTGGAGGGAATGC TGG Intronic
900928450 1:5720470-5720492 TCTCTTGGTGGAGGGAAGTCAGG - Intergenic
901017314 1:6239333-6239355 TTCCTCTGTGGCGGGAAAGCAGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902858951 1:19230798-19230820 ACCCTTTGTGGATGAGATGCAGG - Intronic
904608487 1:31712167-31712189 TCTCTTTGTGGTGGCAATGAGGG - Intergenic
905210810 1:36372933-36372955 TGCCTTTGTGGATGGAGAGCAGG - Intronic
908749153 1:67402942-67402964 CCCCTTTGTGGAGGGCAGACGGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912106661 1:106285686-106285708 TACCTGTGTGGAGGGTATGTGGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916178103 1:162059765-162059787 TGCTTTTGTGGAGGGAAGGTGGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916827162 1:168453499-168453521 TCCCTTGGTGGAGAGCCTGCAGG - Intergenic
920189806 1:204186360-204186382 TCTCTGTGTGCCGGGAATGCAGG - Intergenic
920305464 1:205015544-205015566 TCCCCTTGTGCAGGGAGAGCTGG - Intronic
921935852 1:220796378-220796400 TCCCTACCTGGAAGGAATGCAGG - Intronic
922553914 1:226518701-226518723 TCACTTTGTGGAAGGCATTCTGG + Intergenic
922970114 1:229729058-229729080 TCCATTTGTGGAGGGAACACAGG - Intergenic
923286998 1:232505762-232505784 TCCGTTTGGGGAGGCAATACTGG + Intronic
923532905 1:234825697-234825719 TCTGTTAGTGAAGGGAATGCTGG - Intergenic
924201466 1:241663532-241663554 CCCCTTTGGGGAGAGAATTCTGG + Intronic
924561334 1:245158047-245158069 CACATTTGTGGAGGGAATGTAGG + Intronic
1062989253 10:1800160-1800182 TCCCATTGAGGAGGGAGTGAGGG + Intergenic
1064682768 10:17828046-17828068 TCACTTGATGGAGGGAATGTTGG - Intronic
1065782167 10:29180008-29180030 TCTCTCTGTGGAAAGAATGCTGG + Intergenic
1065808920 10:29422894-29422916 TCTCTCTGTGGAAAGAATGCTGG + Intergenic
1067339146 10:45387081-45387103 TGCATTTGGGGAGAGAATGCAGG - Intronic
1069323830 10:67206378-67206400 TTCCTTTGTGAAGGGTATCCTGG + Intronic
1069622328 10:69845596-69845618 TCCCATTGGGGAGGGGCTGCAGG - Intronic
1071324278 10:84496595-84496617 TCCCTTTCTGATGGGAATGGGGG + Intronic
1071572003 10:86702389-86702411 GCCCTTGGTGGTGGGAATGGTGG - Intronic
1071796833 10:89016697-89016719 TCTCTTTGTGGTGGGCATACTGG + Intergenic
1075752197 10:124782236-124782258 TCCCTTTGTGCTGGGATTACAGG - Intronic
1075825134 10:125349490-125349512 TTCCTTGATGGAGGGAATGGAGG - Intergenic
1076500918 10:130935329-130935351 TCCCCTGGTGGAAAGAATGCTGG + Intergenic
1076587412 10:131559050-131559072 TCCCTCGGTGCAGTGAATGCAGG - Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077554776 11:3220700-3220722 TTCCTTTGGGAAGGGAAGGCAGG - Intergenic
1077646496 11:3930016-3930038 CCCCTTTTAGGAGGTAATGCAGG + Intronic
1079364382 11:19796650-19796672 CCTCTCTGTGGAGGGAAGGCTGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080964342 11:37196561-37196583 ACCCTTTGTGGAGGCAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083082796 11:60111235-60111257 TCGATTTGTGGAGGGTAAGCAGG + Intergenic
1084582408 11:70032260-70032282 TCTCATTGTGGACGGACTGCAGG + Intergenic
1085923744 11:80990074-80990096 TCAATTTATGGAAGGAATGCAGG - Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1089070310 11:115694957-115694979 TCCCATGGTGGAGGGAATTTAGG + Intergenic
