ID: 1082960992

View in Genome Browser
Species Human (GRCh38)
Location 11:58918766-58918788
Sequence GCTTCCAGAGTGACTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 6, 2: 13, 3: 37, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082960992 Original CRISPR GCTTCCAGAGTGACTAGAGC AGG Intronic
901684558 1:10936484-10936506 GCTTCCAGGGAGGCTGGAGCAGG + Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
906060861 1:42947750-42947772 GCAGCCAGAGTGACGAGAGTAGG + Intronic
912233085 1:107818100-107818122 GTTTCCAGAGTGAGGAGAGCAGG + Intronic
912709657 1:111941343-111941365 GCTTGCAGAGAGACTGGGGCAGG - Intronic
914214057 1:145608286-145608308 GGTGCCAGAGTGACTAGCGCAGG - Intronic
917131408 1:171745988-171746010 ACTTCCAGTGTGACTAGATTTGG + Intergenic
919378406 1:196822613-196822635 CCTTCCAGTGGGACAAGAGCGGG - Intronic
920576690 1:207066140-207066162 GCTTCCATAGTAACAACAGCTGG - Intronic
922046019 1:221946782-221946804 GATTCCAGTTTGGCTAGAGCTGG + Intergenic
923844336 1:237712300-237712322 AGTCCCAGAGTGATTAGAGCAGG + Intronic
1064161909 10:12953821-12953843 ACTTCCAAAGTGTCTAGAACAGG + Intronic
1066251617 10:33638276-33638298 GCTTGGAGAGTGACTGGAGAAGG + Intergenic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1069735853 10:70653674-70653696 CCTGCCACAGTGCCTAGAGCTGG - Intergenic
1070922220 10:80195140-80195162 GCTTCCAGAGTGGTTTGAACAGG - Intronic
1072059933 10:91799418-91799440 GTTTCTGGAGTGACTAGAACGGG + Intronic
1072105670 10:92271060-92271082 GCCTCCTGAGTGACTGGGGCTGG - Intronic
1072764388 10:98083825-98083847 GCAGCCTGAGTGACTAAAGCAGG - Intergenic
1073685073 10:105743513-105743535 GTTTACAGACTGACTATAGCTGG - Intergenic
1073754883 10:106571031-106571053 GCGGCCAGAGTGACTAGGGGTGG - Intergenic
1074445609 10:113518983-113519005 GCTTTCAGTGGGACTAGAGCTGG + Intergenic
1074892093 10:117744203-117744225 GCTTCCAGAGTGGTCAGAGAGGG + Intergenic
1076482448 10:130793359-130793381 GATTCCAGAGGAACTAGACCTGG + Intergenic
1077482151 11:2820807-2820829 GCTTCCAGAGGGGCTCTAGCAGG - Intronic
1078018788 11:7638170-7638192 GCTTCCAGAGGGACTGAATCAGG + Intronic
1080189263 11:29525188-29525210 GCTCCTGGGGTGACTAGAGCAGG - Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1084390363 11:68871674-68871696 GCCTCCAGAGTGACTAGAGCAGG - Intergenic
1085010506 11:73137784-73137806 ACGTCCCGAGTGACCAGAGCAGG + Intronic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1086132239 11:83412868-83412890 GTATCCAGAGTGACTACGGCTGG + Intergenic
1087895010 11:103577223-103577245 GCTTCCGGTGTGACTGAAGCAGG - Intergenic
1088118682 11:106341725-106341747 GCTTCCAGTGGGACAAGATCTGG + Intergenic
1089335201 11:117718185-117718207 GCTTCTAGAGAGGCTGGAGCCGG - Intronic
1094060571 12:26310909-26310931 GATTCCTGAAGGACTAGAGCTGG - Intergenic
1096339859 12:50788601-50788623 GCCTCCTGAGTAGCTAGAGCTGG + Intronic
1098659384 12:73073161-73073183 ACTTCCACAGACACTAGAGCTGG - Intergenic
1098800703 12:74953707-74953729 GCTAGTAGAGGGACTAGAGCAGG - Intergenic
1102706513 12:114885491-114885513 GCCTCCAGAGTAGCTAGACCAGG + Intergenic
1104169711 12:126268347-126268369 GCTTGCAGACTGACTAGATATGG - Intergenic
1105611813 13:21975430-21975452 GGTTCAAGAGTGAGGAGAGCAGG - Intergenic
1106620058 13:31364348-31364370 GCGTCCAAATAGACTAGAGCTGG + Intergenic
1107805180 13:44146967-44146989 GCTTCGAGAGTGACTGGAGGTGG + Intronic
1108469773 13:50756304-50756326 GCTGCCAGAGTGAATAGGGAAGG + Intronic
