ID: 1082961755

View in Genome Browser
Species Human (GRCh38)
Location 11:58924518-58924540
Sequence ATGTTTCCCTTTAATATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 734
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 669}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082961752_1082961755 -7 Left 1082961752 11:58924502-58924524 CCTGTTGCTTTCCCTAATGTTTC 0: 1
1: 1
2: 0
3: 25
4: 262
Right 1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG 0: 1
1: 0
2: 2
3: 62
4: 669
1082961750_1082961755 16 Left 1082961750 11:58924479-58924501 CCAAAAAGGTTTGTAAACTATTC 0: 1
1: 0
2: 1
3: 22
4: 251
Right 1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG 0: 1
1: 0
2: 2
3: 62
4: 669
1082961749_1082961755 20 Left 1082961749 11:58924475-58924497 CCTTCCAAAAAGGTTTGTAAACT 0: 1
1: 0
2: 1
3: 23
4: 262
Right 1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG 0: 1
1: 0
2: 2
3: 62
4: 669
1082961751_1082961755 -6 Left 1082961751 11:58924501-58924523 CCCTGTTGCTTTCCCTAATGTTT 0: 1
1: 0
2: 4
3: 58
4: 546
Right 1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG 0: 1
1: 0
2: 2
3: 62
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082961755 Original CRISPR ATGTTTCCCTTTAATATTTC TGG Intronic
900470240 1:2850051-2850073 AAGTTTCCATTTGATATTTTTGG - Intergenic
900855439 1:5178181-5178203 AGTTGTCACTTTAATATTTCAGG - Intergenic
901725541 1:11239078-11239100 TTGTTACCCTTTAAAAGTTCTGG - Intronic
903449958 1:23446385-23446407 AATTTTCCATTTAATATTTTTGG - Intronic
903496684 1:23773168-23773190 AAATTTCCATTTAATATTTTTGG + Intergenic
903764155 1:25722732-25722754 AGGTTTCCCTTAAATGTTTGTGG + Intronic
903801145 1:25969265-25969287 ATGTTTGCCTTTAATCTTAGTGG - Intronic
904343760 1:29854997-29855019 AATTTTCCATTTAATATTTTGGG + Intergenic
906888453 1:49679633-49679655 ATGTCTCCATTTACTTTTTCTGG + Intronic
906912609 1:49971153-49971175 AATTTTCCATTTAATATTTTTGG - Intronic
907164742 1:52400413-52400435 AATTTTCCATTTAATATTTTTGG + Intronic
907206821 1:52779979-52780001 ATTCTTACCTTTAAAATTTCTGG - Exonic
908869468 1:68592272-68592294 TTCTCTTCCTTTAATATTTCAGG + Intergenic
908996109 1:70156865-70156887 AATTTTCCGTTTAATATTTTCGG + Intronic
909350771 1:74650749-74650771 ATTTTTCCATTTAATATTTTTGG + Intronic
909429557 1:75571034-75571056 ATCTTTCTCTTTCATATTGCTGG - Intronic
909785704 1:79610071-79610093 AAGATTCCCTCTAATCTTTCTGG + Intergenic
910028948 1:82692400-82692422 ATGTTTACTTTTAAAAATTCTGG + Intergenic
910483697 1:87686506-87686528 ATGTTTCCCTTTAGAACCTCTGG + Intergenic
910570661 1:88698713-88698735 ACATTGCCCTTTATTATTTCTGG + Intronic
910782858 1:90959879-90959901 AATTTTCCATTTAATATTTTTGG - Intronic
912010585 1:104956441-104956463 AACTTTCCATTTAATATTTTAGG + Intergenic
912032760 1:105270265-105270287 ATATTTCCCTTTCTTTTTTCAGG + Intergenic
912197700 1:107418800-107418822 ATCTTTCACTCTAATATTTTTGG - Intronic
912218801 1:107648481-107648503 ATGTTTCCCTAAAATATTTAAGG + Intronic
912857091 1:113178661-113178683 ATGTGCCTCTTTTATATTTCAGG - Intergenic
912883173 1:113439262-113439284 AATTTTCCATTTAATATTTTTGG + Intronic
913008487 1:114659075-114659097 ATATTTTTCTTTAATGTTTCAGG + Intronic
914734817 1:150405696-150405718 AATTTTCCATTTAATATTTTAGG - Intronic
915777718 1:158509162-158509184 ATGTTTCCTTTACATATTTCTGG - Intergenic
916150722 1:161786314-161786336 CTTTTTCTCTTTAATATTTTAGG + Intronic
917233442 1:172863368-172863390 ATTTTTCCCATTACTATTTGTGG - Intergenic
918000258 1:180487310-180487332 AATTTTCCATTTAATATTTTGGG - Intronic
918693818 1:187516946-187516968 AATTTTCCATTTAATATTTTTGG - Intergenic
918725846 1:187922513-187922535 ATGTAACCTGTTAATATTTCAGG + Intergenic
919065855 1:192692298-192692320 ATATTTCCCTTTAATAAATATGG - Intergenic
919066950 1:192704044-192704066 ATCTTTCCATTTAATATTTTTGG + Intergenic
920080718 1:203371107-203371129 TTGTTTCCCTTTCAGATTTAGGG + Intergenic
920593439 1:207244900-207244922 AGCTTTGCATTTAATATTTCTGG - Intergenic
920995724 1:210988715-210988737 ATGTTTCTGTTTAATATGTGAGG + Intronic
921536603 1:216357010-216357032 ATATTTTCCTTTAGTGTTTCTGG + Intronic
921772332 1:219055714-219055736 ATATTTTACTTTAATATTTTAGG - Intergenic
922395076 1:225190480-225190502 AATTTTCCATTTAATATTTTTGG + Intronic
923076724 1:230615954-230615976 ATGTCTCCATTTCATGTTTCAGG - Intergenic
923424768 1:233858177-233858199 ATTTTTCCATTTAAAATTTTTGG + Intergenic
923615326 1:235532653-235532675 AACTTTCCATTTAATATTTTTGG + Intergenic
923965785 1:239137231-239137253 ATCTTTTCCTTTAAGATTTTAGG + Intergenic
924079459 1:240378847-240378869 ATGTTTTTCTTTAATATTTGAGG + Intronic
924108913 1:240678203-240678225 ATGTTTACACTTAATATATCAGG - Intergenic
924124222 1:240833364-240833386 AATTTTCCATTTAATATTTTTGG + Intronic
1063125449 10:3132986-3133008 AATTTTCCATTTAATATTTGTGG + Intronic
1063162936 10:3432793-3432815 ATTTTCCCCTTTAATTTGTCAGG + Intergenic
1063177683 10:3567044-3567066 ATGTGCCCTTGTAATATTTCTGG - Intergenic
1063518387 10:6719103-6719125 ATGTTTCCTTTAGACATTTCTGG + Intergenic
1064635783 10:17365439-17365461 AAGGTTCCATTTAATATTTTTGG - Intronic
1064868107 10:19905101-19905123 CTGTTTCCCATTAAGATTTAGGG - Intronic
1065040300 10:21687308-21687330 ATGTGTCCCTTTTTTATTTCAGG + Intronic
1065132722 10:22638562-22638584 CTTTTTCCCTTTACTTTTTCTGG + Intronic
1066024058 10:31335152-31335174 AATTTTCCATTTAATATTTTCGG - Intronic
1066036663 10:31495536-31495558 AAGTTTCCTTTTCAGATTTCGGG + Intronic
1066501031 10:35994803-35994825 ATCATCCCTTTTAATATTTCTGG - Intergenic
1067264432 10:44725269-44725291 CTGTCTCCTTTTAATTTTTCAGG - Intergenic
1067344330 10:45427111-45427133 AAGCCTCCCTTTCATATTTCTGG - Intronic
1068049981 10:51937820-51937842 AATTTTCCATTTAATATTTTCGG - Intronic
1068065522 10:52126083-52126105 AATTTTCCATTTAATATTTTTGG + Intronic
1068486295 10:57663346-57663368 AATTTTCCATTTAAGATTTCTGG - Intergenic
1068506757 10:57910095-57910117 AATTTTCCATTTAATATTTTTGG + Intergenic
1068568442 10:58601934-58601956 ATGTTTACATTATATATTTCAGG + Intronic
1068900245 10:62260483-62260505 GTGTTTCCCTTAATTATTGCTGG - Intronic
1069128524 10:64668995-64669017 ATGTTTTTTTTTAATTTTTCTGG - Intergenic
1070450548 10:76553147-76553169 ATGTTGCCCTGTCATTTTTCAGG + Intronic
1070771240 10:79083570-79083592 ATGTGTCCCTCTAAGATCTCTGG + Intronic
1070836623 10:79451370-79451392 AATTTTCCATTTAATATTTTTGG + Intergenic
1070904963 10:80064041-80064063 ATATTTTCCTTTAATTTTACAGG + Intergenic
1071123539 10:82308592-82308614 GTTTTTCCCTATAATTTTTCTGG - Intronic
1071966794 10:90859537-90859559 AAATTTCCATTTAATATTTTCGG - Intergenic
1072000547 10:91191468-91191490 AACTTTCCATTTAATATTTTTGG + Intronic