1090820860 11:130340364-130340386 TCCCTTTTTGGTGGGTATTCAGG - Intergenic
1092217421 12:6693173-6693195 TGTTTTTGGGGAGGGAATGCAGG - Intergenic
1095833008 12:46607701-46607723 TCCTTTTGTGGACTGACTGCTGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096739114 12:53678761-53678783 TCCCTTTGTGAAGTGAAAGAAGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098122482 12:67256595-67256617 TCCCTTGGTGGAGGGAGCACAGG - Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1098977631 12:76919841-76919863 GCCCTTTGTGGATGGGCTGCTGG + Intergenic
1100006471 12:89901080-89901102 TCCCTTTTTGGAGGGCACGCTGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1105995997 13:25672440-25672462 TCTCTTTGGGGTGGGAATGGAGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108535336 13:51370819-51370841 ACCCATTGTGAAGTGAATGCAGG - Intronic
1109156248 13:58913640-58913662 TCCCTTTGTTCAGAGAAAGCAGG - Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1113144915 13:107197847-107197869 TCCCTTTGTGGAAATAATGACGG + Intronic
1113443639 13:110348767-110348789 TTCCTCTGTGGAGGGAATTTGGG + Intronic
1113992438 14:16038151-16038173 TGCGTTTGAGGAGGGGATGCAGG + Intergenic
1114325347 14:21583295-21583317 TCCCAATGTGGAGGGATTACAGG + Intergenic
1114895921 14:26991305-26991327 TTCCTTTCTGGAAGGAGTGCAGG + Intergenic
1116130953 14:40855261-40855283 TCCCTTTGTGAAGGGAAACTGGG - Intergenic
1116498413 14:45590674-45590696 TGCCTTTGTGGAGGCCATGGAGG - Intergenic
1119234101 14:73005266-73005288 TCCCTTTGATGAGGGAAGGAAGG + Intronic
1119297941 14:73548320-73548342 TCAATTTGTGGAGGGAATCCAGG + Intronic
1119302231 14:73580517-73580539 TCAATTTGTGGAGGGAATCCAGG + Intergenic
1120035711 14:79695134-79695156 GCACTTTGTGGAGTGAATGATGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123887596 15:24742207-24742229 TCAATTTGTGGAGGGAATGGAGG - Intergenic
1126901549 15:53319632-53319654 CCCCTTTGTGGTGTGATTGCAGG - Intergenic
1128184858 15:65636206-65636228 TCACTTTGTGGAGGTGAAGCAGG + Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129556211 15:76512548-76512570 TCCCATTGTGGAGGGTCTGCAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1132376105 15:101329201-101329223 ATCCTTTGTGGAGGAAATCCAGG + Intronic
1133294395 16:4743888-4743910 TCCCTTTGTGGAGGGGAGTAGGG + Intronic
1133741602 16:8655965-8655987 TACCTTGGTGGAGGGCATGGTGG - Intergenic
1133822882 16:9252558-9252580 TCTCTTTGTAGGGGGAAAGCAGG - Intergenic
1134304222 16:13017945-13017967 TTCCTTTGAGAAGGGAATACAGG - Intronic
1134311558 16:13079992-13080014 TGCCTTTGAGAAGGGAAGGCCGG + Intronic
1134464162 16:14458556-14458578 TCTCTTTGTAGAGGAAAAGCAGG + Intronic
1137455492 16:48614667-48614689 TCAATTTGTGGGGGGAATGCAGG - Intronic
1137522487 16:49206675-49206697 TTCCTTAGTGGAGAGAATGAAGG + Intergenic
1138160045 16:54744993-54745015 TCTCTTTGTGCTGGAAATGCTGG - Intergenic
1139043460 16:63028980-63029002 TCCCTTAGTGGAAGGAATGCTGG - Intergenic
1139482472 16:67238090-67238112 GCTCTTTGTGGATGGAATGCTGG - Exonic
1140797372 16:78451887-78451909 TTCCTTCGTGGAAGGAATGATGG - Intronic
