ID: 1082962778

View in Genome Browser
Species Human (GRCh38)
Location 11:58934827-58934849
Sequence CTGCCAACCTGGAAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082962773_1082962778 -10 Left 1082962773 11:58934814-58934836 CCTAGGGCTAGGGCTGCCAACCT 0: 1
1: 2
2: 0
3: 22
4: 213
Right 1082962778 11:58934827-58934849 CTGCCAACCTGGAAATGGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 208
1082962770_1082962778 1 Left 1082962770 11:58934803-58934825 CCTGACTAAGGCCTAGGGCTAGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1082962778 11:58934827-58934849 CTGCCAACCTGGAAATGGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 208
1082962767_1082962778 8 Left 1082962767 11:58934796-58934818 CCAGATACCTGACTAAGGCCTAG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1082962778 11:58934827-58934849 CTGCCAACCTGGAAATGGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 208
1082962765_1082962778 28 Left 1082962765 11:58934776-58934798 CCTGGGTCTGCAGATGCTTGCCA 0: 1
1: 2
2: 1
3: 58
4: 547
Right 1082962778 11:58934827-58934849 CTGCCAACCTGGAAATGGGGTGG 0: 1
1: 0
2: 1
3: 24
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082962778 Original CRISPR CTGCCAACCTGGAAATGGGG TGG Intronic
900233873 1:1577378-1577400 CTGCCAACTTGGAAGGGGGCAGG - Intergenic
900788218 1:4663041-4663063 CTGCCCCCCTGGGAAGGGGGAGG - Intronic
902329165 1:15722484-15722506 CTTCCAGCCTGGAACAGGGGAGG + Intronic
904029950 1:27527775-27527797 GTGCTGCCCTGGAAATGGGGTGG - Intergenic
904672782 1:32178871-32178893 CTGCCAAAATGGTAATGGAGAGG + Intergenic
905244677 1:36604369-36604391 ATGCCAACCTGAGGATGGGGAGG + Intergenic
905891786 1:41522548-41522570 CTACACCCCTGGAAATGGGGAGG + Intronic
906051926 1:42881213-42881235 CTGCCAACTTGGAAAAAGGTGGG + Intergenic
910259724 1:85283726-85283748 CTGCCAACTTGGAAGTGGGCAGG - Intergenic
910450765 1:87342422-87342444 CTGCCATCCTGGAAAAGGTGTGG - Intronic
914904000 1:151729164-151729186 ATGGCAACAGGGAAATGGGGAGG + Intronic
915064208 1:153211168-153211190 GGCCCAACCTGGGAATGGGGTGG - Intergenic
915071528 1:153272732-153272754 ATGCCAACCTGGTGCTGGGGTGG + Intergenic
919655505 1:200193306-200193328 TTGGCAACCTGGGAATGGGCAGG - Intergenic
919854680 1:201697187-201697209 GAACCATCCTGGAAATGGGGGGG + Intronic
920051364 1:203166857-203166879 CTGCCTGCCTGGGAACGGGGTGG + Exonic
921478830 1:215640368-215640390 CTGTCAAGCTGCAAATGGGAAGG + Intronic
922707514 1:227797077-227797099 CTGCCCAGCTGAAAATGGGGTGG + Intergenic
923328468 1:232900894-232900916 TTTCCAACCACGAAATGGGGTGG - Intergenic
1069735120 10:70648988-70649010 AGGCCAACCTGGAATTGGTGGGG - Intergenic
1070085775 10:73235952-73235974 CTCCCAGCCTACAAATGGGGAGG - Intronic
1070989639 10:80720144-80720166 CTGCCAAGCTGGAAGAGGGATGG + Intergenic
1071251751 10:83826117-83826139 CTGCAAATCTGGAATTTGGGTGG + Intergenic
1073593530 10:104778573-104778595 CTGCCAACCAGGAACTGAGCTGG - Intronic