1072267296 10:93742949-93742971 AACTTTCCATTTAATATTTTTGG - Intergenic
1073917264 10:108420023-108420045 ATTTTTTCATTTAATATTTTTGG + Intergenic
1074035295 10:109732654-109732676 ATGTTTGCCTTTAATCGTTAGGG - Intergenic
1074307207 10:112290049-112290071 AATTTTCCATTTAATATTTTTGG - Intronic
1074556699 10:114497858-114497880 TTGTTTGCCTTTAATAGTGCTGG + Intronic
1074821545 10:117183112-117183134 TTGTTTCCCTTTTATGTTCCAGG + Intergenic
1074833062 10:117263383-117263405 ATGCTTCCCTTCACTGTTTCTGG + Intronic
1074922643 10:118032688-118032710 AATTTTCCATTTAATATTTTTGG - Intronic
1075498440 10:122949653-122949675 AATTTTCCATTTAATATTTTTGG + Intronic
1077768327 11:5186707-5186729 TTATTTCCCTTTAATTTTTAAGG + Intergenic
1077848625 11:6052522-6052544 ATGCTTCCCAGTAAAATTTCTGG - Intergenic
1078294292 11:10050874-10050896 AATTTTCCATTTAATATTTTTGG + Intronic
1078543929 11:12232857-12232879 AATTTTCCTTTTAATATTTTTGG - Intronic
1079289466 11:19174286-19174308 ATTTTTCATTTTAATATTTTTGG + Intronic
1079643241 11:22832351-22832373 AATTTTCCATTTAATATTTTTGG - Intergenic
1079703608 11:23584159-23584181 ATATTTCCCTTTAATGGTTTAGG + Intergenic
1079711498 11:23688691-23688713 ATTTTTCCCTTCAAATTTTCTGG - Intergenic
1079909035 11:26286156-26286178 ATTTTTCCCTTTGTCATTTCAGG - Intergenic
1079976960 11:27103905-27103927 ATGTCTCCTTTTAATAGTTAAGG - Intronic
1081032893 11:38109586-38109608 TTGTTTCCGATTAATTTTTCTGG + Intergenic
1081100707 11:38998552-38998574 ATTTTTACCTTTAACACTTCTGG + Intergenic
1081366943 11:42247194-42247216 TTGTTTATCTTTAATATGTCTGG - Intergenic
1081480729 11:43486217-43486239 AATTTTCCATTTAATATTTTTGG - Intronic
1082325016 11:51129219-51129241 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082335197 11:51276793-51276815 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082336957 11:51302302-51302324 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082351869 11:51518901-51518923 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082353274 11:51539306-51539328 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082354454 11:51556306-51556328 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082364036 11:51696580-51696602 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082365267 11:51714437-51714459 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082381034 11:51943104-51943126 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082381799 11:51954284-51954306 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082391279 11:52092849-52092871 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082478662 11:53357236-53357258 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082545782 11:54326907-54326929 ATGTTTCTTTTTAGTTTTTCTGG - Intergenic
1082961755 11:58924518-58924540 ATGTTTCCCTTTAATATTTCTGG + Intronic
1085029439 11:73261015-73261037 ATTTTTCCTTTTTAAATTTCTGG - Intergenic
1085427446 11:76417188-76417210 ATGTTTCCATTCCATATTTCAGG - Intergenic
1085812516 11:79697243-79697265 CTGTTTAGCTTAAATATTTCTGG + Intergenic
1086553993 11:88087943-88087965 ATATTTCTCCTTAATATTACAGG + Intergenic
1087256395 11:95959563-95959585 AATTTTCCATTTAATATTTTTGG - Intergenic
1087274112 11:96143358-96143380 CTGTTTCCTATTAATATTTGAGG - Intronic
1087988540 11:104716711-104716733 ATTTTACCCTTTATTATTTATGG - Intergenic
1088038253 11:105344564-105344586 TTTTTTCTATTTAATATTTCAGG - Intergenic
1088069254 11:105761442-105761464 ATATTTCCCTTTAAAGTTTTTGG - Intronic
1088326897 11:108610006-108610028 AAGTTTCCATTTAATATTTTCGG + Intergenic
1088354915 11:108932806-108932828 ATTTTTACTTTTAATATTTTTGG + Intronic
1089881218 11:121775523-121775545 AATTTTCCATTTAATATTTTTGG + Intergenic
1089899494 11:121965857-121965879 AGGTTTTCCTTTTATATTTGAGG - Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090568998 11:128026958-128026980 AATTTTCCATTTAATATTTTTGG + Intergenic
1091158515 11:133397250-133397272 ATGTTTCCCTTCAATACCTAGGG + Intronic
1091474966 12:763628-763650 AATTTTCCATTTAATATTTTTGG + Intronic
1091874932 12:3925804-3925826 ATGTTTCATTTGAGTATTTCAGG - Intergenic
1091899212 12:4130673-4130695 ATGTTTCACTTTTAAATTTAGGG - Intergenic
1092174708 12:6395434-6395456 AATTTTCCATTTAATATTTTTGG - Intergenic
1092507896 12:9123599-9123621 AATTTTCCATTTAATATTTTTGG + Intergenic
1092633007 12:10405634-10405656 AGTTTTCCTTTTAATATTTTTGG + Intronic
1094408295 12:30142701-30142723 ATGTTTTCCTTTAACATTCTAGG - Intergenic
1095325961 12:40893017-40893039 ATGTTTCTATTTAATATTTTTGG - Intronic
1095377489 12:41547690-41547712 ATGTTTCTCTTTTCTATTCCTGG + Intronic
1095453044 12:42351419-42351441 ATGTTTCCTTTTGATCATTCTGG + Intronic
1095460336 12:42436875-42436897 AGTTTTCCATTTAATATTTTTGG + Intronic
1095520223 12:43055021-43055043 ATTTTTCCCATTAATAACTCTGG + Intergenic
1096065105 12:48733476-48733498 AATTTTCCATTTAATATTTTTGG - Intergenic
1096280170 12:50245907-50245929 ATGCTTCCCTGAAATATTTTGGG - Intronic
1097453130 12:59760820-59760842 AATTTTCCATTTAATATTTTTGG + Intronic
1097723789 12:63051587-63051609 ATGATTCCCTTCACTCTTTCTGG - Intergenic
1097820573 12:64124696-64124718 CTGTTTGCCTTCAATATTTGTGG + Intronic
1097952932 12:65452909-65452931 ATGTTTCCCCAAAATATGTCTGG - Intronic
1098038616 12:66332395-66332417 AATTTTCCATTTAATATTTTTGG - Intronic
1098204827 12:68097443-68097465 AATTTTCCATTTAATATTTTTGG - Intergenic
1098381417 12:69873720-69873742 AATTTTCCATTTAATATTTTTGG + Intronic
1098724117 12:73940546-73940568 TTGTTTACCTTTTATATTTTTGG + Intergenic
1098842844 12:75497201-75497223 ATGTTTCCCTTTAAAAATCTAGG + Exonic
1099303164 12:80922728-80922750 AATTTTCCATTTAATATTTTTGG - Intronic
1099353157 12:81599010-81599032 ATGTTTGCATTCAATATTTTTGG - Intronic
1099412373 12:82347202-82347224 AATTTTCCATTTAATATTTTTGG + Intronic
1099413026 12:82355325-82355347 ATTTTTCAATTTAATATTTTTGG - Intronic
1099440939 12:82699002-82699024 AATTTTCCTTTTAATATTTTTGG + Intronic
1100133358 12:91523326-91523348 ATATTTACTGTTAATATTTCTGG + Intergenic
1100778507 12:97998632-97998654 AAGTTTCCTTTGAACATTTCTGG - Intergenic
1101070078 12:101064768-101064790 AATTTTCCATTTAATATTTTTGG - Intronic
1101420100 12:104543802-104543824 ATTTTTCCCTTTACTTTTTTGGG + Intronic
1102314650 12:111877323-111877345 TTTTTTTTCTTTAATATTTCTGG + Intronic
1103310231 12:120000579-120000601 AATTTCCCCTTTAATTTTTCTGG - Intronic
1103585155 12:121947592-121947614 ATGTATCTCTTTAATATGCCTGG + Intronic
1104248607 12:127067605-127067627 ATTTTTGTCTTTATTATTTCTGG + Intergenic
1105737544 13:23286890-23286912 AATTTTCCATTTAATATTTTAGG + Intronic
1105981359 13:25519440-25519462 TTGGTTCCCTTTAGTATCTCCGG + Intronic