1141806608 16:86345886-86345908 TCCCCTTGTGGAGGAAAGGCTGG - Intergenic
1142201216 16:88761983-88762005 TCCCTTTCTGGAGAGGCTGCGGG - Intronic
1142228721 16:88889454-88889476 TCCCCTTGGGGAGGGACTGAGGG + Intronic
1142425313 16:89999458-89999480 TCCCTTCGGGGTGGGAAAGCAGG + Intergenic
1142534457 17:604856-604878 TCCCTTTGTTGAGTGGATGAGGG - Intronic
1142549610 17:730511-730533 TCCCTTTAAGGAGGGAAGGCAGG + Intergenic
1143037111 17:4005611-4005633 TCCCTCTGTGCAGGGTCTGCAGG - Exonic
1143272046 17:5683073-5683095 TCTCTTTGTGGAAAGAGTGCTGG - Intergenic
1143921518 17:10334056-10334078 CCCCTTTGGGGAGGTAATGTGGG + Intronic
1144130325 17:12240482-12240504 TCACTTAGTGAAGGTAATGCTGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145882846 17:28364682-28364704 TCCCTGGGTGGAGGGGATGCTGG - Intronic
1146761090 17:35479656-35479678 GCCCTTTTTGCAGGGAATTCTGG + Exonic
1147953798 17:44121501-44121523 TCCCTTTGAGGAGGGATGTCTGG - Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1154399105 18:14018285-14018307 ACCCATTGTGGAGACAATGCTGG - Intergenic
1155491540 18:26405903-26405925 TCCCTTTGGGGAGTGATGGCTGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155746446 18:29361306-29361328 TCCCTTAGAGGAGGGACTGGCGG + Intergenic
1156497610 18:37536419-37536441 TCCCTTTTAGGAGGGAGTGGGGG - Intronic
1157256556 18:46144812-46144834 TGAATTTGTAGAGGGAATGCAGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1161681077 19:5680171-5680193 TCTCTGTGAGGTGGGAATGCCGG - Intronic
1162115426 19:8426438-8426460 TCCCTTTGGGAAGGAGATGCAGG - Intronic
1163045635 19:14639672-14639694 TCCCAGTGTGCAGGGATTGCAGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164383651 19:27755538-27755560 GCCTTTTGTGGAGGGAAGGATGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164466279 19:28489953-28489975 TTCCTTTGTGGCAGGAAGGCTGG + Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166540921 19:43605206-43605228 TCCCTTTGTGGAGGTTATAATGG - Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1168142880 19:54401017-54401039 TTCCTCTGTGGAGGGAAAGGTGG - Intergenic
1168568634 19:57445478-57445500 GGCCTTAGTGGAGTGAATGCAGG + Exonic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928657978 2:33473028-33473050 TTTAGTTGTGGAGGGAATGCAGG + Intronic
929073870 2:38061218-38061240 TCCCCATGTGAAGGAAATGCAGG + Intronic
929132682 2:38593914-38593936 TCCCATAGTGGTGGGATTGCAGG - Intronic
930842542 2:55863570-55863592 TCCCTTTGGGAAGCCAATGCAGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933333364 2:80922744-80922766 TCAATTTTTGGAGGGAATGAGGG - Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
934952300 2:98585184-98585206 TCACTTTGTGGAGGGAAAACAGG - Intronic
936034406 2:109099386-109099408 TCTCTTAGCAGAGGGAATGCTGG + Intergenic
937261781 2:120591299-120591321 TCCCTTGGTGGTGGTAATGGTGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938671283 2:133588929-133588951 TGCCTTTGGGGAGGGAATGATGG + Intergenic
938764209 2:134449652-134449674 TCCCTTTGGGAAGGAAATACAGG + Exonic
940850291 2:158681943-158681965 TCCATCTGTGGAGGCAATGAGGG + Intronic
941622501 2:167793890-167793912 TCCCTATGCGGAGGGCATGAAGG - Intergenic