1111615734 13:90659358-90659380 GCTTCCAGAGGAAAGAGAGCTGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1115522166 14:34243838-34243860 GCTTTCAGAGACACAAGAGCAGG + Intronic
1118337438 14:64865995-64866017 GCTTATAGAGTCAGTAGAGCAGG - Intronic
1118367605 14:65109092-65109114 GCTTGCTGAGTGACTAGATGAGG - Intergenic
1118411541 14:65484109-65484131 GCTACCAGAATGAGTACAGCAGG - Intronic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1125403683 15:39331318-39331340 GCTTCCAGAGTGACCATTTCAGG - Intergenic
1125631376 15:41150257-41150279 GCCTCCAGAGTAAATTGAGCAGG - Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1129388446 15:75208415-75208437 GCTTCGCGAGTGGCTAGAGACGG + Exonic
1129714189 15:77837410-77837432 GAGTCCAGTGTGACCAGAGCTGG - Intergenic
1136835286 16:33495064-33495086 GCTTGCAGAGGGAACAGAGCTGG + Intergenic
1137254764 16:46765738-46765760 GCCTCCAGAGTAACTAGCTCCGG - Intronic
1137614788 16:49839672-49839694 GCCTCCAGAGAGAACAGAGCCGG + Intronic
1138190125 16:55007807-55007829 GCTTCCACCGTGAATAAAGCTGG - Intergenic
1140557955 16:75943278-75943300 GCTATCAGAGTGATCAGAGCAGG + Intergenic
1203009517 16_KI270728v1_random:228968-228990 GCTTGCAGAGGGAACAGAGCTGG - Intergenic
1142614003 17:1124697-1124719 CCTTCCAGAGTGAACAGAGGAGG + Intronic
1143863417 17:9907351-9907373 CCTTCCAGAGTGACATGAGGTGG - Intergenic
1143985577 17:10910760-10910782 GCTTCCACAGCAACTAGAGCAGG - Intergenic
1149046146 17:52247634-52247656 CCTTCCAGAGGGAATAAAGCAGG + Intergenic
1150543406 17:66127722-66127744 GCTTCCTGAGAGTCAAGAGCTGG - Intronic
1152427681 17:80227093-80227115 CCTTCTAGAATGTCTAGAGCAGG + Intronic
1152842271 17:82577697-82577719 GCCTCCAAAGGGACTAGAGCTGG + Intronic
1153523648 18:5975481-5975503 GCTTCCATAGTGACTTCTGCTGG + Intronic
1154108581 18:11546929-11546951 GCTTCCAGTGTGACTAGAGCAGG + Intergenic
1158511380 18:58093942-58093964 GCTTCCAGAGTGATTGAGGCAGG + Intronic
1159024442 18:63169632-63169654 GCTACTCGGGTGACTAGAGCAGG - Intronic
1160219748 18:76965973-76965995 GCTTCCAGGGTGGGTAGAGAAGG + Intronic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1162011382 19:7817572-7817594 GCTTGCAGGCTGACTAGATCTGG - Intergenic
1162342364 19:10099144-10099166 GCTGTCAGAGAGACTAGACCTGG - Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164010589 19:21200397-21200419 GCTTCCACTGTGATCAGAGCAGG + Intergenic
1164017081 19:21262678-21262700 GCCTCCAGAGTGGTCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164142567 19:22486246-22486268 GCTTCCAGTGTGACTAGAGCGGG + Intronic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286101 19:23819219-23819241 GCTTCTGGGGTGACTAGAACAGG + Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168105414 19:54163104-54163126 GATTCCAGAGAGAGAAGAGCAGG + Exonic
926272247 2:11375525-11375547 GCTTCGAGAGTGACTGGAACAGG - Intergenic
929438245 2:41945353-41945375 CCTTCCACATTGACTAGGGCTGG + Intronic
930316010 2:49797766-49797788 TCTTCCAGAGTGCCCAGAACTGG - Intergenic
931345479 2:61441437-61441459 GGCTGCAGAGAGACTAGAGCTGG + Intronic
933729484 2:85446213-85446235 GCTTTCAGAAGGAATAGAGCTGG - Intergenic
933812516 2:86041799-86041821 TCTTCCGGAGTGAGTAGGGCAGG + Intronic
934759784 2:96848159-96848181 GCTTCCACAGTGACCAGACTGGG + Exonic
935757899 2:106291182-106291204 GCTTCCTCAGTGAACAGAGCAGG + Intergenic
937750388 2:125470142-125470164 GTTTCTACAGTGACAAGAGCAGG + Intergenic
940020167 2:149147844-149147866 GCTTCAAGATTGAGTAGGGCAGG + Intronic
940109076 2:150130667-150130689 GCTTCCAGAGCGACAAGAACTGG + Intergenic
940473789 2:154133997-154134019 GCTTCCAAAGTTGCTACAGCAGG + Intronic