1075574208 10:123566686-123566708 CTGCCATCCTGGAGGTTGGGTGG + Intergenic
1075906850 10:126089051-126089073 CTGCCAACTGGGAGTTGGGGCGG - Intronic
1075964305 10:126597919-126597941 AAGTCAACCTGGAAATGGGTAGG - Intronic
1078355346 11:10628344-10628366 CAGCCAACAAGGAAAGGGGGAGG - Intronic
1079303261 11:19298282-19298304 CTGCAAAGCTGGAGATGGGGTGG + Intergenic
1079438054 11:20477808-20477830 CTGCAAAACAGGAAGTGGGGGGG - Intronic
1081558724 11:44192253-44192275 CTCCCTACCTGGAGATGAGGAGG - Intronic
1082962778 11:58934827-58934849 CTGCCAACCTGGAAATGGGGTGG + Intronic
1083333764 11:61911374-61911396 CTTGCAGCCTGGAAATGAGGAGG - Intronic
1083880384 11:65545513-65545535 CACCCAAACTGGAAACGGGGAGG + Intronic
1085261417 11:75207437-75207459 CTTCCAAACTGGACATGGTGAGG + Intergenic
1089520069 11:119057307-119057329 TTGCCAGCCTTGTAATGGGGCGG + Intergenic
1090942073 11:131395737-131395759 CTGCCTGCCTGGGAATGGCGTGG + Intronic
1092040587 12:5380392-5380414 CTGCCACCCTGCAAATGCTGAGG - Intergenic
1093535755 12:20220470-20220492 CTGCCTATCTAGAACTGGGGAGG - Intergenic
1094809393 12:34123043-34123065 CTGCCACCTTGTAACTGGGGTGG + Intergenic
1095814103 12:46402455-46402477 CTTCCCACCTGGAAATGCTGAGG + Intergenic
1095952240 12:47787901-47787923 TTCCCCACCTGGAAATGGGGAGG - Intronic
1095970213 12:47896659-47896681 CTGGGAAACTGGAAATGGAGTGG - Intronic
1096227751 12:49877336-49877358 CAGACAACCTGGAAGTGGCGTGG - Intronic
1096615553 12:52831315-52831337 CTGGGACCCTGGGAATGGGGTGG + Intronic
1096839544 12:54371787-54371809 TTGCCCTCCAGGAAATGGGGGGG - Intronic
1097168112 12:57096472-57096494 CTGCCAAGCAGCAGATGGGGAGG - Exonic
1101821862 12:108190615-108190637 CTGCCAACTTGAAGATGGGTGGG - Intronic
1101969793 12:109304951-109304973 CAGCAAACCTGCAAATTGGGTGG + Intronic
1102744639 12:115239697-115239719 CAGCTAACCTGAAAATAGGGAGG - Intergenic
1102803036 12:115753377-115753399 TTGGCAGCCTTGAAATGGGGTGG - Intergenic
1102978045 12:117220635-117220657 CTGCACACCTGGAAATGTGCAGG - Intronic
1103520841 12:121536416-121536438 CTGCGGAGCTGGCAATGGGGTGG + Intronic
1108029095 13:46210069-46210091 CTGCCAAACTGCAAAGGGGACGG + Intronic
1110313919 13:74083054-74083076 CTGACAACATTGAAATGGGTTGG + Intronic
1112838527 13:103546891-103546913 CTGCTGACCTTGATATGGGGAGG + Intergenic
1113267399 13:108634511-108634533 CTGCAAACAAGGAAATGGGGTGG - Intronic
1114773231 14:25452694-25452716 TTAGCAACCTGGAAATGTGGGGG + Intergenic
1115960922 14:38835862-38835884 CTGCCCACCTGTAGCTGGGGTGG - Intergenic
1116221806 14:42096667-42096689 CTGCCAACTTGGAAGTGTGTGGG + Intergenic
1120053087 14:79891394-79891416 CTCCATGCCTGGAAATGGGGAGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1125182425 15:36892452-36892474 CTGCAAACCTGAAAATAGAGAGG + Exonic
1128053649 15:64684174-64684196 CTGCCCACCTCTACATGGGGAGG + Exonic
1128066435 15:64767622-64767644 GTCCCACCCTGGACATGGGGAGG + Intronic