942012699 2:171778745-171778767 TCCCTTGGTGGAGGGCAAGACGG + Intergenic
944224601 2:197337533-197337555 TCCCCTTGTGAATGGAATGAAGG + Intergenic
945032106 2:205675292-205675314 TTGCATTGTGGATGGAATGCAGG - Intergenic
945079454 2:206074149-206074171 TCCCTTAAAGGAGAGAATGCAGG + Intronic
946858674 2:223978863-223978885 TGCCTTTGAGGAGGTAATGAAGG + Intronic
948130887 2:235599844-235599866 GCCCCTGGTGGAGGCAATGCTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948925362 2:241092958-241092980 CCTCTTTGTGGCTGGAATGCTGG - Exonic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1170155515 20:13265614-13265636 TCCATTTGTCCAAGGAATGCTGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1177051625 21:16241974-16241996 TCCCTCTGTGGTGAGATTGCAGG + Intergenic
1177596885 21:23256231-23256253 CCAATTTGTGGAGGGAAGGCAGG + Intergenic
1178797598 21:35759432-35759454 TCTCTTTGTGTAGGAAAGGCAGG - Intronic
1179291471 21:40021540-40021562 TGCCTTTCTGGAGGGAACCCAGG + Intronic
1180314833 22:11269366-11269388 TGCGTTTGAGGAGGGGATGCAGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181641554 22:24202838-24202860 TCAGTTTGTGGAGAGAATGCAGG - Intergenic
1183293197 22:37015321-37015343 TCCCTTCTTGGAGGGAGTGAGGG - Intronic
1184225417 22:43126886-43126908 TCCCTACTTGGAGGGGATGCGGG - Intronic
949134106 3:541648-541670 TTAATTTGTGGAGGGAATGCAGG - Intergenic
949487381 3:4553003-4553025 TCACTTTGTGTTGGGGATGCTGG - Intronic
952996464 3:38887630-38887652 TCAATTTGTGGAAGGAATGCGGG - Intronic
954713022 3:52514268-52514290 TCCCTTCGTGGTGGGATTGGAGG - Intronic
955973230 3:64456742-64456764 TGACATTGAGGAGGGAATGCAGG + Intergenic
956049233 3:65229790-65229812 TTCCTTTGTGGAGGAACTGAAGG - Intergenic
956286066 3:67611939-67611961 TTCCTTTGTGGAGTGATAGCCGG - Intronic
957239067 3:77635007-77635029 TCCCTTCGATGAGGCAATGCTGG - Exonic
957885531 3:86282501-86282523 GCCCACTGTGGAGGGAATGAGGG - Intergenic
958487660 3:94732327-94732349 TCCATTTGATGATGGAATGCTGG + Intergenic
958813697 3:98892576-98892598 TCTCTTTGTGGAAGGAATCATGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
961423543 3:126827447-126827469 TGCCTTGGTGGAGGGAAGGATGG + Intronic
963387053 3:144610856-144610878 TCCCTTTGTGGTGGGAAGTGAGG + Intergenic
963850953 3:150210049-150210071 TTCCTTGGTGGTGTGAATGCGGG + Intergenic
964247698 3:154672526-154672548 TCCCATTGTGGTCTGAATGCAGG + Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
965082449 3:164051942-164051964 TCCCTTTGGGGATGGACTGAAGG + Intergenic
965390362 3:168096000-168096022 TCCCTTCGGGGAGGCAGTGCCGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
966887946 3:184386989-184387011 GTCCTTTGGGGAGGGAATGAGGG + Intronic
969582960 4:8076468-8076490 GGCCTTGGTGCAGGGAATGCTGG - Intronic
969686889 4:8680615-8680637 TCCTTTTGGGGAGGAAATGGGGG - Intergenic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
970281144 4:14457043-14457065 TCCCTTTGTGGATCAAAAGCAGG + Intergenic
970521045 4:16884064-16884086 TCCCTTTGTGGAGGGTGGACTGG - Intronic
970814294 4:20135753-20135775 TCATTTTGTGGAGAAAATGCTGG - Intergenic
