ID: 1082963287

View in Genome Browser
Species Human (GRCh38)
Location 11:58939574-58939596
Sequence ACCACAGCTGGCCCCAACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082963278_1082963287 15 Left 1082963278 11:58939536-58939558 CCCAATTTTGGCTGGAGAGATAA 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1082963287 11:58939574-58939596 ACCACAGCTGGCCCCAACCATGG 0: 1
1: 0
2: 1
3: 32
4: 264
1082963279_1082963287 14 Left 1082963279 11:58939537-58939559 CCAATTTTGGCTGGAGAGATAAG 0: 1
1: 0
2: 2
3: 16
4: 155
Right 1082963287 11:58939574-58939596 ACCACAGCTGGCCCCAACCATGG 0: 1
1: 0
2: 1
3: 32
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082963287 Original CRISPR ACCACAGCTGGCCCCAACCA TGG Intronic
900434088 1:2619207-2619229 ACCCCAGCTGAGCCCAACCTAGG + Intronic
901256969 1:7837679-7837701 ACCACAGCTGCCACCAACACTGG - Intronic
901756851 1:11446691-11446713 CCAACAGCTGCCCCCATCCAAGG + Intergenic
902734365 1:18390489-18390511 ACCACAGCAGGCCTCCCCCAGGG + Intergenic
903295148 1:22339049-22339071 ACCAGCTCTGGCCCCAACCCTGG + Intergenic
904208630 1:28871410-28871432 ACCACACCTGGTCCAAACTAGGG - Intergenic
904546781 1:31280449-31280471 ACCACACCTGGCCAAAAGCAAGG + Intronic
904714454 1:32456752-32456774 TCCACAGCTGGGCCCCACCCTGG - Intergenic
905178955 1:36155300-36155322 ACCTCAGCTGGCACCAACAAGGG + Intronic
905866268 1:41378436-41378458 ACCATGGCTGGCCCAACCCATGG - Intronic
906167044 1:43694225-43694247 ACCACACCTGGCCTCCACTAAGG - Intronic
906461085 1:46035455-46035477 TCCTCAGCAGGCCCCAACCTAGG + Exonic
906756329 1:48319831-48319853 ACAACTGCTGCACCCAACCAAGG + Intronic
909884406 1:80923097-80923119 TCCACAGCTGACCCCCAGCACGG + Intergenic
910117890 1:83752476-83752498 ACCCCAGCTGGCCTCAGCCCAGG + Intergenic
911265885 1:95742822-95742844 GCCACAGCAAGCCCCACCCAAGG - Intergenic
915283395 1:154837883-154837905 GACACAGCTGGGCCCAGCCAGGG + Intronic
918171760 1:182004191-182004213 GCCACAGCAAGCCCCACCCAAGG + Intergenic
918217289 1:182403066-182403088 ACCATACCTGGCCCCAACTTAGG + Intergenic
920342434 1:205284100-205284122 AGCACAGCAGTCCCCCACCAGGG + Intergenic
920778807 1:208968027-208968049 ACCACACCTGGCCAAATCCAAGG + Intergenic
922612546 1:226940876-226940898 CCAACAGCTGGCTCCAGCCAAGG - Intronic
923270173 1:232348209-232348231 ACCATGCCTGGCCCCACCCAGGG + Intergenic
923812886 1:237339948-237339970 AGCACAACTGGCTCCGACCATGG + Intronic
924894214 1:248318046-248318068 AGCACAGCAAGCCCCACCCAAGG + Intergenic
924940840 1:248811759-248811781 AACACAGCTGGCCTCTCCCAGGG + Exonic
1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG + Intergenic
1063364221 10:5480116-5480138 ACCACAGCTGTCCCCTGCCATGG + Intergenic