943445326 2:187978200-187978222 GCATCTATAGTGACTAGATCTGG - Intergenic
946597119 2:221318175-221318197 GCTTCAAGGGTGAGTAGAGAAGG - Intergenic
947960880 2:234236258-234236280 GCTTCCAGAAGGAATACAGCAGG + Intergenic
1170059032 20:12240171-12240193 GCTGGCAGAATGACTGGAGCTGG + Intergenic
1175029176 20:55935102-55935124 GCTCCAAAATTGACTAGAGCTGG - Intergenic
1175986174 20:62765140-62765162 ACCTCCAGAGTGACAGGAGCGGG - Intergenic
1175991700 20:62793130-62793152 GGGTCCACAGGGACTAGAGCAGG + Intergenic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1180956113 22:19742113-19742135 GCTTCCAGAGAGCCTACAGCTGG + Intergenic
1183308825 22:37098275-37098297 GCTTCCATGGTGCCTGGAGCAGG + Intronic
1184010314 22:41743055-41743077 GCATCCAGAGAGACAAAAGCAGG - Intronic
950948714 3:16977389-16977411 GCTTCCAGAGTGACTATGAAGGG - Intronic
952401889 3:32970797-32970819 GCTTCCAGTGTGGTCAGAGCAGG - Intergenic
952402338 3:32974741-32974763 CCTTCCTGACTGACTTGAGCTGG - Intergenic
954022667 3:47756051-47756073 GCTTCCTGAGTGGCTGTAGCTGG - Intronic
955025447 3:55163232-55163254 GCTTCTAGAATAATTAGAGCTGG + Intergenic
955582727 3:60442154-60442176 CCTTTCAGAGTGACCAGGGCTGG - Intronic
957616179 3:82530445-82530467 TTTTCCAGAGTGACCAGGGCTGG + Intergenic
957858515 3:85912004-85912026 GCTTGCAGAGTGAGCAGAGATGG - Intronic
959071886 3:101709632-101709654 GCCTCCAGAAAGACTAGAGACGG - Intergenic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
962631861 3:137284653-137284675 GCTTGCACAGTTCCTAGAGCAGG + Intergenic
962648789 3:137467046-137467068 GGCTCCAGAGTGCGTAGAGCAGG - Intergenic
963575303 3:147053331-147053353 GCATCCAGTGTGACTAGATTTGG + Intergenic
963752862 3:149201242-149201264 GCCTCCAGAGTAACTAGGACAGG + Intronic
964189012 3:153980480-153980502 GCTACCAGAGTGGGTAGAGAAGG - Intergenic
968480074 4:829353-829375 GCTTCCAGAGAGGCTAGAGCTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
969893758 4:10283477-10283499 GCTTCAAGATTGACTTGATCAGG + Intergenic
972334800 4:38098091-38098113 GCTTTCAGTGTGACTTTAGCAGG + Intronic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976539 4:68901154-68901176 GCTCCCAGTGTGACTAGAGCAGG + Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
976773325 4:88679030-88679052 TCTTCAAGATTGCCTAGAGCAGG - Intronic
978067664 4:104425431-104425453 CCTTCCAGAGTGACTATACAAGG - Intergenic
978953588 4:114590829-114590851 GCTTCCAGTGTGATCAGAGCAGG + Intergenic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
983003858 4:162457661-162457683 CCTTCCAGTGTGACAAGAGGTGG - Intergenic
985928629 5:3036929-3036951 CCTTCCAGAGGGACAAGAGGAGG + Intergenic
987744299 5:21949579-21949601 GCTTCCAGTGGGACAAGATCTGG + Intronic
988520733 5:31943357-31943379 TCTGCCAGAGTGCCTAGGGCAGG - Intronic
990155602 5:52873651-52873673 GCTTCCAGTGTGACTAAGTCAGG - Intronic
990770099 5:59233837-59233859 CCTCCCAGAGTGGCTAGAGTAGG - Intronic
991292466 5:65045906-65045928 GTTTCAAGAATGAGTAGAGCCGG - Intergenic
991764504 5:69959715-69959737 GCTTCCAGTGGGACAAGATCTGG + Intergenic
991782820 5:70158432-70158454 GCTTCCAGTGGGACAAGATCTGG - Intergenic
991843736 5:70834787-70834809 GCTTCCAGTGGGACAAGATCTGG + Intergenic
991875262 5:71158759-71158781 GCTTCCAGTGGGACAAGATCTGG - Intergenic
993920488 5:93795040-93795062 GCTACCAGGGTGAGTAGAGAAGG + Intronic