971036035 4:22693740-22693762 TCCCTTTGTGGAGGGGAAGGGGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972597497 4:40542793-40542815 TCCCTATGTGCTGGGATTGCAGG + Intronic
973634084 4:52845851-52845873 TAGCGTTGTGGAGGGAAGGCAGG + Intergenic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980484462 4:133437814-133437836 TGCCTTTGTGGAGGGTCTGCTGG - Intergenic
980835985 4:138193467-138193489 TCACTTTGTGGACCCAATGCTGG + Intronic
981181801 4:141754962-141754984 TCCCTTTCTGAAGGGAGTTCTGG + Intergenic
981977391 4:150747271-150747293 TACTTCTGTGGAGGGAAAGCAGG - Intronic
982654388 4:158129402-158129424 TCTCTTTGTGGATTGAAGGCAGG - Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
986713295 5:10503235-10503257 TACCTTTAAGGAGGGAATGGGGG - Intergenic
987066277 5:14292968-14292990 TCTCTTTCTGGAGTGATTGCGGG + Intronic
987224617 5:15827086-15827108 TGTCTTTGTGGAGGAAATGATGG - Intronic
989103843 5:37842556-37842578 ATCCTCTGTGGAGGGAATGTGGG - Intergenic
991773966 5:70066313-70066335 TCCATTTGTGAATGGAAGGCAGG + Intronic
991853260 5:70941737-70941759 TCCATTTGTGAATGGAAGGCAGG + Intronic
991956341 5:71998974-71998996 TCCCTTTGAGGAAGGACTGAGGG - Intergenic
992793468 5:80234513-80234535 GCCCTTTGTGGTGGGAGTGGTGG - Intronic
994037365 5:95217511-95217533 TCCCTTTGCAGAAGGAAAGCAGG - Intronic
996339035 5:122415822-122415844 TCCCTTTCTTGAGGAAATGTAGG - Intronic
996538695 5:124606591-124606613 TTACTTTGAGGAGGGAATGTGGG - Intergenic
997008271 5:129846619-129846641 TTCCTTTTTGGGGGGAAGGCAGG - Intergenic
997249684 5:132378901-132378923 TCACTTTGCAGAGAGAATGCTGG - Intronic
997364704 5:133318549-133318571 TGCCTGTGTGGAGGGTCTGCAGG + Intronic
997583133 5:135029459-135029481 AACCATTGTGGAGGGAATGCAGG - Intronic
998127876 5:139636394-139636416 TCCCCCTGTGGAGGGGATTCTGG + Intergenic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
999411645 5:151355199-151355221 TCAATTTGTGGAGGGAACACAGG + Intergenic
1000172673 5:158718411-158718433 CCTTTTTTTGGAGGGAATGCTGG + Intronic
1000645336 5:163754637-163754659 TCAGTTTGTGGAGGGAGTGTAGG - Intergenic
1000957036 5:167555562-167555584 TCCATTCATGGAGGGATTGCTGG + Intronic
1001505788 5:172279034-172279056 TCCCAATGTGGTGCGAATGCAGG + Intronic
1002758838 6:186114-186136 GCCCTTTGTGGATGGACTACAGG + Intergenic
1003102292 6:3186116-3186138 TGCCTGTGTGGAGGGCAGGCTGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003334216 6:5155337-5155359 TCCCATTGTGGTGGGATTACAGG + Intronic
1003617539 6:7669219-7669241 GCCCTTTGTGGAGGTAATTAAGG - Intergenic
1003758626 6:9150230-9150252 TCCATTTGATGATGGAATGCTGG - Intergenic
1004313343 6:14565117-14565139 TCTCTTTGGGGAAGGATTGCGGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005447742 6:25942016-25942038 TCCCTTTATGGAGTAATTGCAGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1009378732 6:63004107-63004129 TGCCTTTGTGAAGGGAATGGTGG + Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1016616148 6:146050817-146050839 TGCTTTTGTGGAAGGAATTCCGG + Intronic
1019696045 7:2446690-2446712 TCCCTTGGTGGGGGGATTCCTGG - Intergenic
1019762767 7:2825852-2825874 CCCCTGGGTGGTGGGAATGCTGG - Intronic