1128807051 15:70538877-70538899 CTGGGAACCTGGATTTGGGGAGG + Intergenic
1129342047 15:74892549-74892571 CTGCCATCCTGCAACTGGGGAGG + Intronic
1129705559 15:77792206-77792228 GGGCCAGCCTGGGAATGGGGCGG - Intronic
1132154470 15:99485954-99485976 CTGCCATCCTTGAAATGGCAAGG - Intergenic
1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG + Intergenic
1132774449 16:1584418-1584440 CTTGCAACCTGGAAATGAAGTGG - Exonic
1133417105 16:5615551-5615573 CTGCCAATCTGAAGATGTGGTGG + Intergenic
1133590922 16:7242550-7242572 GTGGCAACTTGGACATGGGGAGG + Intronic
1134618909 16:15672896-15672918 CTTACAGCCAGGAAATGGGGAGG + Intronic
1136367071 16:29813789-29813811 CTGCCAACTGGGAGCTGGGGTGG - Exonic
1136408859 16:30065118-30065140 CTGCCAGCCTGGAACTCGGATGG + Intronic
1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG + Intergenic
1137738575 16:50742551-50742573 CTCCCAATCTGTAAATGGGGTGG - Intronic
1138628640 16:58274822-58274844 CTGCTGCCCTGGAACTGGGGTGG + Intronic
1139911237 16:70398814-70398836 CTGCCACCCTGGTGAGGGGGAGG + Exonic
1140288121 16:73623717-73623739 CTTCCAAAATGAAAATGGGGAGG + Intergenic
1140893372 16:79304263-79304285 CTGCTTGCCTGGAAAGGGGGAGG - Intergenic
1141568502 16:84919870-84919892 CTGAGAAGCTGGAAATGGCGTGG + Intronic
1143884473 17:10055558-10055580 TGGCCAACCTGGAAAGGGAGGGG - Intronic
1145765770 17:27457159-27457181 CCCGCAAACTGGAAATGGGGTGG - Intronic
1145907856 17:28526089-28526111 CTCCTAACCTGCAAATGGTGAGG + Intronic
1146123047 17:30211598-30211620 CTGCCTCCCAGGAACTGGGGTGG - Intronic
1146749239 17:35362762-35362784 CTGACAACCGAGAAATGGGTAGG - Exonic
1147261290 17:39210908-39210930 TTGGCCACCAGGAAATGGGGTGG - Exonic
1147961179 17:44168554-44168576 CTGCCAAGCTGGGGAAGGGGAGG - Intergenic
1148686888 17:49506100-49506122 CAGCCAACTGGGAAAGGGGGAGG - Intronic
1149655710 17:58308693-58308715 CTGCTACCCTGGAGATGGGGAGG - Exonic
1151541186 17:74765205-74765227 TTGCCAATCAGGAAATGAGGGGG - Intronic
1151820931 17:76496440-76496462 TTGCCACCCTGGAACTGGTGAGG + Intronic
1151896219 17:76982648-76982670 ATGTCAGCCTGGAAATGGGCGGG - Intergenic
1152107619 17:78340321-78340343 CTGCCACACTGGAACTGGGAGGG - Intergenic
1152765326 17:82134187-82134209 CAGCCACCCTGGGAATGGGATGG + Intronic
1156008652 18:32471232-32471254 CTCCCATCCTGGCAATGCGGTGG + Intergenic
1156515197 18:37673465-37673487 TCTCCAACCTGGAAATGAGGGGG - Intergenic
1156621559 18:38857615-38857637 CTGCCAACCTGGAAATGCCAAGG + Intergenic
1157150892 18:45216698-45216720 CTGCCATCTTGGACATAGGGGGG + Intronic
1157484217 18:48075584-48075606 ATGCCATCCTGGGAGTGGGGAGG - Intronic
1158261316 18:55609074-55609096 CTGCAAACCAGGAAGTGGGCTGG + Intronic
1158597877 18:58832265-58832287 CTGCCCAGCAGGAAAGGGGGAGG + Intergenic
1159334226 18:67043452-67043474 CTTCCAACTTGGAAGTGGGCGGG - Intergenic
1162450212 19:10749868-10749890 CTGCCTACCTGGCCATGGGCAGG - Intronic
1162861000 19:13505856-13505878 CTCCCAGCCTGGAAGAGGGGAGG + Intronic