1063364231 10:5480160-5480182 ACCACAGCTGTCCCCTGCCACGG + Intergenic
1065462352 10:25982229-25982251 GCCACAGCGAGCCCCACCCAAGG + Intronic
1065522811 10:26588689-26588711 ACCAAAGCCAGCCCCAATCATGG + Intergenic
1066303543 10:34117620-34117642 ACCACACCTGGCCCCAAATTTGG - Intronic
1067414017 10:46090493-46090515 ACCAGACCTGGCCCCACTCAGGG + Intergenic
1067434070 10:46265004-46265026 ACCAGACCTGGCCCCACTCAGGG + Intergenic
1069609949 10:69766322-69766344 ACCACCAGTGGCCACAACCAGGG - Intergenic
1069760289 10:70805848-70805870 ACCTCAGCTGTCCCCCTCCAGGG - Intergenic
1069963988 10:72098512-72098534 ACCATACCTGGCCCCAAGAAAGG + Intronic
1071870557 10:89789662-89789684 GCCACAGCAAGCCCCACCCAAGG - Intergenic
1073113268 10:101075509-101075531 GGCACAGATGGCCCTAACCAAGG - Intergenic
1073310548 10:102537267-102537289 ACCACAGCTGCACACCACCATGG + Intronic
1073425280 10:103452150-103452172 CCCACAGCTGGCCCCAGGTAAGG - Exonic
1074202486 10:111250275-111250297 ACCACAGTTGGCACCAAACTGGG - Intergenic
1074418333 10:113286715-113286737 AACACAGCAGGCCTCAACAACGG - Intergenic
1074974595 10:118569842-118569864 ACCCCAGCTGGTCCTAACCATGG + Intergenic
1075001202 10:118799447-118799469 ACCACACCTGGCCACAGCCGTGG + Intergenic
1075540684 10:123311240-123311262 ACCACTGCTGGCCCCCAGCGTGG + Intergenic
1075766722 10:124899150-124899172 ACCACTGCTGTCCCCCTCCATGG - Intergenic
1076349024 10:129801921-129801943 ACCCCCGCTGGCCCCACCCTTGG - Intergenic
1076676973 10:132152147-132152169 AGTGCAGCTGGCCCCCACCATGG + Intronic
1076682356 10:132179697-132179719 ACCACAGCAGGGCCACACCACGG + Intronic
1077193905 11:1269789-1269811 AGCACAGCTGGCCCCTTACAGGG - Intergenic
1077297884 11:1834597-1834619 ACCACAGCTGGGGCCCACCATGG - Exonic
1077617077 11:3683825-3683847 ACCACACCTGGCCTAAACTATGG + Intronic
1080090517 11:28342550-28342572 ACCACACCTGGCCCCATTCTTGG + Intergenic
1082963287 11:58939574-58939596 ACCACAGCTGGCCCCAACCATGG + Intronic
1082974007 11:59054382-59054404 ACCACAACTCGCCCCAAACCCGG + Intergenic
1082978415 11:59098170-59098192 ACCACAACTCGCCCCAAACCCGG + Intergenic
1083349281 11:62015726-62015748 ATCACAGATGGCAACAACCAAGG - Intergenic
1083473422 11:62899909-62899931 ACTACAGCTGCCCGCCACCATGG + Intergenic
1084321914 11:68377934-68377956 ACCACAGCCGGCACCAACCCAGG - Intronic
1087074511 11:94116902-94116924 ACCACACCTGGCCTCCACCTTGG + Intergenic
1088458068 11:110053528-110053550 ACCACAACTGGCCCCAATGTGGG - Intergenic
1092111153 12:5965715-5965737 ACCACAGCTACCCCCAACCCAGG + Intronic
1092408573 12:8237581-8237603 TCCACAGCTGGCCCCGTCCTAGG + Intergenic
1096956361 12:55529986-55530008 GCCACAGCAAGCCCCACCCAAGG + Intergenic
1097302541 12:58034256-58034278 GCCACAGCAAGCCCCACCCAAGG - Intergenic