999028978 5:148268842-148268864 ACATCCAAAGTGACAAGAGCAGG + Exonic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1009765710 6:68072626-68072648 TCTTGCAGAGTGAGTAGGGCAGG + Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1012630104 6:101455355-101455377 GCTTCTTAAGTGACTAGAGTGGG + Intronic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1016272156 6:142301854-142301876 GCTTCCGGCGTGACTGGAGCTGG - Intronic
1017525635 6:155239505-155239527 GCTTCCACAGTTGCTGGAGCAGG - Intronic
1019890353 7:3941315-3941337 GCTTGCACACTGTCTAGAGCGGG - Intronic
1020257091 7:6508439-6508461 GGGCCCAGAGAGACTAGAGCAGG + Intronic
1020878218 7:13725264-13725286 GCTGTCAGAGTGACAAGTGCAGG + Intergenic
1021361274 7:19715683-19715705 GCTGCCTCAGTGACTAAAGCTGG + Intergenic
1022025316 7:26443050-26443072 GCTTTCAGAGAGACCACAGCGGG + Intergenic
1023387615 7:39676036-39676058 GCTTCCAGTGAGCCTAGATCAGG - Intronic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1026483904 7:70801281-70801303 GCTCCCAGGGTGACAGGAGCTGG - Intergenic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1032783168 7:135180336-135180358 GCCTCCAGAGTGATCACAGCAGG - Intergenic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1034875073 7:154718558-154718580 GGTTCCACAGTGACTAAAGTTGG - Intronic
1038067293 8:23976162-23976184 GATTCCAGAGTGCTTAGAACAGG - Intergenic
1038349359 8:26762373-26762395 GCTTCCAGAGAGCCCAGGGCAGG - Intronic
1039116645 8:34098656-34098678 CCTTCCAGAGGGACAAGAGGTGG + Intergenic
1040092259 8:43410212-43410234 GCTACCAAGGTGACTAGAGTGGG + Intergenic
1041008753 8:53521221-53521243 GCCTCCAGAGTAACCAGAGCAGG + Intergenic
1041099492 8:54381877-54381899 GCTTGGAGAGTGATGAGAGCCGG + Intergenic
1041985014 8:63910880-63910902 GCTTCCAGAGTGTACAGAGAGGG - Intergenic
1042122853 8:65507318-65507340 GCTACCAGAGTGAGTAGGGAAGG + Intergenic
1043816865 8:84812518-84812540 GCTACCAGGGTGAGTAGGGCAGG + Intronic
1047932953 8:129749133-129749155 GGTAACAGTGTGACTAGAGCAGG + Intronic
1049010441 8:139883817-139883839 GGCTCCAGAGTGAGCAGAGCCGG - Intronic
1058296040 9:103308366-103308388 GCTGCCAGACTGGCTAGAGCTGG + Intergenic
1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG + Intergenic
1061264873 9:129499089-129499111 GGTTCCAGAGTGACCAGGGCTGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1186835164 X:13430322-13430344 GCTTCCCCTGTGTCTAGAGCAGG - Intergenic
1193366255 X:80637482-80637504 GCTGCCACAGCCACTAGAGCTGG + Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1196334750 X:114518663-114518685 GCTTCCACTGTAACTAGACCTGG + Intergenic
1196497314 X:116336307-116336329 GCTTCCAGCGTGATTAGGGGTGG - Intergenic
1198469410 X:136932308-136932330 GCTGCCAGTGTGACTAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1200180431 X:154147169-154147191 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200186259 X:154185564-154185586 GCCACCAGTGTAACTAGAGCTGG - Intergenic
1200191911 X:154222702-154222724 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200197666 X:154260506-154260528 GCCACCAGTGTAACTAGAGCTGG - Intronic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1200779559 Y:7201958-7201980 GCCTCCAGAGTGGTCAGAGCAGG - Intergenic
1201858319 Y:18569408-18569430 ACTTCCAGGATGACTAGAGCAGG + Intronic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1201875002 Y:18750973-18750995 ACTTCCAGGATGACTAGAGCAGG - Intronic
1202168726 Y:22018664-22018686 GCTTCCAGGATGACTACAGCAGG - Intergenic
1202222635 Y:22567704-22567726 GCTTCCAGGATGACTACAGCAGG + Intergenic
1202320480 Y:23627956-23627978 GCTTCCAGGATGACTACAGCAGG - Intergenic
1202550287 Y:26042100-26042122 GCTTCCAGGATGACTACAGCAGG + Intergenic