1106152367 13:27117979-27118001 ATGTTTACCTTGAAAATTCCCGG + Intronic
1106371192 13:29135007-29135029 AAGTGTCCATTTAATATTTTCGG - Intronic
1107298631 13:38941589-38941611 AATTTTCCATTTAATATTTTTGG - Intergenic
1107384304 13:39891201-39891223 CTTTTACCCTTAAATATTTCAGG - Intergenic
1108092399 13:46862570-46862592 CTGTTTCTCTTTTCTATTTCTGG - Intronic
1108218504 13:48209097-48209119 ATGTTTTCCTTTATTCTTACAGG + Intergenic
1108894072 13:55300888-55300910 ACCATTCCCTTTAATAATTCTGG - Intergenic
1109296753 13:60542104-60542126 ATTTTTCCCTTTGATACTTATGG + Intronic
1109344321 13:61096480-61096502 CTGTTTACTTTTAATATTTTTGG + Intergenic
1109345441 13:61109916-61109938 GTATTTCCTTTTCATATTTCAGG + Intergenic
1109553100 13:63932277-63932299 TTCTTTCTCTTTAATATTACTGG - Intergenic
1109651590 13:65334751-65334773 ATGTTTTCAGTTTATATTTCTGG + Intergenic
1109803498 13:67406030-67406052 AAGTTTTCCTTTAACATTTCAGG - Intergenic
1109852220 13:68080444-68080466 TTGTTTCCTTTTACTATTTCTGG - Intergenic
1109965784 13:69693076-69693098 TTGTTTCCTTTTCAAATTTCAGG + Intergenic
1110286343 13:73754074-73754096 ATGTTTTCCTTTAATGCTCCTGG + Intronic
1110457052 13:75700864-75700886 AATCTTCCTTTTAATATTTCTGG + Intronic
1110638383 13:77791897-77791919 TTGTTTCCCTATAATATTACTGG - Intergenic
1110854509 13:80281495-80281517 AATTTTCCATTTAATATTTCTGG + Intergenic
1111032445 13:82621337-82621359 ATGTGTCCATATAATATTTAGGG + Intergenic
1111263277 13:85772479-85772501 AATTTTCCATTTAATATTTTTGG - Intergenic
1111306345 13:86418047-86418069 AATTTTCCATTTAATATTTTTGG - Intergenic
1111678724 13:91417948-91417970 AACTTTCCCTTTCATATTTTTGG - Intronic
1111716136 13:91881133-91881155 ATTTTTCTGTTTATTATTTCTGG - Intronic
1112117061 13:96367683-96367705 ATGTTACCCATTATTATTGCTGG + Intronic
1112632915 13:101181381-101181403 ATTTTTCCTTTTAAAAGTTCTGG + Intronic
1113019336 13:105865718-105865740 ATTTTTTCCTATAATATTTTTGG - Intergenic
1113141223 13:107152322-107152344 ATGTTTCTCTTCAATTTTTTTGG + Intergenic
1114557459 14:23570206-23570228 ATCTTTTCCTTTTTTATTTCTGG + Intronic
1114592129 14:23875978-23876000 ATGTTTCCTTCTAAAAATTCAGG - Intergenic
1115078998 14:29427829-29427851 TTGTTGCCCTTTACTATTTGGGG - Intergenic
1115573352 14:34687617-34687639 AGTTTTCCCTTTAATCTTCCAGG + Intergenic
1115748831 14:36467387-36467409 AATTTTCCATTTAATATTTTTGG - Intergenic
1115805329 14:37044504-37044526 ATGCTTACCTATAATCTTTCAGG - Intronic
1116609621 14:47051076-47051098 ATATTTCCCTTTATTATCTCAGG - Intronic
1116832468 14:49735575-49735597 ATGTATTACTTTAACATTTCTGG + Intronic
1117171883 14:53108605-53108627 AATTTTCCATTTAATATTTTTGG + Intronic
1118246210 14:64113512-64113534 ATGTCTGCGTTTAATGTTTCCGG - Exonic
1118483771 14:66194991-66195013 ATATTTCCTTCTAATATTTCTGG - Intergenic
1119467919 14:74874074-74874096 ATCTATCCCTTTATTATTTTTGG - Intergenic
1119654289 14:76406060-76406082 ATTTTTCCTTTTCATATTTGGGG + Intronic
1119974800 14:79013622-79013644 TGCTTTCCCTTTAATAATTCAGG + Intronic
1120487722 14:85135706-85135728 ATGTATCCATTTAGTATTTTTGG - Intergenic
1120692766 14:87611577-87611599 AATTTTCCATTTAATATTTCTGG + Intergenic
1121722746 14:96122318-96122340 AATTTTCCATTTAATATTTTTGG + Intergenic
1122071197 14:99206396-99206418 AATTTTCCATTTAATATTTTTGG - Intronic
1122220307 14:100234383-100234405 AAGTATCCCTTTAATAGCTCAGG + Intergenic
1122472473 14:101980007-101980029 ATGTTACTCTTTAATATCTTTGG + Intronic
1123705829 15:22950585-22950607 AGTTTTCCGTTTAATATTTTTGG - Intronic
1123917347 15:25045614-25045636 AAGTCTCCATTTAATTTTTCTGG + Intergenic
1124102130 15:26705362-26705384 ATGTTTCCTTTTCAAAATTCAGG - Intronic
1124470722 15:29983292-29983314 AATTTTCCATTTAATATTTTGGG + Intergenic
1125162490 15:36662152-36662174 ATGTTGCTGTTTAATCTTTCTGG + Intronic
1125564586 15:40666826-40666848 ATTTTTTCCCTAAATATTTCTGG - Intergenic
1125910222 15:43431206-43431228 AATTTTCCATTTAGTATTTCTGG + Intronic
1126132836 15:45359725-45359747 ATTTTTCTATTTAATATTTTTGG - Intergenic
1126300167 15:47185456-47185478 CTGTTTCCCTTAAAGATTCCTGG + Intronic
1126592240 15:50352206-50352228 CTGTTACCTGTTAATATTTCTGG + Intronic
1126655994 15:50978279-50978301 CTGTTTCCCCTTATTATTTCTGG - Intronic
1127199374 15:56626537-56626559 ATGCTTTACTTTAATATTTCGGG + Intergenic
1127229372 15:56971727-56971749 AATTTTCCATTTAATATTTCTGG + Intronic
1127444316 15:59044813-59044835 ATGTTTCCCTTTTAAAATTTTGG + Intronic
1127943240 15:63722505-63722527 AATTTTCCATTTAATATTTTTGG - Intronic
1129510167 15:76115778-76115800 ATGTATCCCTTCTATATTTGGGG + Intronic
1130059872 15:80561590-80561612 AATTTTCCATTTAATATTTTTGG - Intronic
1131126334 15:89860564-89860586 AATTTTCCATTTAATATTTTTGG + Intronic
1131538844 15:93259336-93259358 AATTTTCCATTTAATATTTTTGG - Intergenic
1131668937 15:94599037-94599059 AATTTTCCATTTAATATTTTTGG - Intergenic
1131762244 15:95637055-95637077 ATGTTTCACTTTAATTGATCTGG - Intergenic
1132213323 15:100042837-100042859 AATTTTCCTTTTAATATTTTTGG + Intronic
1135884475 16:26293115-26293137 CTGTTTTCCTTTTTTATTTCTGG - Intergenic
1135985452 16:27180484-27180506 AATTTTCCATTTAATATTTTGGG - Intergenic
1136713019 16:32254877-32254899 ATGTTTCCATTAAGTTTTTCAGG + Exonic
1136754897 16:32674556-32674578 ATGTTTCCATTAAGTTTTTCAGG - Exonic
1136813216 16:33195813-33195835 ATGTTTCCATTAAGTTTTTCAGG + Exonic
1136819692 16:33305893-33305915 ATGTTTCCATTAAGTTTTTCAGG + Exonic
1136826255 16:33362428-33362450 ATGTTTCCATTAAGTTTTTCAGG + Exonic
1136831321 16:33461199-33461221 ATGTTTCCATTAAGTTTTTCAGG + Exonic
1137095834 16:36255197-36255219 AAATTTCCCTTTAATATAGCAGG - Intergenic
1137735161 16:50718473-50718495 AATTTTCCATTTAATATTTTTGG + Intronic
1138175639 16:54895916-54895938 ATGTTTGCCTTTAATGTCTACGG + Intergenic
1138569753 16:57862387-57862409 AATTTTCCATTTAATATTTTTGG + Intronic
1138946073 16:61851606-61851628 ATGTTTGCCTGTAATATTTTGGG - Intronic
1139155783 16:64440380-64440402 ATGTGTCCCACTTATATTTCAGG + Intergenic
1141797025 16:86281913-86281935 ATGTAGCCCATTTATATTTCTGG - Intergenic
1142268878 16:89078832-89078854 AATTTTCCATTTAATATTTTTGG - Intergenic
1202991792 16_KI270728v1_random:18783-18805 ATGTTTCCATTAAGTTTTTCAGG + Intergenic
1203057038 16_KI270728v1_random:934886-934908 ATGTTTCCATTAAGTTTTTCAGG - Intergenic
1143335285 17:6167547-6167569 CTGTTTGCCTTAAACATTTCAGG - Intergenic
1143797622 17:9350322-9350344 AATTTTCCATTTAATATTTTAGG + Intronic
1146086454 17:29834609-29834631 ATGTTTTCTTTTATTGTTTCTGG + Intronic
1146362683 17:32190510-32190532 ATGTATCCCTTTATTATGTGAGG + Intronic
1147196843 17:38772263-38772285 AATTTTCCATTTAATATTTTTGG - Intronic
1147569716 17:41561620-41561642 AATTTTCCATTTAATATTTTTGG - Intergenic
1147795729 17:43041358-43041380 AATTTTCCTTTTAATATTTTTGG + Intergenic
1148320297 17:46745217-46745239 ATGTATCACTTTAATATATTCGG + Intronic
1149257802 17:54846946-54846968 AGTTTTCCATTTAATATTTTTGG - Intergenic
1149276677 17:55048018-55048040 ATGTTTACCTTTTCTCTTTCTGG - Intronic
1149447785 17:56727099-56727121 AATTTTCCATTTAATATTTTTGG + Intergenic
1149520154 17:57312580-57312602 AAGTGACCCTTTCATATTTCAGG + Intronic
1149881382 17:60295467-60295489 AAATTTCCATTTAATATTTTTGG - Intronic
1149907740 17:60542145-60542167 AATTTTCCATTTAATATTTTTGG - Intergenic
1149954722 17:61035942-61035964 AATTTTCCGTTTAATATTTTTGG + Intronic
1150028733 17:61708227-61708249 AATTTTCCATTTAATATTTTTGG - Intronic
1150528979 17:65957105-65957127 AATTTTCCATTTAATATTTTTGG + Intronic
1150529761 17:65964781-65964803 ATGTTCCTCTTTAATTTTTGAGG + Intronic
1150543594 17:66129823-66129845 CTTTTTCCCTTTTGTATTTCAGG - Exonic
1150718008 17:67588393-67588415 AATTTTCCATTTAATATTTTTGG - Intronic
1151220961 17:72612745-72612767 CTCTTTCTCTTTAACATTTCTGG - Intergenic
1151271250 17:72997625-72997647 AATTTTCCATTTAATATTTTTGG - Intronic
1153184749 18:2473634-2473656 GTGTCTTCCTTTAAGATTTCAGG - Intergenic
1153212305 18:2780467-2780489 ATGTTTCTATTTCATAATTCGGG - Intronic
1153224163 18:2885166-2885188 ATGGCCACCTTTAATATTTCCGG + Intronic
1153390220 18:4548875-4548897 GTCTTTTCCTTTATTATTTCTGG - Intergenic
1153813309 18:8770915-8770937 ACCTATCCCTTTAATAGTTCCGG - Intronic
1154033177 18:10771700-10771722 AATTTTCCATTTAATATTTTTGG - Intronic
1155488780 18:26376841-26376863 AGGTTTCCCTTCTATATTTATGG + Intronic
1155503409 18:26509689-26509711 ATGTTTTCCTTTACTGTTTTGGG - Intronic
1155727835 18:29111916-29111938 ATGTTTCCATTTACTTTTTCTGG + Intergenic
1155841571 18:30651381-30651403 AATTTTCCATTTAATATTTTTGG - Intergenic
1156737979 18:40286101-40286123 ATTTTTCCATTTAATCTTCCTGG - Intergenic
1156785732 18:40911944-40911966 AATTTTCCATTTAATATTTTTGG - Intergenic
1157763027 18:50278258-50278280 AATTTTCCATTTAATATTTTTGG + Intronic
1158252714 18:55507476-55507498 AATTTTCCATTTAATATTTTTGG + Intronic
1158334746 18:56403714-56403736 ATATTTTCCATTACTATTTCTGG - Intergenic
1158470402 18:57730933-57730955 ATGTATCCTTTAAAAATTTCTGG + Intronic
1158595609 18:58813001-58813023 AATTTTCCATTTAATATTTTTGG + Intergenic
1158706771 18:59799529-59799551 ATGTTTCTCTTTAAGGTTTGTGG - Intergenic
1158763308 18:60416129-60416151 AGCTTTCCCTTTAAAATTTTTGG + Intergenic
1158907773 18:62030487-62030509 CCTTTTCCCTTTGATATTTCTGG - Intergenic
1159077458 18:63697880-63697902 ATGCTTCTCTTTTATTTTTCAGG - Intronic
1159565597 18:70044892-70044914 AATTTTCCATTTAATATTTCTGG + Intronic
1159849078 18:73504471-73504493 AGTTTTCTTTTTAATATTTCTGG - Intergenic
1160212494 18:76894185-76894207 AATTTTCCATTTAATATTTTTGG - Intronic
1160468882 18:79108390-79108412 ATGTTCACCATTAATATTTTTGG - Intronic
1161467262 19:4438078-4438100 CTGTTGCCCTTTATTATTTTAGG + Intronic
1161823836 19:6548672-6548694 ATATTTCTATTTAATATTTGAGG + Intergenic
1162912179 19:13853967-13853989 AATTTTCCATTTAATATTTTTGG + Intergenic
1165667508 19:37646006-37646028 ATTTTTCCATTTTATATTTTTGG - Intronic
1167770771 19:51515312-51515334 ATTTTTGCCTTCTATATTTCTGG + Intergenic
1168253158 19:55152385-55152407 AATTTTCCATTTAATATTTTTGG - Intronic
1168456955 19:56519771-56519793 AATTTTCCATTTAATATTTTTGG - Intronic
925459967 2:4053509-4053531 TGGTTTCCCTTGAATATTTGAGG + Intergenic
925831079 2:7896172-7896194 ATGCTTCTCTTTAATCTCTCAGG - Intergenic
925919636 2:8630177-8630199 ATGCTCACCTTTAATAATTCAGG + Intergenic
926430728 2:12783350-12783372 ATTTTTTCCTTTAAAATTCCTGG + Intergenic
926481015 2:13394863-13394885 GTGTTTCACTTTTATATATCAGG - Intergenic
926846317 2:17144534-17144556 ATTTTTCCATTTAATATTTTGGG + Intergenic
927099691 2:19778520-19778542 AAGTTTCCACTGAATATTTCTGG - Intergenic
927217942 2:20680041-20680063 ATGTGTTCCTTAAATATTTCTGG + Intergenic
927260898 2:21088928-21088950 ATTTTTCACTTTAAGATTTCTGG + Intergenic
928258701 2:29747699-29747721 TTGTTTCTCTTTTATATTTCTGG - Intronic
928375867 2:30772683-30772705 AAGTTTCCCTCTGTTATTTCTGG - Intronic
929021995 2:37562580-37562602 AATTTTCCGTTTAATATTTTTGG + Intergenic
929267241 2:39931614-39931636 ATGTTTCCCTTCCAAATTTATGG - Intergenic
929441083 2:41966297-41966319 AGGCTTTCCTTTCATATTTCGGG + Intergenic
930280617 2:49364267-49364289 GTGTTTCCCTTTTATATGTTTGG - Intergenic
930612422 2:53557816-53557838 ATGCTCCTTTTTAATATTTCTGG - Intronic
930887561 2:56344461-56344483 AATTTTCCATTTAATATTTTTGG + Intronic
930946048 2:57077246-57077268 TTGTTTTTCTTTAATTTTTCAGG + Intergenic
930985089 2:57575993-57576015 AAGTTTTCATTTAATATTTTCGG + Intergenic
931347522 2:61460208-61460230 AATTTTCCATTTAATATTTTTGG - Intronic
931506351 2:62931611-62931633 AACTTTCCATTTAATATTTTTGG - Intronic
931606293 2:64056071-64056093 AATTTTCCACTTAATATTTCTGG - Intergenic
931762240 2:65428620-65428642 ATGTTTCCCATTAATAAAACAGG - Intronic
932214016 2:69954671-69954693 ATGTTTCCCGGGAATATTTGGGG - Intergenic
932273977 2:70437472-70437494 CTTTTTACCTTTAATTTTTCTGG + Intergenic
933128692 2:78644925-78644947 ATTTCTCCATTTAATATTTTTGG - Intergenic
933239766 2:79907152-79907174 ATGTTCTGCTTTAAGATTTCAGG - Intronic
933347982 2:81114261-81114283 ATATTTCCATTTAATTTATCTGG + Intergenic
933582306 2:84141554-84141576 AACTTTCCATTTAATATTTTTGG + Intergenic
933631074 2:84659004-84659026 CTGTTTCTCTTTATTCTTTCAGG + Exonic
935505915 2:103902665-103902687 ACAATTCCCTTTACTATTTCTGG + Intergenic
935537393 2:104310075-104310097 ATATTTTCCTATAAAATTTCAGG - Intergenic
936167211 2:110131762-110131784 ATATTTCCAATTAATGTTTCTGG + Exonic
937481760 2:122268942-122268964 ATCTTTTCCTCTAATATTTTAGG - Intergenic
937588725 2:123588472-123588494 AATTTTCCATTTAATATTTTTGG + Intergenic
937838164 2:126495272-126495294 ATTATTTCCTTTTATATTTCAGG - Intergenic
938170729 2:129073569-129073591 ATGTTGGCTTTTAATATTTGTGG - Intergenic
938620367 2:133046118-133046140 ATTTTTCCATTTAATATTTTTGG + Intronic
938815516 2:134900202-134900224 AATTTTCCATTTAATATTTTTGG - Intronic
939161096 2:138589792-138589814 AATTTTCCATTTAATATTTTTGG + Intergenic
939171524 2:138701689-138701711 ATGTTGCTTTTTAATATTTCAGG + Intronic
939204931 2:139089057-139089079 ATGTCTTCTTTTTATATTTCTGG + Intergenic
939537682 2:143452422-143452444 AAGATCCCCTTTAATGTTTCGGG - Intronic
939620680 2:144415159-144415181 AAATTTCCATTTAATATTTAAGG + Intronic
939749918 2:146031450-146031472 ATTTTTCCCTTTAATATTTTAGG + Intergenic
939796762 2:146655212-146655234 ACCTTTCCATTTAATATTTCTGG - Intergenic
940456304 2:153906065-153906087 AATTTTCCATTTAATATTTTTGG + Intronic
941056331 2:160793189-160793211 ATGTGTCCCTTTCAAAATTCAGG - Intergenic
941450704 2:165656991-165657013 ATATTTTCATTTAATATTTTTGG - Intronic
941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG + Intergenic
941829647 2:169940826-169940848 AATTTTCCATTTAATATTTTCGG - Intronic
942109372 2:172665076-172665098 ATGTTTCCCTTTTTTCTTGCAGG + Intergenic
942338087 2:174912922-174912944 ATGTTTCAAATTAATATCTCTGG - Intronic
942641921 2:178069622-178069644 AAGTTGCCTTTTAATATTTTTGG - Intronic
942891278 2:180991904-180991926 ATTTTTCCATTTAATATTTTTGG + Intronic
943118649 2:183706985-183707007 ATGTTTTTCTTTAATATCTTGGG - Intergenic
943164125 2:184295914-184295936 TTTTTTCCCCTAAATATTTCTGG + Intergenic
943584177 2:189718472-189718494 ATTTATTCATTTAATATTTCTGG - Intronic
943845654 2:192643341-192643363 TTGATTCACTTTAATATTTATGG - Intergenic
944110449 2:196125855-196125877 GTGTTTCCCTTTAAGAAGTCAGG - Intergenic
944214550 2:197241130-197241152 ACATTCCCCTTTAATTTTTCAGG - Intronic
944376537 2:199051593-199051615 ATGATTCCTTTTAATATTATGGG - Intergenic
945354601 2:208824382-208824404 ATATTTCCCCTTGATTTTTCAGG - Intronic
945665468 2:212735982-212736004 AATTTTCCATTTAATATTTTTGG + Intergenic
946324748 2:218979618-218979640 ATTTTTCGCTTTATTTTTTCTGG - Intergenic
946392493 2:219425196-219425218 CTATCTCCCTTTAAGATTTCAGG - Intronic
946480776 2:220054522-220054544 ATCTTTTCCTTCAATATTTTAGG - Intergenic
946543732 2:220714256-220714278 ATGATTTCCTATAATATTTGGGG - Intergenic
946668034 2:222071669-222071691 TTGTTCCCCTTTTATATTTAAGG + Intergenic
947091865 2:226521055-226521077 ATGTATCCCTGTCCTATTTCTGG + Intergenic
947104175 2:226650865-226650887 GTTTTGACCTTTAATATTTCAGG + Intergenic
1168866855 20:1094044-1094066 AATTTTCCATTTAATATTTTTGG + Intergenic
1169755289 20:9036663-9036685 AAATTTTCCTTTAATATTTTTGG - Intergenic
1170450498 20:16478482-16478504 AATTTTCCATTTAATATTTTTGG - Intronic
1170758245 20:19224010-19224032 GTTTTTCCATTTAATATTTTTGG + Intronic
1170934166 20:20795581-20795603 ATGTTTCCCTTCTCTTTTTCTGG + Intergenic
1171536046 20:25890619-25890641 ATCTCTCTCTTGAATATTTCCGG - Intergenic
1174059081 20:47819639-47819661 ATGTTTTCCCTTAATTATTCAGG + Intergenic
1174679542 20:52392896-52392918 AATTTTCCATTTAATATTTTTGG + Intergenic
1177033619 21:16014389-16014411 AATTTTCCGTTTAATATTTTTGG - Intergenic
1177067130 21:16453658-16453680 ATGTTTCCATTTAATAGTATAGG - Intergenic
1177758467 21:25374610-25374632 AATTTTCCATTTAATATTTTTGG + Intergenic
1177759513 21:25387938-25387960 CTGTTTCCCATTAATTTTTGGGG - Intergenic
1178026637 21:28475654-28475676 ATGGTTCACTGTAATATTTAAGG - Intergenic
1178759690 21:35390354-35390376 AGCTTTCCCTTCAAAATTTCTGG + Intronic
1178998985 21:37436627-37436649 GTGTATCCCTTTAATTGTTCTGG + Intronic
1179142134 21:38734946-38734968 GTATTTGCCTTTAAAATTTCAGG - Intergenic
1179364668 21:40746552-40746574 ATGTTTTCCTTACATATTTGAGG - Intronic
1179447493 21:41442640-41442662 AAGTTTCCATTTGATATTCCTGG - Intronic
1179611373 21:42553720-42553742 ATCTTTCCCTTTAACATGTGAGG - Intronic
1180035659 21:45247089-45247111 AGGCTTATCTTTAATATTTCTGG - Intergenic
1181378482 22:22479956-22479978 AATTTTCCGTTTAATATTTTTGG - Intergenic
1182142573 22:27973965-27973987 ATGTGTCCCTTTAATGTGTTTGG + Intergenic
1182939610 22:34262909-34262931 AATTTTCCATTTAATATTTTTGG + Intergenic
1183921068 22:41168994-41169016 CTGTTTCACTTTAAAATTACTGG - Intronic
1184501651 22:44878362-44878384 AAATTTCCATTTAATATTTTTGG - Intergenic
1184906646 22:47491981-47492003 AAGTTTCCATTTATTATTTTTGG + Intergenic
1184939390 22:47750065-47750087 ATGTTTGCATTTTATATTTTCGG + Intergenic
1185135260 22:49067270-49067292 CTGTTTTCCTTTTATATTTGGGG + Intergenic
1185355044 22:50363444-50363466 TTTTTTCCCTTTCATATTCCTGG + Intronic
949326246 3:2868134-2868156 ATGTTTCCTATTAATGTTTTTGG - Intronic
950339296 3:12228576-12228598 ATATTTCCCTTTCATATCTCTGG + Intergenic
950398995 3:12756195-12756217 TTGTTTCTCATTATTATTTCAGG - Intronic
950822800 3:15779144-15779166 ATGGTCCCCTGTATTATTTCTGG - Intronic
950848350 3:16036721-16036743 ATGTTTCTCTTTTTTTTTTCTGG - Intergenic
951059758 3:18191505-18191527 ATTTTTCACATTATTATTTCAGG + Intronic
951146312 3:19231914-19231936 ATGTATTGATTTAATATTTCAGG - Intronic
951331250 3:21371154-21371176 AGTTTTCCATTTAATATTTTTGG - Intergenic
951603256 3:24400339-24400361 ATGTTTACATTTAAAATATCAGG - Intronic
951631396 3:24725181-24725203 ATTTTTCTCTTTCATATTTTGGG + Intergenic
951698942 3:25475351-25475373 ATGTTTACCTGTATTATATCGGG + Intronic
951820334 3:26802487-26802509 CTATTTCCCTTGAATTTTTCTGG - Intergenic
952355762 3:32582439-32582461 ATGTTTGCATTTAATGTTTGTGG + Intergenic
954520478 3:51221119-51221141 ATCTATCCCGTTAAGATTTCTGG + Intronic
955425609 3:58786440-58786462 AATTTTCCATTTAATATTTTTGG - Intronic
955557385 3:60152611-60152633 ATGTTTTCCTTTGTTATTTTGGG - Intronic
955994114 3:64660466-64660488 AATTTTCCATTTAATATTTAAGG - Intronic
956007212 3:64793080-64793102 ATATTTTCCTTTCATATTTTGGG + Intergenic
956102382 3:65782052-65782074 GTGTTTCCCTTTGATAGTTAGGG - Intronic
956739119 3:72261094-72261116 TTTTTTCCATTTAATATTTTGGG - Intergenic
956758383 3:72413278-72413300 AATTTTCCATTTAATATTTTTGG - Intronic
956971605 3:74532742-74532764 AATTTTCCATTTAATATTTTTGG + Intergenic
957692126 3:83585154-83585176 TTGTTTCCTTCTAATAATTCTGG + Intergenic
957924999 3:86797674-86797696 ATGTTGGCATTAAATATTTCTGG + Intergenic
959860438 3:111209287-111209309 ATGCTTACCTTTTCTATTTCAGG - Intronic
960766955 3:121142352-121142374 CTGATTCCTTTTAATATATCTGG - Intronic
960804227 3:121567306-121567328 AAGTTTCCATTTAATATTTTTGG + Intergenic
961023154 3:123527310-123527332 AATTTTCCATTTAATATTTTTGG - Intronic
962760601 3:138509644-138509666 AATTTTCCTTTTAATATTTTTGG - Intronic
962805866 3:138927108-138927130 ATATTTCCTTTTAATATGTAAGG - Intergenic
963507503 3:146205740-146205762 AATTTTCCATTTAATATTTTTGG + Intronic
965111121 3:164424502-164424524 AGGATTCTCTTTCATATTTCTGG + Intergenic
965468339 3:169060058-169060080 ATTTTTCTATTTAATATTTTGGG + Intergenic
966005651 3:175008417-175008439 AGTTTTCCATTTAATATTTCTGG + Intronic
966080410 3:175993337-175993359 AATTTTCCATTTAATATTTTTGG + Intergenic
968328081 3:197838915-197838937 CAGTTTCTCTTGAATATTTCTGG - Intronic
969689579 4:8696831-8696853 AATTTTCCATTTAATATTTTAGG - Intergenic
970017204 4:11525439-11525461 ATTTTTCCTATTAATCTTTCAGG - Intergenic
970490439 4:16568044-16568066 ATGGTTCACTCTAATATTTAAGG - Intronic
970978737 4:22072415-22072437 ATCTTTCCCTTTAAGAAGTCAGG - Intergenic
971152409 4:24047382-24047404 AAGTAGCCCTTAAATATTTCTGG + Intergenic
971597124 4:28544703-28544725 ATGTTTCCCTTTGCTTATTCTGG - Intergenic
971625021 4:28908324-28908346 ATTTTTCTTTTTAATATTACTGG + Intergenic
971918341 4:32904844-32904866 ATGTTTTCTTTTACTGTTTCAGG - Intergenic
972804672 4:42516879-42516901 ATCTGTCACTTTAATATATCAGG - Intronic
972976437 4:44642007-44642029 GTGTGTCCCTTTCATTTTTCTGG - Intronic
973603791 4:52567094-52567116 AGGTCTCCCTTTAATATTTAGGG + Intergenic
973739211 4:53902852-53902874 ATTTTTCCATTTAATATTTTTGG - Intronic
973873610 4:55191646-55191668 ATGTATCCCTTTTACATTTAAGG - Intergenic
974501337 4:62707466-62707488 ATGTTTACCATTTATTTTTCTGG + Intergenic
974592190 4:63967087-63967109 ATTTTTCCCTTTTATCTTACTGG - Intergenic
974753051 4:66166314-66166336 AATTTTCCATTTAATATTTTTGG - Intergenic
975583109 4:75924445-75924467 AATTTTCCATTTCATATTTCTGG + Intronic
976959619 4:90953031-90953053 ATCTTTACCTTTAGTATTTTGGG + Intronic
976992471 4:91384108-91384130 ATGTTTGCCCTAAATATTGCTGG + Intronic
977144836 4:93425693-93425715 GTGTTTCCCTTTTCAATTTCTGG + Intronic
977295196 4:95201970-95201992 ATTTTTCCCTCTACTATTGCTGG + Intronic
977977496 4:103284441-103284463 AATTTTCCATTTAATATTTTTGG - Intergenic
978148009 4:105399836-105399858 AATTTTCCATTTAATATTTCTGG - Intronic
978767780 4:112422212-112422234 AATTTTCCATTTAATATTTTTGG + Intronic
979356050 4:119707061-119707083 AATTTTCCATTTAATATTTTTGG + Intergenic
979425347 4:120557647-120557669 AGTTTTCCATTTAATATTTTTGG + Intergenic
979512043 4:121565899-121565921 ATGTTTCCCTTGTGTTTTTCAGG - Intergenic
979743766 4:124183047-124183069 ATATTTGCAATTAATATTTCTGG + Intergenic
979744336 4:124191795-124191817 CCTTTTCCCTTTGATATTTCAGG - Intergenic
980388468 4:132116747-132116769 ATGTTCCCATTGAATTTTTCTGG - Intergenic
980661269 4:135862040-135862062 AAATTTCCATTTAATATTTTTGG - Intergenic
981527766 4:145723405-145723427 CTGTTTTCCTTTAATATGTTGGG - Intronic
981826412 4:148947024-148947046 ATGTTTTACTTTAATCTTTATGG - Intergenic
982389019 4:154844057-154844079 TTGTTTTCTTTTAATATTTTAGG - Intergenic
982503354 4:156187666-156187688 ATGTTTTTCTTTAATATACCTGG + Intergenic
982729894 4:158944784-158944806 ATTTTTCTCCTTAATAATTCTGG + Intronic
982790847 4:159589593-159589615 AAGTTTCCATTTAATAGTTTTGG + Intergenic
983109872 4:163736466-163736488 AATTTTCCATTTAATATTTTTGG + Intronic
983332638 4:166351127-166351149 TTGTTACACTCTAATATTTCAGG + Intergenic
983378144 4:166956593-166956615 AATTTTCCATTTAATATTTTTGG + Intronic
983909701 4:173224288-173224310 ATTTTTCCCATTATTTTTTCAGG + Intronic
984049989 4:174854005-174854027 AACTTTCCATTTAATATTTTCGG + Intronic
984128818 4:175847338-175847360 AATTTTCCATTTAATATTTTTGG - Intronic
984328478 4:178284627-178284649 TTGTTTCCCTCTAATTTTTAAGG - Intergenic
985157132 4:187001059-187001081 ATATTTCCCTTTAAAATGTCTGG - Intergenic
986207863 5:5643124-5643146 ATGTTTGCACTTTATATTTCTGG - Intergenic
986483796 5:8215196-8215218 ATGTTTTCCTTTAAAAGTTAAGG + Intergenic
986595184 5:9414183-9414205 ATATTTCATTTTAATATTTGAGG + Intronic
986900390 5:12423962-12423984 AGTTTTACCTTTCATATTTCTGG - Intergenic
986924192 5:12726539-12726561 ATATTTCCATTTAATAGTTGAGG - Intergenic
987030949 5:13976291-13976313 AATTTTCCATTTAATATTTTTGG - Intergenic
987102145 5:14601191-14601213 ATTGTTCCCTTTTATCTTTCAGG + Exonic
987576464 5:19734654-19734676 ATGTTCTCCTTTAATGTTTAGGG + Intronic
987884110 5:23790527-23790549 ATATTTACATTTTATATTTCTGG + Intergenic
988147418 5:27328559-27328581 AAGTTTCCATTGAATATTTTTGG - Intergenic
988149129 5:27353344-27353366 ATGTTTCTTTTTAATTATTCTGG - Intergenic
988206968 5:28150300-28150322 AACTTTCCATTTAATATTTTTGG + Intergenic
988343614 5:30008267-30008289 ATGTTTCTGTTTAAAAGTTCTGG + Intergenic
988883826 5:35533589-35533611 AATTTTCCATTTAATATTTTTGG + Intergenic
989474537 5:41858971-41858993 AATTTTCCATTTAATATTTGTGG - Intronic
989555706 5:42792143-42792165 ATGTTTCCATTCTATTTTTCAGG + Intronic
989973891 5:50558336-50558358 ATTTTTCCCTTAAATGTTTTGGG + Intergenic
990093622 5:52085385-52085407 ATATTTCCATTTATTTTTTCTGG + Intergenic
991099089 5:62772143-62772165 AATTTTCCATTTAATATTTTTGG + Intergenic
991274439 5:64827800-64827822 AATTTTCCATTTAATATTTCTGG - Intronic
991374828 5:65955811-65955833 AATTTTCCATTTAATATTTTTGG - Intronic
992145077 5:73838428-73838450 ATGTTTCCCATTAATTTTCAAGG + Intronic
992211358 5:74482994-74483016 AATTTTCCATTTAATATTTTTGG - Intergenic
992435654 5:76753363-76753385 ATGTTTCCTTTTAATTTGTCTGG - Intergenic
992483939 5:77177888-77177910 ATTTTTCAATTTAATATTTTTGG + Intergenic
993235853 5:85308962-85308984 ATGTTTTCCTTCCATATTTCTGG - Intergenic
993372833 5:87113979-87114001 AATTTTCCGTTTAATATTTTCGG - Intergenic
993485621 5:88480601-88480623 ATGTTTGCCTTTAAGATTTTAGG - Intergenic
993571890 5:89550923-89550945 AATTTTCCATTTAGTATTTCGGG - Intergenic
993867057 5:93208438-93208460 ATGTTTACTTTTGCTATTTCTGG + Intergenic
993923494 5:93836785-93836807 ATGGTTCAATTTAATATTTTGGG - Intronic
994101821 5:95901968-95901990 AATTTTCCTTTTAATATTTTTGG + Intronic
994443269 5:99837318-99837340 CTGTTTCCCCTAATTATTTCAGG + Intergenic
994794332 5:104276023-104276045 ATATTTCCTTTTAAAATATCAGG - Intergenic
995737642 5:115319500-115319522 ATTTTTCCCTTCAATGTCTCTGG - Intergenic
996924678 5:128810545-128810567 TTTTTTTCCTTTAATATTTATGG - Intronic
997137300 5:131340218-131340240 AAATTTCCATTTAATATTTTTGG - Intronic
997789532 5:136744769-136744791 ATGTTTCTCTTTTTTATTTCTGG - Intergenic
997845279 5:137280298-137280320 ATGTTTTCATTTATTATTTGGGG + Intronic
998058584 5:139100770-139100792 TTCTATCCCTTTAATTTTTCAGG - Intronic
998586489 5:143432525-143432547 GTCTTTCCCCTAAATATTTCTGG - Intronic
1000099347 5:158000165-158000187 ATCTATCTCATTAATATTTCAGG - Intergenic
1000457570 5:161470741-161470763 AATTTTCCATTTAATATTTTCGG + Intronic
1000586502 5:163105778-163105800 ATTGTTCCTTTTAATCTTTCTGG + Intergenic
1001499563 5:172219331-172219353 ATTTTTCCATTTAATATTTTTGG - Intronic
1003301274 6:4884958-4884980 AATTTTCCATTTAATATTTTTGG - Intronic
1003693445 6:8377563-8377585 AAGTTTCCATTTAATATTTCTGG - Intergenic
1003949648 6:11105754-11105776 ATTTTTCCCCTTCAGATTTCAGG + Intronic
1004294851 6:14401236-14401258 TTGTGTCCCTTTTATATTTAAGG - Intergenic
1004577755 6:16914581-16914603 CTATTTCCCATCAATATTTCAGG + Intergenic
1004703501 6:18101398-18101420 ATCTTTCCCTTTAATGGTTCAGG + Intergenic
1008067485 6:47064621-47064643 AATTTTCCATTTAATATTTTTGG + Intergenic
1008134222 6:47755014-47755036 ATTATTTCTTTTAATATTTCTGG - Intergenic
1008200703 6:48585848-48585870 ATGTCTGCCTTTAACATTTTAGG - Intergenic
1008554310 6:52659945-52659967 ATTTTTCCATTTAATATTTTTGG - Intergenic
1009721659 6:67479365-67479387 ATTTTTAGCTTTAACATTTCTGG + Intergenic
1009919567 6:70040548-70040570 ATATACCCCTTTATTATTTCAGG + Intronic
1010056154 6:71567632-71567654 AGTTTTCCATTTAATATTTTTGG - Intergenic
1010059824 6:71609611-71609633 ATGTTTGTCTTTATTATTTTGGG + Intergenic
1010408676 6:75535742-75535764 AATTTTCCATTTAATATTTGTGG + Intergenic
1010412834 6:75580350-75580372 AATTTTCCATTTTATATTTCCGG + Intergenic
1011005925 6:82645597-82645619 ATGTTCACCTGTAATAGTTCTGG - Intergenic
1011117566 6:83910479-83910501 ACCTTTCCCTTAAATCTTTCTGG - Intronic
1011262709 6:85485502-85485524 TTTTTTTCCTTTAATGTTTCAGG + Intronic
1011270597 6:85575559-85575581 TTGTTTCTCTTTAATATTTGTGG - Intronic
1011739644 6:90347178-90347200 AGATTTCTCTTTAACATTTCAGG - Intergenic
1012489987 6:99771783-99771805 ATTTTTCCCTTTAAGCTTTTTGG + Intergenic
1012708601 6:102567734-102567756 AATTTTCCATTTAATATTTTGGG + Intergenic
1013218449 6:108053259-108053281 AATTTTCCATTTAATATTTTTGG + Intronic
1013219216 6:108062411-108062433 AATTTTCCATTTAATATTTTTGG + Intronic
1013438895 6:110141049-110141071 AATTTTCCATTTAATATTTTTGG + Intronic
1013481119 6:110553612-110553634 ATGGTTCCCTCTAATCTTTTTGG + Intergenic
1013585131 6:111571531-111571553 ATATTTCCCTTTCTCATTTCTGG - Intronic
1013640036 6:112065381-112065403 ATGTTACCTTTTAAAATTTGGGG - Intronic
1013708067 6:112863083-112863105 AATTTTCCATTTAATATTTTTGG + Intergenic
1013713862 6:112934219-112934241 AGTTTTCCCTTTAACATTTAAGG + Intergenic
1013940471 6:115655215-115655237 AAATTTCCCTTTATTATTTTAGG + Intergenic
1014027549 6:116667170-116667192 ATGCTTTCCTGTAATATTTGTGG - Exonic
1014194924 6:118544290-118544312 GTGTTTCCCTTTGTTATTTTTGG + Intronic
1014602582 6:123432833-123432855 AACTTTTCCTTTAATATCTCTGG + Intronic
1015610034 6:135007136-135007158 ATGTGATCCTGTAATATTTCTGG + Intronic
1015738314 6:136425221-136425243 AGTTTTCCATTTAATATTTTTGG + Intronic
1015799136 6:137043498-137043520 ATTTTTCCTTTTAATATTCCCGG - Intronic
1016817766 6:148319456-148319478 AGTTTTCCATTTAATATTTTAGG - Intronic
1017244968 6:152214479-152214501 ATGTATCCCTTCCATAATTCAGG + Intronic
1017686888 6:156922704-156922726 TTCTTACCCTTTAATCTTTCTGG + Intronic
1018590106 6:165410225-165410247 AAGTTCACCTTTAATATTTTAGG - Intronic
1020145957 7:5643299-5643321 ATTTTTCACTTTTATATTACTGG - Intronic
1020349882 7:7207965-7207987 AGTTTTCCATTTAATATTTTTGG - Intronic
1020503608 7:8955290-8955312 AAATTTCCATTTAATATTTTGGG + Intergenic
1021342026 7:19476757-19476779 ATTTTTCCTTGTAATATCTCCGG + Intergenic
1021408028 7:20296779-20296801 AATTTTCCATTTAATATTTTTGG + Intergenic
1021550509 7:21866448-21866470 TTGTTTCCCTATCATATTACAGG + Exonic
1021557752 7:21938839-21938861 ATTTTTCTTTTTAAAATTTCTGG - Intronic
1021740794 7:23683279-23683301 ATGTTTTCCCATAATATTTTGGG + Intronic
1021846043 7:24763618-24763640 AAATTTCCATTTAATATTTTTGG + Intergenic
1022247128 7:28571241-28571263 AATTTTCCTTTTAATATTTTTGG + Intronic
1022433161 7:30347975-30347997 ATGTTTTGCCTTAATATCTCAGG + Intronic
1022751653 7:33233921-33233943 ATTTTTCAATTTAATATTTCTGG - Intronic
1023046967 7:36218644-36218666 AATTTTCCATTTAATATTTTTGG + Intronic
1023153362 7:37223230-37223252 TTGTTTCATTTTATTATTTCTGG - Intronic
1023678804 7:42661602-42661624 AATTTTCCATTTAATATTTTTGG + Intergenic
1024206827 7:47170199-47170221 ATGTATGCATTAAATATTTCTGG - Intergenic
1025235828 7:57234387-57234409 ATGTTTTCCCTTAATTATTCAGG - Intergenic
1026720442 7:72826354-72826376 ATTTTTCTCTTAAATCTTTCTGG + Intronic
1026777723 7:73241208-73241230 ATCTTTCCCTTTTTTATTTTTGG - Intergenic
1027018576 7:74794600-74794622 ATCTTTCCCTTTTTTATTTTTGG - Intergenic
1027069452 7:75151337-75151359 ATCTTTCCCTTTTTTATTTTTGG + Intergenic
1027525924 7:79268665-79268687 ATGTTTCCCTTTAATTTCAGTGG + Intronic
1027547941 7:79554107-79554129 AATTTTCCATTTAATATTTCTGG + Intergenic
1027561579 7:79738945-79738967 ATCTTTAACTTAAATATTTCTGG + Intergenic
1027682942 7:81242776-81242798 ATGTTTTCCTTATATATTTTGGG - Intergenic
1027832664 7:83199762-83199784 ATGTTTGCTTTTAATGTTGCTGG + Intergenic
1028060154 7:86302599-86302621 TTGTTGCCTTTTAATATTTTTGG - Intergenic
1028068031 7:86412944-86412966 ATGTTTCCCTTCCATGTGTCAGG - Intergenic
1028133853 7:87206692-87206714 AGTTTTCCATTTAATATTTTTGG + Intronic
1028272680 7:88812256-88812278 AATTTTGTCTTTAATATTTCTGG + Intronic
1028397775 7:90391238-90391260 ACTTTTCCATTTAATATTTTTGG + Exonic
1028397824 7:90391774-90391796 ACTTTTCCATTTAATATTTTTGG + Intronic
1028509503 7:91608340-91608362 ATGTTTCCCTTAATTCTTTGAGG - Intergenic
1028767435 7:94575638-94575660 AGGACTCCCTTTAATATTTCTGG + Intergenic
1029339401 7:99930765-99930787 AATTTTCCATTTAATATTTTTGG - Intergenic
1029843255 7:103388004-103388026 ATGTTTCCTTTTCATCTTTATGG + Intronic
1030253459 7:107478475-107478497 AATTTTCCATTTAATATTTTTGG - Intronic
1030731934 7:113000219-113000241 AATTTTCCATTTAATATTTTTGG - Intergenic
1033022943 7:137745420-137745442 AATTTTCCATTTAATATTTTTGG - Intronic
1033509659 7:142046876-142046898 ATTTTTTCCTATAATATTTAAGG + Intronic
1033880352 7:145874225-145874247 AAGTTTCCATTGAATATTTCTGG - Intergenic
1036172628 8:6503992-6504014 ATTTTTCCATTTAATATTTTTGG - Intronic
1036936881 8:13011514-13011536 ATGATTTCTTTTAATATTTCTGG + Intronic
1036958212 8:13214348-13214370 AAGTTTCCCTTTTAGCTTTCGGG + Intronic
1037500817 8:19483952-19483974 AATTTTCCATTTAATATTTTTGG - Intronic
1039705688 8:40005100-40005122 ATGTTGCCCTTTGCTATTTGTGG - Intronic
1040523205 8:48195413-48195435 AATTTTCCATTTAATATTTTTGG - Intergenic
1041142812 8:54841226-54841248 ATGTTGACCTTCAATATTTTGGG + Intergenic
1041338386 8:56813267-56813289 AAGATTTTCTTTAATATTTCTGG - Intergenic
1041474004 8:58242592-58242614 ATGTTTCCAGATAATATTTCTGG - Intergenic
1041512793 8:58670275-58670297 AATTTTCCATTTAATATTTTTGG - Intergenic
1041558372 8:59185491-59185513 TTAATTCCCTTTAATATTTAGGG - Intergenic
1041627801 8:60050572-60050594 ATATTCCCCTTCAATATTTTGGG - Intergenic
1041646489 8:60257974-60257996 AATTTTCCATTTAATATTTTTGG - Intronic
1042194860 8:66223293-66223315 ATGTCTCCCTTCCATATTCCAGG + Intergenic
1042433043 8:68730455-68730477 ATTTTTCCTTTTGACATTTCAGG + Intronic
1042527381 8:69777595-69777617 AATTTTCCATTTAATATTTTTGG - Intronic
1043038436 8:75228572-75228594 AATTTTCCATTTAATATTTTTGG - Intergenic
1043127172 8:76413674-76413696 AGGTTTCTTATTAATATTTCAGG - Intergenic
1043620800 8:82190628-82190650 AAGTGTTCATTTAATATTTCTGG - Intergenic
1043723195 8:83574294-83574316 ATGTTGTCCTATAATATTTGTGG + Intergenic
1043861366 8:85320905-85320927 ATTTTTCCCCTTAATTTTACTGG - Intergenic
1043865689 8:85372686-85372708 AAGTTTCCATTTAATAATTTTGG - Intronic
1044074526 8:87802710-87802732 AATTTTCCATTTAATATTTTTGG + Intergenic
1044253845 8:90036819-90036841 CTGTATCCTTTTAAAATTTCAGG + Exonic
1044914291 8:97095811-97095833 ATGTCTCCCTTTAGTATCTAAGG + Intronic
1044951535 8:97440175-97440197 AATTTTCCATTTAATATTTTTGG + Intergenic
1045058892 8:98394221-98394243 ATCTTTCTCCTAAATATTTCTGG - Intergenic
1045549556 8:103158808-103158830 AATTTTCCATTTAATATTTTTGG + Intronic
1045985577 8:108246215-108246237 AATTTTCCATTTAATATTTTTGG + Intronic
1046252183 8:111646522-111646544 AATTTTCCATTTAATATTTTTGG + Intergenic
1046254895 8:111682874-111682896 AATTTTCCATTTAATATTTTTGG + Intergenic
1046453422 8:114423987-114424009 ATTTTTCCTTTTAATATCTGTGG + Intergenic
1046472549 8:114695830-114695852 TTGTTTCCTTTTCATATTTAAGG - Intergenic
1046485702 8:114884852-114884874 ATGTTTCATTTGAATATGTCAGG - Intergenic
1047466054 8:125115448-125115470 ATGTTTCTATTAAATCTTTCAGG + Intronic
1047930725 8:129726211-129726233 ATGTCTCCCTTAAAAATCTCTGG - Intergenic
1048500712 8:134972354-134972376 AATTTTCCATTTAATATTTTTGG - Intergenic
1049387459 8:142350515-142350537 ATGTATTCCTTGAATGTTTCTGG - Intronic
1049589994 8:143454029-143454051 AATTTTCCATTTAATATTTTTGG - Intronic
1049656545 8:143801393-143801415 ATGTTTTCTTCTAGTATTTCTGG - Intronic
1049727077 8:144152227-144152249 ATTTTTCTATTTAATATTTTTGG + Intronic
1050605417 9:7296122-7296144 ATGTGCCCCTTTAACATTTGAGG + Intergenic
1050826335 9:9951140-9951162 ATGTAGCCCTTTAATGTTTCAGG + Intronic
1051546157 9:18278303-18278325 ATAATTCCCTTTAGCATTTCTGG + Intergenic
1052430557 9:28360992-28361014 ATTTTTCCATTTAATATTTTTGG - Intronic
1052822785 9:33151982-33152004 ATGTTTTCCTTTATGACTTCAGG - Intronic
1053311059 9:37020262-37020284 ATGTTTCATTTTAATGTTTTTGG - Intronic
1053972953 9:43765606-43765628 ATGTTTCCCTGTTATATACCAGG + Intergenic
1053978601 9:43863135-43863157 ATGTTTCCCTGTTATATACCAGG + Intergenic
1053979325 9:43875562-43875584 ATGTTTCCCTGTTATATACCAGG + Intergenic
1053999007 9:44217094-44217116 ATGTTTCCCTGTTATATACCAGG + Intergenic
1054007736 9:44370436-44370458 ATGTTTCCCTGTTATATACCAGG + Intergenic
1054013137 9:44463482-44463504 ATGTTTCCCTGTTATATACCAGG + Intergenic
1054020000 9:44582075-44582097 ATGTTTCCCTGTTATATACCAGG + Intergenic
1054738014 9:68775660-68775682 AATTTTCCATTTAATATTTTTGG + Intronic
1054998213 9:71417621-71417643 ATGTTTCCATTAATTCTTTCTGG - Intronic
1055008983 9:71542599-71542621 ATGTTTCCCATTAATACATAAGG + Intergenic
1055071394 9:72170074-72170096 TTTTTCCCCTTTAATATTACGGG + Intronic
1055131942 9:72785796-72785818 AATTTTCCATTTAATATTTTTGG + Intronic
1055159794 9:73112256-73112278 ATTTTTCCATTTAATATTTTTGG - Intergenic
1055325700 9:75126314-75126336 ATGTGTTGCTTTCATATTTCAGG - Intronic
1055546055 9:77374577-77374599 AATTTTCCATTTAATATTTTTGG + Intronic
1055660626 9:78500489-78500511 ATTTGTCCCTTAAATATTTGGGG + Intergenic
1056596005 9:88008065-88008087 AATTTTCCATTTAATATTTTTGG - Intergenic
1057108085 9:92439995-92440017 AATTTTCCATTTAATATTTTTGG - Intronic
1057451719 9:95168482-95168504 ATTTTTTCATTTAATATTTTTGG - Intronic
1058007722 9:99936927-99936949 AAGATTTCCTTTAACATTTCTGG + Intronic
1058261698 9:102841313-102841335 AATTTTCCATTTAATATTTTTGG + Intergenic
1058268705 9:102941596-102941618 ATTTTTCTCTTTAATAGTTCTGG + Intergenic
1058755227 9:108077426-108077448 AGGTAGCCCTTTAATATCTCAGG - Intergenic
1059851976 9:118352270-118352292 ATGTTTCCTTTTCATCTTTATGG + Intergenic
1059873485 9:118604383-118604405 ATGTGTCCCTTTAATTTTGTGGG - Intergenic
1060328197 9:122638742-122638764 ATGTTTCCAATTATCATTTCTGG + Intergenic
1060455632 9:123792812-123792834 ATTTTTCTTTTTTATATTTCTGG - Intronic
1060800385 9:126540969-126540991 AATTTTCCATTTAATATTTTTGG + Intergenic
1203705498 Un_KI270742v1:38746-38768 ATGTTGCAGTTTTATATTTCTGG + Intergenic
1186140854 X:6571944-6571966 ATGGGTCCCTTTAATGCTTCAGG + Intergenic
1186255588 X:7715036-7715058 ATGTTGCCATTTAATTTTACAGG - Intergenic
1186286430 X:8048769-8048791 ATTTCTCCCTTTGTTATTTCAGG + Intergenic
1186847846 X:13548815-13548837 AATTTTCCATTTAATATTTTTGG - Intergenic
1188800780 X:34526905-34526927 ATTTTTCTAATTAATATTTCTGG - Intergenic
1189655407 X:43239709-43239731 ATGCTTCCATTTCATGTTTCAGG - Intergenic
1189737156 X:44083299-44083321 AATTTTCCATTTAATATTTTTGG - Intergenic
1189984010 X:46537751-46537773 ATATTTCCCTTTATGATTTCTGG + Intronic
1189994034 X:46621886-46621908 ATCATTCTCTTTAATATTACAGG + Intronic
1190149263 X:47929598-47929620 AAATTTCCCTTTGATATTTTTGG + Intronic
1190162623 X:48044879-48044901 AAGCTTCCCATCAATATTTCTGG + Intronic
1190794360 X:53727039-53727061 AATTTTCCATTTAATATTTTTGG - Intergenic
1190847152 X:54204416-54204438 GTGTTTCCCTTTGATATTTAAGG - Intronic
1191995733 X:67093435-67093457 ATGTTTCATTTTAATAGTTTTGG + Intergenic
1192590886 X:72358622-72358644 AATTTTCCATTTAATATTTTTGG + Intronic
1193113121 X:77749703-77749725 AATTTTCCGTTTAATATTTTTGG - Intronic
1193195408 X:78625724-78625746 ATGTTTCCATTTTCTGTTTCAGG - Intergenic
1193202214 X:78704996-78705018 AAGTTTCTTTTTAATTTTTCTGG - Intergenic
1193450219 X:81656082-81656104 ATGTTTCCCTCTGAGATTTGGGG + Intergenic
1193479992 X:82015794-82015816 ATGGTTGCTTTTAATGTTTCTGG + Intergenic
1193689105 X:84618330-84618352 ATGTTAACCTTCTATATTTCAGG - Intergenic
1193845136 X:86459568-86459590 CTAATTACCTTTAATATTTCAGG - Intronic
1194031097 X:88816426-88816448 ACATTTTCCTATAATATTTCAGG + Intergenic
1194098792 X:89676274-89676296 ATTTATCCCTTTTATATTTAAGG - Intergenic
1194681147 X:96854821-96854843 AATTTTCCATTTAATATTTTTGG + Intronic
1194693850 X:97020833-97020855 ATTTTTCCATTTAATATCTTTGG + Intronic
1194773716 X:97936777-97936799 GTGTTTCCCTTTATTAATTTTGG - Intergenic
1195262611 X:103148162-103148184 AATTTTCCATTTAATATTTTTGG - Intergenic
1195956926 X:110341445-110341467 AATTTTCCATTTAATATTTTTGG - Intronic
1196221502 X:113116497-113116519 AATTTTCCATTTAATGTTTCTGG + Intergenic
1197435972 X:126428652-126428674 AAGATTCCCTTTAGTATTTCTGG + Intergenic
1197447550 X:126569110-126569132 AATTTTCCATTTAATATTTTTGG + Intergenic
1198004411 X:132477835-132477857 ATCTTTCCCATTAATATTTTAGG + Intronic
1198048263 X:132924172-132924194 ATGTGTCCCATAAATATTCCTGG - Intronic
1198386118 X:136131117-136131139 AATTTTCCATTTAATATTTTTGG - Intergenic
1199778483 X:151036716-151036738 TTGTTTCCCTTTGATTTTTATGG + Intergenic
1200041571 X:153374555-153374577 AAGTTTCCACTTAATATTTTTGG - Intergenic
1200451818 Y:3337647-3337669 ATTTATCCCTTTTATATTTAAGG - Intergenic
1201633187 Y:16092632-16092654 TTATTTCCATTTAATATTTTTGG - Intergenic