1097853966 12:64442420-64442442 ACCACACCTGTCCAGAACCAGGG + Intronic
1098851386 12:75600483-75600505 ACAAAAGCTGGCCCCTATCAAGG + Intergenic
1100588283 12:95999612-95999634 ACCAGAGGTGGACCCAACCTGGG + Intergenic
1100706326 12:97203844-97203866 ACCACAGCAAGACCCACCCAAGG + Intergenic
1101207321 12:102501547-102501569 TCCACATCTGCCGCCAACCATGG - Intergenic
1101726947 12:107395708-107395730 ACCAGAGCTGGCCCCCACTGGGG - Intronic
1102206599 12:111095139-111095161 ACCACAGCTGTTCCCACCCCAGG - Intronic
1102303404 12:111787477-111787499 GCCACAGCTGGCCAGAACCAAGG - Intronic
1102616534 12:114159550-114159572 ACCACAGCTTGGACCCACCAAGG + Intergenic
1103269614 12:119662323-119662345 ACCACACCTTGCCCCAAACCAGG + Intergenic
1103568543 12:121829382-121829404 TCCAGATCTGGCCCCAACCAGGG - Intronic
1106501535 13:30333810-30333832 ACCAGAGCAGGCCCCTCCCAAGG - Intergenic
1106754735 13:32811236-32811258 AGCACAGCTGGCCATCACCAGGG + Intergenic
1107349119 13:39495835-39495857 AACACTGCTGGTCCCAACCCTGG - Intronic
1108569166 13:51732267-51732289 ACCACAGGTGCCCGCCACCATGG + Intronic
1109126103 13:58519415-58519437 ACCACAGCTGGGAGAAACCATGG - Intergenic
1111568585 13:90048282-90048304 ACCACAGCTGGCACCATGCTGGG + Intergenic
1112195728 13:97224323-97224345 AGCACAGATGGCCCCAAGCAGGG + Intronic
1113269932 13:108662439-108662461 GCCACAGCAAGACCCAACCAAGG - Intronic
1113867674 13:113538375-113538397 AACAAAGCTGGACCCAAACACGG - Intronic
1115224602 14:31089623-31089645 ACCACGCCTGGCCCCAACATTGG - Intronic
1119328726 14:73778063-73778085 ACCACGCCTGGCCCCTATCATGG - Intronic
1119473485 14:74913265-74913287 ACCACACCTGGCCCTCACCAAGG - Intronic
1119769040 14:77208896-77208918 AGCCCAGCTGGACCCAGCCAGGG + Intronic
1122878268 14:104678671-104678693 ACCCCAGCTGGCCACCCCCAGGG - Intergenic
1127089988 15:55457388-55457410 GCCACAGCAAGCCCCACCCAAGG + Intronic
1127413554 15:58733370-58733392 TCCACAGCAGACCCCAACCCAGG - Intronic
1129694327 15:77731991-77732013 ACCCCAGCAGCCACCAACCACGG + Intronic
1130572373 15:85058374-85058396 ACCACATCTGGCCCTAACTTTGG + Intronic
1130600739 15:85271482-85271504 TTCACAGCCGGCCCCACCCAGGG - Intergenic
1130786631 15:87104597-87104619 ACCACTGCTGCCTCCATCCAAGG + Intergenic
1132498480 16:274724-274746 ACCACAGCAGGGCCCCACAAGGG - Intronic
1133404088 16:5509315-5509337 CCCACAGCTGGCCGGAACCATGG + Intergenic
1134622136 16:15697417-15697439 ACCACACCTGGCCCAAATAAGGG - Intronic
1135179474 16:20260379-20260401 ACCAGAGCAGGGACCAACCAGGG - Intergenic
1135651187 16:24208130-24208152 ACCACAGCTGCACACCACCATGG - Intronic
1136545131 16:30950216-30950238 CACACAGCTGGCCACAAGCAGGG - Intronic
1138018618 16:53456035-53456057 CCCACAGGTGGACACAACCATGG - Intronic
1138127308 16:54449285-54449307 ACCACGCCGGGCCCCAACAATGG + Intergenic
1138516816 16:57540668-57540690 ACCACAGCTGGGACCGAGCAGGG + Intergenic
1139714213 16:68799722-68799744 ACCACACCCGGCCCCAACCTTGG - Intronic
1140245642 16:73245676-73245698 TCCAGAGCTGGCCCCTACCTGGG + Intergenic
1140889546 16:79273201-79273223 ACCTCCTCTGGCCCCAACCCCGG + Intergenic
1141455464 16:84138707-84138729 ACCACAACTGTCCCCAAACTAGG + Intronic
1141671546 16:85494691-85494713 ACTACACCTGGCCCCAAATAAGG + Intergenic
1141720727 16:85753827-85753849 ACCACACCTGGCCTCACCTAGGG - Intergenic
1141730916 16:85822308-85822330 TCCAGAGCTGGGCCCCACCATGG - Intergenic
1143753609 17:9050378-9050400 ACCACGCCTGGCCCCAGCTAGGG - Intronic
1145205445 17:20982751-20982773 ACCACGCCCGGCCCCAACTATGG - Intergenic
1150622715 17:66820516-66820538 AACACAGATGGACCCAACCAGGG + Intergenic
1151347463 17:73510935-73510957 ACCACTGCTGGTCCCTTCCAGGG + Intronic
1151350532 17:73529232-73529254 CCCTCAGCTGTCCCCAACCTCGG - Intronic
1151720166 17:75850532-75850554 ACCGCACCCGGCCCCAGCCAGGG + Intronic
1152022019 17:77784920-77784942 ACCACACCCGGCCACAAGCAAGG + Intergenic
1152600754 17:81260983-81261005 ATCACAGCTGGCACCATGCATGG + Intronic
1157601525 18:48895974-48895996 ACCGCACCTGGCCCCAGCGATGG + Intergenic
1157621630 18:49020495-49020517 ACCACAGCAAGCCACCACCAGGG - Intergenic
1159921568 18:74231602-74231624 GCCACCTCTGGCCCGAACCATGG + Intergenic
1160200294 18:76790255-76790277 ACCACAGGTGTGCCCCACCATGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161407568 19:4099068-4099090 ACCACAGTCGGCACCATCCAGGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161507322 19:4650827-4650849 ACCACACCTGGCCCCCGACAGGG - Intronic
1162196687 19:8990264-8990286 ACCACTCCTGGCCCCCACAATGG - Intergenic
1162702908 19:12531637-12531659 ACCACAGAAGGCCACAACCCAGG + Intronic
1162712084 19:12602913-12602935 ACCACACCTGGCCCCATCATGGG + Intronic
1163032124 19:14551644-14551666 ACCACAGCGGGGCCCAGGCAGGG - Intronic
1163322937 19:16585274-16585296 ACCACAGAGAGCCCGAACCAGGG + Intronic
1163497322 19:17654553-17654575 AACACAGCTGTCCCCAGCCCAGG + Intronic
1163553954 19:17982331-17982353 TCCCCAGCTGCCCTCAACCAGGG + Intronic
1163593413 19:18206733-18206755 ACCACACCTGGCCCCCACACTGG - Intergenic
1164204164 19:23044131-23044153 ACCGCACCTGGCCCCAACATGGG - Intergenic
1165314644 19:35047199-35047221 TCCCCAGCTGGCCCCAGCCTTGG + Intronic
1165376771 19:35448570-35448592 ACCCTTGCTGGCCCCAACCCAGG - Intronic
1165461239 19:35945379-35945401 ACCACAGCATCCCCCAACCCAGG - Exonic
1165969811 19:39617945-39617967 GCCACAGCAAGCCCCACCCAAGG + Intergenic
925343313 2:3151492-3151514 ACCACAGCAAGACCCAACCAAGG + Intergenic
926258446 2:11232416-11232438 ACCACAGCTGGCCAAAACTATGG + Intronic
927176812 2:20415664-20415686 GCCACAGCATGCCCCACCCAAGG - Intergenic
929028281 2:37626479-37626501 ACCGCAGCTGGCCCTGAGCATGG + Intergenic
929174499 2:38962723-38962745 ACCGCACCCGGCCACAACCAGGG - Intronic
929437519 2:41939764-41939786 ACCATTGCTGGCCCCATTCAGGG - Intronic
929593457 2:43161464-43161486 ACCACACCTGGCCCCAAGTCAGG + Intergenic
932200334 2:69821140-69821162 ACCTCAGCTGGCCCCTGCCTAGG - Intronic
932739948 2:74283629-74283651 CTGACAGCTGCCCCCAACCATGG - Intronic
937647829 2:124285508-124285530 ACCACACCAGGCCACATCCAGGG - Intronic
940762398 2:157751788-157751810 GCCACAGCAAGCCCCACCCAAGG + Intronic
941814225 2:169784483-169784505 ACTACAGGTGCCCACAACCACGG - Intergenic
942464096 2:176189467-176189489 ACCCCAGGTGGCCCCATCCAAGG - Intronic
944551044 2:200844968-200844990 GCAAGAGCTGGGCCCAACCACGG + Intergenic
945132129 2:206584598-206584620 ACCACAGCAAGACCCACCCAAGG + Intronic
945362324 2:208906784-208906806 GCCACAGCATGCCCCACCCAAGG + Intergenic
946713764 2:222532529-222532551 ACCAGATCTGGCCCCACCCCAGG + Intronic
947101718 2:226628308-226628330 ACCAAAGATGGCCCCAAGGATGG - Intergenic
947166229 2:227264668-227264690 ACCACACCTGGCCCCAGAAAAGG - Intronic
947683733 2:232061907-232061929 ACCACACTTGGGCCCAAACAAGG + Intronic
1168743901 20:219503-219525 ACCACAGCTGGCACCATGCTGGG - Intergenic
1169070463 20:2725651-2725673 ACCAAATCTGGCCCCAAACCGGG + Intronic
1170031076 20:11944765-11944787 ACCTCAGCTGGGCCTAACCCAGG - Intergenic
1170654979 20:18278092-18278114 ACAGCAGTTGGCCCCAACCTAGG - Intergenic
1171040771 20:21760928-21760950 ACCACACCTGGCCCAAATTATGG - Intergenic
1171066932 20:22026621-22026643 GCCACAGCAAGCCCCACCCATGG - Intergenic
1171305247 20:24099749-24099771 ACCACAGCTAACCAAAACCATGG - Intergenic
1172500606 20:35423940-35423962 ACCACAGCTGTGCACCACCACGG - Intergenic
1174417896 20:50379625-50379647 GCCACAGCTGGCCCCACCGAAGG + Intergenic
1174606398 20:51765008-51765030 ACCACATCTGGCCCCTAAAATGG + Intronic
1175133296 20:56805686-56805708 TCCACACCTGGTCCCTACCAGGG - Intergenic
1175681344 20:60991194-60991216 AACACAGCGGGCTCCACCCACGG + Intergenic
1176242514 20:64081592-64081614 AGCTCACCTGGCCCCACCCATGG - Intronic
1176378948 21:6102132-6102154 GCCACAGCTGTCCTCACCCAGGG - Intergenic
1177578894 21:22994182-22994204 GCCACAGCAAGCCCCACCCACGG + Intergenic
1179744526 21:43436105-43436127 GCCACAGCTGTCCTCACCCAGGG + Intergenic
1179829199 21:43985549-43985571 CACACAGCTGGGTCCAACCACGG - Exonic
1179930624 21:44568750-44568772 ACTGCAGCTGGCCCCAGCCTGGG + Intronic
1180836826 22:18934107-18934129 CCCACTGCTGTCCCCATCCAAGG + Intronic
1180905882 22:19411165-19411187 ACCAGCGCTGGCTGCAACCAAGG + Intronic
1181378898 22:22483555-22483577 ACCACACCTGGCCCCAAAAATGG + Intergenic
1182361166 22:29747404-29747426 ACCACACCTAGCCCCAACCAGGG + Intronic
1182537944 22:31019915-31019937 ACCACAGACAGCCCCAACCAGGG - Intergenic
1182918663 22:34059536-34059558 ACCAGACCTGGCCTCAACCTGGG - Intergenic
1184777155 22:46628920-46628942 ACCAGAGCTGGTCCAGACCACGG - Intronic
1203286919 22_KI270734v1_random:159406-159428 CCCACTGCTGTCCCCATCCAAGG + Intergenic
950227142 3:11245061-11245083 ACCACACCTGGCCCTAACTCAGG - Intronic
950611957 3:14132627-14132649 ACCACTGTGGGCCCCCACCATGG - Intronic
952106629 3:30077608-30077630 GCCTCAGCTATCCCCAACCAAGG - Intergenic
953179317 3:40581779-40581801 AGAACAGCTGGGCCCAAGCAAGG - Intergenic
954989875 3:54831488-54831510 GCCACAGCTGCTCCCCACCATGG + Intronic
955939841 3:64137375-64137397 ACCACTGCTGGCCTCCACCCTGG + Intronic
956658037 3:71570903-71570925 AGCACAGCTGGCCCCAGCCTGGG + Intronic
960403953 3:117237143-117237165 CCTACAGTTGGCCCCAACCCAGG - Intergenic
961865920 3:129953399-129953421 ACCAGAGCTGGCCAGCACCAGGG - Intergenic
961887521 3:130106132-130106154 TCCACAGCTGGTCCCATCCTAGG + Intronic
964737769 3:159933947-159933969 AGCAAAGCTGCCCACAACCATGG - Intergenic
965250992 3:166343722-166343744 ACTACAGGTGCCCCCCACCATGG - Intergenic
965296653 3:166955650-166955672 ACCACAGCAAGCCCTGACCAAGG - Intergenic
969322832 4:6423491-6423513 ACCACACCCGGCCCCCACTAGGG + Intronic
969662028 4:8535970-8535992 ACCATGGCTGGCCAAAACCAAGG + Intergenic
969871972 4:10110280-10110302 TCCACAGCTGTCCCTAACAAGGG + Intronic
970066848 4:12104950-12104972 AGCACAGCTGGCCCAGGCCAGGG - Intergenic
970282957 4:14478507-14478529 GCCACAGCAAGCCCCATCCAAGG + Intergenic
971017530 4:22504133-22504155 TACACACCTGCCCCCAACCATGG + Intronic
971472301 4:27040293-27040315 GCCACAGCAAGCCCCACCCAAGG - Intergenic
976887860 4:90007877-90007899 GCCACAGCAGGCCCTACCCATGG + Intergenic
977472578 4:97459576-97459598 ACTACAGCTGCCCACCACCATGG + Intronic
977976117 4:103268839-103268861 GCCACAGCAAGCCCCATCCAAGG - Intergenic
987380081 5:17276587-17276609 ACTACAGGTGCACCCAACCACGG - Exonic
988602071 5:32649393-32649415 ACCACAGGTGTCCACTACCATGG - Intergenic
989431546 5:41361059-41361081 GCCACAGCAAGCCCCACCCATGG - Intronic
994887450 5:105582712-105582734 GCCACAGCAAGCCCCACCCAAGG + Intergenic
995020336 5:107360150-107360172 AGCACAGGTTGCCCCTACCAAGG + Intergenic
996080813 5:119256034-119256056 ACCACAGCAAGCCCCGCCCAAGG + Intergenic
996693492 5:126367144-126367166 ACCACACCCGGCCCAGACCAAGG + Intronic
996927606 5:128846540-128846562 AGCACTGCTGGACCCATCCAGGG + Intronic
997362762 5:133305640-133305662 ACCACAGCAGGCCCTGCCCATGG - Intronic
997383401 5:133453678-133453700 GCCACAGCACGCCCCAAGCAAGG + Intronic
997445516 5:133936808-133936830 TCTACAGCTGGCTCCCACCATGG + Intergenic
997977919 5:138451059-138451081 ACCGCACTTGGCCCCAACCTGGG + Intergenic
999321498 5:150618290-150618312 CACACAGCTGGCCCCAGCCCAGG + Exonic
999484854 5:151985318-151985340 ACCACAGCAAGACCCACCCAAGG - Intergenic
999742763 5:154569033-154569055 ACCACACCTGGCCCAAACCCAGG - Intergenic
1000264490 5:159621539-159621561 ATCACAGCAAGCCCCACCCATGG + Intergenic
1001145253 5:169178157-169178179 ATCCCAGCTGGCCCAAACCAGGG + Intronic
1005683163 6:28226640-28226662 ACCACAGCTGACCCAGACCTAGG - Intronic
1005932457 6:30493770-30493792 GCCACAGAGGGCCCCCACCAGGG + Exonic
1006093706 6:31643016-31643038 ACCACAGCTGGCCCCGCTCCTGG - Exonic
1006298709 6:33181773-33181795 ACCACACCTGGCCCCTTTCAGGG + Intronic
1006436551 6:34028773-34028795 ACCACAGCTGGCCCTTCTCAGGG + Intronic
1007150266 6:39683662-39683684 AACACTGATGGCCCCAACCTTGG - Intronic
1010027818 6:71239992-71240014 GCCACAGCAAGCCCCATCCAAGG + Intergenic
1011618637 6:89221303-89221325 ACCCCAGCTGCTCCCAAACAGGG + Intronic
1014313181 6:119830687-119830709 GCCACAGCAAGCCCCACCCAAGG - Intergenic
1017372097 6:153723029-153723051 ACCAATTCTGGCCCCTACCAAGG - Intergenic
1018903793 6:168063847-168063869 CCCACAGCTGGTGCCAACCTCGG + Intronic
1019123465 6:169823996-169824018 GCCACAGCAAGCCCCATCCAAGG - Intergenic
1019265791 7:116790-116812 ACAACAGCTGGCACCCACCTTGG + Intergenic
1019307952 7:344745-344767 AGCTCAGCTGGCCCCAGGCAGGG + Intergenic
1023067281 7:36390187-36390209 ACCACAGCAGGCCGCAGCCGCGG - Intronic
1023957090 7:44895118-44895140 ACAACAGCTGGCCCTGGCCAGGG - Intergenic
1024166575 7:46739005-46739027 ACCAGAGCTGGAGCCAACCAGGG + Intronic
1024367298 7:48535665-48535687 ACCACAGCAAGCCCCACCAAAGG - Intronic
1025252763 7:57362927-57362949 GCCACAGCTGGCCCCACCGAAGG - Intergenic
1025952626 7:66157506-66157528 ACCACACCTGGCCCCAGACAAGG - Intergenic
1026484745 7:70808318-70808340 ATCACAGCTGACCGTAACCATGG - Intergenic
1026805768 7:73429111-73429133 ACAACTACTGGCCCCAGCCAGGG + Intergenic
1026835846 7:73638569-73638591 ACCACACCTGGCCTCAACTAAGG + Intergenic
1029688396 7:102164565-102164587 ACCACAGCTGACCCTCACCACGG + Intronic
1030365880 7:108645621-108645643 GGCACAGCTGGCCCAAAGCATGG + Intergenic
1030723606 7:112898667-112898689 ACCACAGCTGGCCTCATGCTGGG - Intronic
1030937538 7:115603830-115603852 ACCACTGCTGCCCCTATCCATGG + Intergenic
1030972331 7:116075712-116075734 ACAGCAGCAAGCCCCAACCAAGG + Intronic
1031090420 7:117347898-117347920 GCCACAGCAAGCCCCACCCAAGG - Intergenic
1034566283 7:151918229-151918251 GGCACAGCTGGCCCCAGGCATGG + Intergenic
1035045604 7:155963514-155963536 ACCACAGCTGGGCCAAACGGTGG - Intronic
1036642393 8:10592581-10592603 ACCACAGCCTGCCCCTCCCAGGG + Intergenic
1038248916 8:25884417-25884439 TCCACAGCTGGCGCCATCCTGGG + Intronic
1038642065 8:29336982-29337004 ACCAGAGCTGGCTCCCAGCAAGG - Exonic
1040482502 8:47839375-47839397 ATCACAGCTTGCCCCACTCATGG + Intronic
1040779650 8:51092913-51092935 ACCACATCTTGCCACAAACAGGG + Intergenic
1041006908 8:53504217-53504239 ACCACACCTAGCCCCAGCAATGG + Intergenic
1041095036 8:54341689-54341711 ACCACAGCTGGCCCTTCCTATGG + Intergenic
1042995533 8:74693798-74693820 GCCACAGCAAGCCCCACCCAAGG + Intronic
1043912128 8:85875394-85875416 AGCACAGCTGTCCCCTCCCAAGG + Intergenic
1047700577 8:127445614-127445636 ACCACAGATAGCCCCTACTAGGG + Intergenic
1049744728 8:144258420-144258442 ACCACAGGTGCCCCCCACCCCGG - Intronic
1049758265 8:144320406-144320428 TCCACAGCTGGCCACCCCCAGGG + Intronic
1050133597 9:2439192-2439214 GCCACAGCAAGCCCCACCCAAGG - Intergenic
1051819605 9:21149481-21149503 CCCACAGCCCTCCCCAACCAGGG - Intergenic
1051885654 9:21890099-21890121 GCCACAGCAAGCCCCACCCAAGG - Intronic
1055426077 9:76198228-76198250 ACCACAACTGGATCCAACAATGG - Intronic
1056464792 9:86843112-86843134 ATCCCAGCTGGCCCCGTCCAAGG + Intergenic
1058233598 9:102461712-102461734 GCCACAGCAAGCCCCATCCAAGG + Intergenic
1058396241 9:104557244-104557266 GCCACAGCAAGCCCCAGCCAAGG + Intergenic
1059453803 9:114387341-114387363 ACCAGAGCTGGCAACAGCCAGGG - Intronic
1061542929 9:131288092-131288114 AGCCCAGCTGGACCCAGCCAGGG + Intergenic
1062503178 9:136859900-136859922 ACCACAGCTGGCACAGACCCGGG - Exonic
1185677755 X:1862347-1862369 ATCACACCTGACCCCAAGCAGGG + Intergenic
1186308384 X:8289940-8289962 GCCACAGCAAGCCCCACCCAAGG + Intergenic
1192609652 X:72554710-72554732 CCCACAGCAGGCCCCACCCAAGG + Intronic
1192713811 X:73618430-73618452 GCCACAGCAGACCCCACCCAAGG - Intronic
1192994561 X:76498984-76499006 ACCACAGCAAGCCCCACCCAAGG - Intergenic
1193196951 X:78643585-78643607 GCCACAGCAAGCCCCACCCAGGG + Intergenic
1194734253 X:97493588-97493610 ACCACATCTGGCCCTAACAGAGG - Intronic
1195996114 X:110733269-110733291 ACCACAGCATGGCCCAGCCAGGG + Intronic
1197578587 X:128254541-128254563 CCCTCAGCTGGCACCAACAAAGG - Intergenic
1199059618 X:143339506-143339528 ACCACAGCCAGCCCCTCCCATGG + Intergenic
1199586838 X:149423661-149423683 GCCACAGCTAGCCCCACCCAAGG + Intergenic
1200834949 Y:7724193-7724215 ACCACAGGTGACCCCAACATAGG + Intergenic
1200939168 Y:8764546-8764568 CCTCCAGCTGGGCCCAACCACGG - Intergenic
1202038058 Y:20655285-20655307 GCCACAGCTGGCCCTGCCCAAGG + Intergenic