1167023072 19:46893188-46893210 CTGACAACCTGAATAGGGGGAGG + Intergenic
925781725 2:7387847-7387869 CTGCCAGCCTGGTGATGGTGGGG + Intergenic
926772878 2:16393783-16393805 CTGCCTATCTGGAAATTGTGTGG + Intergenic
928050994 2:27995212-27995234 CTGGCAAAGTGGAAATGGGCTGG + Intronic
928462014 2:31483933-31483955 CTGGCAACCTTGAAAGGGTGAGG - Intergenic
930062743 2:47304147-47304169 CTGCAAACCTAGAAATGGGTTGG - Intergenic
932054880 2:68433457-68433479 CTGCCAACTCGGAAAGGGCGGGG + Intergenic
935082671 2:99814004-99814026 CAGCCAACCTTGCAATGGAGGGG + Intronic
935375675 2:102394509-102394531 ATGCCGACCTGAAAATGGAGAGG + Exonic
937974489 2:127574069-127574091 CTCCCGACCTGGGAAGGGGGAGG - Intronic
939314167 2:140525888-140525910 CTGCCAACCTGGATATGCGACGG - Exonic
939937056 2:148305546-148305568 CTGCAAACCAGGAAATGTGTGGG - Intronic
940123341 2:150293699-150293721 CTTCCAACCTGGAAGAGGGGTGG + Intergenic
941998763 2:171626388-171626410 CTGCCAACTTGGAAGCGGGCAGG - Intergenic
942459261 2:176158381-176158403 CTGGCAAGCTGGGGATGGGGTGG - Intronic
945357662 2:208858082-208858104 CTGCCTACCTGGAACTGGCATGG - Intergenic
945396100 2:209320943-209320965 CTGTCAACCTGCAATTAGGGTGG + Intergenic
945925287 2:215797023-215797045 TTTCCAACCTGGAATTGGAGAGG - Intergenic
946957070 2:224942190-224942212 CTTCCAAAATGGAAATGGGAGGG - Intronic
947596266 2:231413605-231413627 CTGCCTAGCTGGAAAGGGGCAGG + Intergenic
948993456 2:241565875-241565897 TTGCCAACTTTTAAATGGGGAGG - Intronic
1169734809 20:8825996-8826018 CTGCCAAACTGGGAATGAGGGGG + Intronic
1171956381 20:31467010-31467032 CTGCCACACTGGAAATGATGAGG + Intronic
1172752397 20:37259821-37259843 CTGCCGGCCTGGGAATGAGGAGG - Intronic
1172808113 20:37627700-37627722 CTGAAAACCTCCAAATGGGGAGG - Intergenic
1175452043 20:59077652-59077674 CTGGCTGCCAGGAAATGGGGAGG + Intergenic
1178040917 21:28640140-28640162 ATGCAAACCAGGGAATGGGGAGG + Intergenic
1178578715 21:33817899-33817921 CAGTCAAATTGGAAATGGGGAGG + Intronic
1179241565 21:39597579-39597601 CTGCAGACCTTAAAATGGGGAGG + Exonic
1180802187 22:18637084-18637106 CTGGCATCTGGGAAATGGGGTGG + Intergenic
1180853424 22:19032636-19032658 CTGGCATCTGGGAAATGGGGTGG + Intergenic
1181219535 22:21358175-21358197 CTGGCATCTGGGAAATGGGGTGG - Intergenic
1181496290 22:23289055-23289077 CTGCCACTCTGGAAATGGCTGGG - Intronic
1182391745 22:30003067-30003089 CTGCTAACCTGGGAAGGGTGGGG + Intronic
1182424877 22:30266665-30266687 CTGCCCTCCGGGAACTGGGGAGG - Intronic
1182554036 22:31119376-31119398 CTGCCACTCAGGAAATGGGCTGG - Intronic
1183333799 22:37235376-37235398 CAGCCAGCCTGGCAGTGGGGAGG - Intronic
1184728702 22:46361112-46361134 CGGCCACCCTGGGCATGGGGAGG + Exonic
1185147584 22:49147672-49147694 TTCCCAACCTGGCAGTGGGGAGG + Intergenic
950136385 3:10584144-10584166 CTGCCCAGGTGGAGATGGGGTGG + Intronic
953636924 3:44671784-44671806 CTGCCCACCAGCAAAAGGGGTGG + Intergenic
954121394 3:48502266-48502288 CTGCCATCATGGTTATGGGGTGG - Intronic
956065993 3:65397875-65397897 CTGCCCTCATGGAAATGGGGAGG - Intronic
957614420 3:82509143-82509165 CTGCCAACTTGGAAAGGGGCAGG - Intergenic
958759041 3:98285597-98285619 CTGCCTACCTGGAAGTGGATGGG + Intergenic
961547515 3:127645562-127645584 CTGCCAACCAGGCCATGGGCTGG + Intronic
961578038 3:127854509-127854531 CTGCCAACCTGGAGCTTGGCAGG - Intergenic
962240733 3:133748717-133748739 CTTCAAAAGTGGAAATGGGGAGG + Intronic
962255195 3:133865694-133865716 CTGCCAGCCTGGGAAATGGGAGG - Intronic
963917599 3:150873360-150873382 CTGCCCACCTGGAAAGGGGAAGG + Exonic
964111376 3:153091134-153091156 GTGTGAATCTGGAAATGGGGTGG - Intergenic
968143081 3:196274275-196274297 CTGCCAACTTGGAAACGGGCAGG + Intronic
968408081 4:359551-359573 CTGCCCACCTAGAAATCTGGAGG - Intronic
968418064 4:457914-457936 CTGCCAACCCAGAAATCTGGAGG + Intronic
968621415 4:1604964-1604986 CTGCCAAGCAGGAGATGTGGAGG - Intergenic
969391411 4:6893663-6893685 CTGCCACGCTGGAGCTGGGGTGG - Intergenic
974697824 4:65398027-65398049 CTGCCAACTTGGAAGGGGGGTGG - Intronic
976647212 4:87399352-87399374 CTGCCAACTCAGAAAGGGGGTGG - Intergenic
980582547 4:134773375-134773397 CTGCCAACTTGGAAGGGGGCAGG - Intergenic
980744843 4:137000556-137000578 CTGCCAACTGGGAAGTGGGTAGG - Intergenic
981579359 4:146236584-146236606 CAGCCACCCTGGGAATGAGGAGG + Intergenic
984375226 4:178921793-178921815 CTGCCAACTTGGAAAGGGTCAGG - Intergenic
985228514 4:187789329-187789351 CTGCCAACTTGGTAAGGGGTGGG - Intergenic
1202770369 4_GL000008v2_random:199644-199666 CAGCCCACCTGGACATGGGAAGG + Intergenic
985946259 5:3186359-3186381 CTGCAAACCTGGAGACAGGGAGG - Intergenic
989094921 5:37772959-37772981 CTGCCAACCTGGTGATTGGATGG - Intergenic
991230759 5:64330831-64330853 CTGCTAACTTGGAAAGGGGCAGG - Intronic
993547429 5:89229920-89229942 GTGCCATCCTGGCACTGGGGTGG + Intergenic
996850303 5:127943974-127943996 CTGCCAAATTAGAAGTGGGGAGG + Intergenic
997978612 5:138454991-138455013 CTGACAACTTGGCAGTGGGGTGG - Intergenic
997989530 5:138532558-138532580 CAGCCCAACTAGAAATGGGGAGG + Intronic
999182538 5:149680412-149680434 CTGCCAAAAGGGAAATGGGCAGG - Intergenic
1000266147 5:159640493-159640515 CTGCCAACTTGGAATAGGGTGGG - Intergenic
1000998222 5:167980469-167980491 GTGACCACCTGGACATGGGGAGG + Intronic
1001125133 5:169012481-169012503 CTGGCAACTTGTAAATGTGGAGG + Intronic
1002099000 5:176848154-176848176 GTGCTAACGTGGAAATGAGGCGG - Intronic
1002471486 5:179438512-179438534 CTGCCAGCCTGGCCATGGAGAGG + Intergenic
1003463584 6:6355177-6355199 ATGCCACCGTGGAAATGAGGTGG + Intergenic
1007181420 6:39931928-39931950 CTGCCAGCCTGCATCTGGGGTGG - Intronic
1007834481 6:44664107-44664129 CTGCCAGCCTGGAACTGGTTTGG - Intergenic
1010762214 6:79736376-79736398 CTGCCAAAATGGAAATCAGGAGG - Intergenic
1011149325 6:84252791-84252813 CTTCCAGCCCAGAAATGGGGAGG - Intergenic
1013463266 6:110395789-110395811 TTTCCAACCAGGAAGTGGGGCGG - Intronic
1019235263 6:170606713-170606735 CTGCCCAACTTGTAATGGGGAGG + Intergenic
1019625625 7:2014380-2014402 CTGCCAGCCGGGAACTGGGGAGG + Intronic
1021577275 7:22116018-22116040 TTTCCAACCTGGAAATGGGTGGG - Intergenic
1022499162 7:30871820-30871842 CTGCCAGCCTGTAAAATGGGAGG - Intronic
1022516044 7:30975600-30975622 CTGGTAGCCTGGAGATGGGGGGG - Intronic
1022574362 7:31483196-31483218 CTGCCAACCTGACAATTTGGTGG - Intergenic
1023292767 7:38685724-38685746 CTGAAAACCAGGAAATTGGGTGG - Exonic
1028304043 7:89239284-89239306 CTGCCAATCAGGAAATGAGATGG + Intronic
1029416122 7:100444339-100444361 ATGCAAGCTTGGAAATGGGGAGG + Intergenic
1031698750 7:124896304-124896326 CTGCGAACCTGTAAATAAGGCGG - Intronic
1032540661 7:132700338-132700360 TTGCCAACCAGGAAATGAAGTGG - Intronic
1035406816 7:158604157-158604179 CTGCCACACGGGAACTGGGGTGG - Intergenic
1035663800 8:1365501-1365523 CTGCCATCCTGGACCTGGGAGGG - Intergenic
1036954076 8:13168554-13168576 CTGCCAATCAGGAAAGGGAGTGG + Intronic
1040547531 8:48410459-48410481 CTGCCAAGCTGGAAAGGGGGTGG - Intergenic
1041955939 8:63558442-63558464 CTGCCAACTTGGAAGGGGGTGGG - Intergenic
1043745467 8:83869152-83869174 CTGCCAACCAGGAAGGGGCGGGG - Intergenic
1044962246 8:97542697-97542719 CTGCCAACTTGGAAGGGGTGGGG - Intergenic
1048500948 8:134974599-134974621 GTGCCATCCTGGGAATGGTGGGG - Intergenic
1048528720 8:135227990-135228012 CTGCTAACCAGGAAATGCAGTGG - Intergenic
1053076516 9:35138952-35138974 CTGCCAACCTGGAAGGGGCGGGG - Intergenic
1056204902 9:84310377-84310399 CTGCCATCCTGGAAATAGGATGG - Intronic
1056249385 9:84732645-84732667 CTGCCAGCCTGAACTTGGGGAGG - Intronic
1056766491 9:89447517-89447539 CTGCCAGCTTGGATCTGGGGTGG - Intronic
1057189075 9:93076157-93076179 CTGCCAACATGGCACTGGGAGGG - Intronic
1057200610 9:93137811-93137833 CTGTCCTTCTGGAAATGGGGTGG - Intergenic
1057507185 9:95644681-95644703 CAGCCAACCTGTAACTGTGGAGG + Intergenic
1057833468 9:98425657-98425679 TTGTCAACCAGGAAATGGGAAGG - Intronic
1060215897 9:121738027-121738049 CTTCCAACCTGGAGGTGGGGAGG + Intronic
1062110674 9:134780481-134780503 CGGCCCACCTGGGAGTGGGGAGG - Intronic
1186573626 X:10742213-10742235 ATGCAATTCTGGAAATGGGGAGG - Intronic
1186788287 X:12973618-12973640 CTCCCAACATGGAACAGGGGCGG + Intergenic
1191221143 X:57989655-57989677 CTGCCAACTGGGAAAGGGTGGGG - Intergenic
1192656626 X:73000819-73000841 ACACCAACCTGGAAATGGTGAGG + Intergenic
1192665494 X:73082182-73082204 ACACCAACCTGGAAATGGTGAGG - Intergenic
1195200509 X:102546103-102546125 CTGCCATCATGAAAATGTGGAGG - Intergenic
1196439173 X:115702913-115702935 TGGCCAAAGTGGAAATGGGGTGG - Intergenic
1196802457 X:119556067-119556089 CAGCCAGCCTGGAACTGGGAAGG - Intronic
1198179510 X:134192411-134192433 CGGCCAAGCTAGAAATCGGGGGG - Intergenic
1200116922 X:153773501-153773523 CTGCCATCCTGGTACAGGGGTGG + Exonic
1200169694 X:154063634-154063656 CTGCTATCCTGGAAATGGACAGG + Intronic