1022403252 7:30061881-30061903 TTACTTTCTGGAGGGAAAGCAGG - Exonic
1022603526 7:31785229-31785251 CCCCTTTGTGGGGTGAATGCTGG - Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1027390906 7:77702615-77702637 TCTCTTTGTGGGTGGAATGATGG + Intronic
1029554468 7:101258550-101258572 TCTCTTTGTGCAGAGCATGCAGG + Intergenic
1030364660 7:108631525-108631547 TCCATTTGTCCAGGAAATGCTGG - Intergenic
1032420450 7:131774991-131775013 TCTCTTTGCTGAGGAAATGCAGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032929485 7:136649768-136649790 TCTCTATGTGGATGGAATCCTGG - Intergenic
1033288791 7:140063696-140063718 GCCCTTTGAGGAGGTAATCCAGG + Exonic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034609337 7:152351579-152351601 TCCCTTTGTTGTGGGAAGTCAGG + Intronic
1035409391 7:158626834-158626856 TCAGTTTGTGGAGGGAACGCAGG - Intergenic
1036093227 8:5692407-5692429 TCCTTTTGTGGATGGAATCATGG - Intergenic
1037902019 8:22694031-22694053 TCCCTTTGTGGGGGGAAGGAGGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039841650 8:41297776-41297798 TCCCTTCTTGGTGGGAAAGCCGG - Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044079465 8:87865876-87865898 TCCTGTTGTGGAGAGAATGGTGG - Intergenic
1046282445 8:112051535-112051557 TGCAGTTGTGGAGGGAAGGCAGG + Intergenic
1046616158 8:116479803-116479825 TGCCTCCGAGGAGGGAATGCTGG + Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047320405 8:123774872-123774894 TACCTTTTTGGGGGGCATGCTGG + Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048974164 8:139661916-139661938 TTCCTGTGGGGAGGGACTGCTGG + Intronic
1049524110 8:143112258-143112280 TCCATTTGTGGAGGGAACGCAGG + Intergenic
1049544608 8:143224192-143224214 TCCATTTGTGGAGGGAACGCAGG - Intergenic
1053186349 9:36019858-36019880 TCAATTTGTGGAGGGAATGCAGG + Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057443847 9:95099961-95099983 TCCTGTTGTGGAGGGACTCCTGG - Exonic
1058453391 9:105117279-105117301 TCTCCTTGTTGAGTGAATGCAGG - Intergenic
1062570342 9:137182090-137182112 TCCCTATGTGCTGGGATTGCAGG - Intronic
1203363140 Un_KI270442v1:235379-235401 TGCGTTTGAGGAGGGGATGCAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186532318 X:10309846-10309868 TCCCTTTTTGGAGGGGAGGATGG + Intergenic
1189226348 X:39416480-39416502 TGCCTGTGTGGAGGGATTTCAGG - Intergenic
1190307732 X:49095107-49095129 TCCCTTTGCAGAGGGAAAGCTGG - Intronic
1191087806 X:56587884-56587906 TCCCTTACTGTAGAGAATGCTGG + Intergenic
1191572038 X:62639166-62639188 TCTCTTTTTGAAGGAAATGCAGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191689533 X:63925772-63925794 TCAATTTTTGGAGGGAATGCAGG - Intergenic
1192780920 X:74293172-74293194 TCCCATTGTGAAAGGAATGCGGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193936353 X:87626958-87626980 TCCATTTGTAGAAGGAATGTGGG + Intronic
1195371598 X:104180237-104180259 TCCCAATGTGGTGGGAATACAGG + Intronic
1198828414 X:140722582-140722604 TCATGTTGTGGAGGGAATCCGGG - Intergenic
1198851112 X:140966297-140966319 TCAATTTGTGGAAGGAATGCAGG - Intergenic
1199565697 X:149213385-149213407 GCCCTGTGTGGAGGGCAAGCAGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic