ID: 1082963645

View in Genome Browser
Species Human (GRCh38)
Location 11:58943247-58943269
Sequence CTGCTGGGATTGGCCAACAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082963645 Original CRISPR CTGCTGGGATTGGCCAACAC TGG (reversed) Exonic
900002881 1:24674-24696 TTGCTGGGATTGCCCAGGACAGG + Intergenic
900022601 1:195199-195221 TTGCTGGGATTGCCCAGGACAGG + Intergenic
902628706 1:17692067-17692089 CTCCTGGAGTTGGCCAACATGGG - Intronic
903250336 1:22048789-22048811 ATGCTGTGATTGGCCAAGCCTGG + Intergenic
903394087 1:22985997-22986019 CAGTTGGGTTTGGCCAACAGGGG - Intergenic
903499509 1:23793599-23793621 CTGCTGGGAGGGGCCACCAGGGG + Intronic
903811092 1:26035477-26035499 CTGTTGTGATTGGCCAACCGGGG - Exonic
904342465 1:29845695-29845717 CTGATGGGATTGGCCCAGGCAGG - Intergenic
904399695 1:30248033-30248055 CTGATGGGATTGGCCCAGGCAGG + Intergenic
905940668 1:41860734-41860756 CTGCTGGGTCTGGCCCCCACAGG + Intronic
911171538 1:94775484-94775506 CTGCTGTGATTGGCTGACATCGG - Intergenic
915080453 1:153348542-153348564 CTGCTGGGCTGGGACAGCACAGG - Exonic
916199466 1:162256438-162256460 GTGCGGGGATTGGCCAACAAGGG - Intronic
917476796 1:175375669-175375691 CTGCAGGGAATGGCAAATACAGG + Intronic
917629210 1:176876608-176876630 CTGTGGGGAGTGGACAACACAGG - Exonic
918077781 1:181183461-181183483 CTGCTGGGGCTGGCCAGCCCTGG + Intergenic
922976043 1:229784306-229784328 CAGCTGGGATTGGCGAAGTCTGG - Intergenic
923552704 1:234976874-234976896 AAGCTGGGACTGGCAAACACTGG + Intergenic
1067324656 10:45255971-45255993 CTGCTGGTGTTGGCAGACACAGG + Intergenic
1068623506 10:59212464-59212486 CTGCTGGGATTGCCTGAGACTGG - Intronic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1073316442 10:102584246-102584268 CTGCTGGTTTTGGCAAACCCTGG - Intronic
1074552385 10:114456745-114456767 CTACAGGCACTGGCCAACACAGG - Intronic
1076297266 10:129396208-129396230 CTGCTCGGATGGGAGAACACCGG - Intergenic
1077168233 11:1153253-1153275 GTGCTGGGCTTGGCTACCACGGG + Intergenic
1077810080 11:5628063-5628085 CTGCTGGGCTTGAGCCACACTGG + Intronic
1080109972 11:28555621-28555643 TTTCTGGGCATGGCCAACACAGG - Intergenic
1082963645 11:58943247-58943269 CTGCTGGGATTGGCCAACACTGG - Exonic
1083392155 11:62360547-62360569 CTGCTTGCATTTTCCAACACTGG + Intronic
1085333197 11:75669448-75669470 CTGCTGGAATTGGTCAAAACCGG + Intergenic
1085374539 11:76047291-76047313 ATGGTGGGATTGGACAACACTGG - Intronic
1086427760 11:86703622-86703644 CTGGTGGCATTGACCATCACAGG + Intergenic
1086918200 11:92555666-92555688 CTGCCAGGATTAGTCAACACAGG - Intronic
1087117413 11:94540618-94540640 CTGCTGTCATTGGCCAAACCTGG - Intergenic
1088476669 11:110246870-110246892 CTGTTGGAAATAGCCAACACAGG - Intronic
1091369337 11:135045653-135045675 CTGGTGGCTTTGACCAACACTGG + Intergenic
1091376299 12:26737-26759 TTGCTGGGATTGCCCAGGACAGG + Intergenic
1093053890 12:14535065-14535087 CTCCTTGGAATGGACAACACTGG + Intronic
1094455239 12:30624700-30624722 TTACTGCGATTGGCCAACACTGG + Intergenic
1095952629 12:47790078-47790100 ATGCTGGGATTGGGGGACACAGG - Intronic
1096411409 12:51379457-51379479 CTTCTGGGAACGGCCACCACAGG - Exonic
1096469348 12:51866262-51866284 CTTCAGGGATTGGCCCACCCTGG - Intergenic
1097232750 12:57522505-57522527 GGGCTGGGATTGGCCACCAGTGG + Intronic
1099241242 12:80141990-80142012 CTCCTGGGCTTGGCCAAGATAGG + Intergenic
1104123217 12:125819163-125819185 GTGCAGGGTTTGGACAACACAGG - Intergenic
1106666107 13:31852416-31852438 CTGCAGGCATTGGCTAACCCTGG + Intergenic
1111809945 13:93087874-93087896 ATGCTGAGATTGGGAAACACAGG + Intergenic
1117450472 14:55845149-55845171 CAGCTGGGAGAGGCCAAGACTGG - Intergenic
1117964089 14:61189203-61189225 CCGCTGGGATTCCCAAACACCGG - Intronic
1121623083 14:95363635-95363657 CTGCTGAGATTGACAAACCCTGG + Intergenic
1123939985 15:25212148-25212170 CTCCTGGCATTGACCAACATAGG + Intergenic
1123944213 15:25231189-25231211 CTCCTGGCATTGACCAACATAGG + Intergenic
1124041003 15:26103561-26103583 CTGCTGCGATTGGAGAATACGGG + Intergenic
1128760834 15:70215084-70215106 CTGCTGGGACAGGCCACCCCTGG - Intergenic
1129375248 15:75126229-75126251 CAGTTAGGATTTGCCAACACTGG - Intergenic
1132450631 15:101966265-101966287 TTGCTGGGATTGCCCAGGACAGG - Intergenic
1132477060 16:145064-145086 CTGCTGGGATTTGCCCATTCTGG + Intergenic
1136676613 16:31914140-31914162 CTGCTGTGATAGGGCAGCACTGG + Intronic
1140284821 16:73592119-73592141 CTACTGGGAGAGGCCAAGACAGG + Intergenic
1140339407 16:74142032-74142054 CTGTTGGTATTGGCCAATCCTGG + Intergenic
1141639544 16:85333375-85333397 CTGGTGGGCTGGGCCAGCACGGG - Intergenic
1144831986 17:18136891-18136913 CAGCTGGTATTGCCCAGCACAGG - Intronic
1145226471 17:21132654-21132676 CTGCTGTGATTGGCTGAGACTGG + Intronic
1146466413 17:33090111-33090133 CTGCCTGGATTGGGCATCACTGG + Intronic
1148052123 17:44774602-44774624 CTGCTGGGCGTGGGCCACACGGG - Intronic
1151400399 17:73852219-73852241 CTGTTGGGATTGGTCAAGACAGG + Intergenic
1154201222 18:12302043-12302065 CTGCTGGGCTTTGCCAAAAGTGG + Intergenic
1155392315 18:25350272-25350294 CTTCTGGGAATGGCCAAGAGGGG + Intronic
1157688899 18:49664808-49664830 CTACTGTGATTGGCCAAGCCCGG - Intergenic
1159359566 18:67382144-67382166 CTGATGGGATGGGCTAACAGGGG + Intergenic
1160623966 18:80190335-80190357 CTCCTGGGATGGGCAAACTCTGG + Intronic
1160634632 19:66282-66304 TTGCTGGGATTGCCCAGGACAGG + Intergenic
1166143607 19:40819490-40819512 CTGCTGTGAATGGTAAACACAGG + Intronic
1166183944 19:41127289-41127311 CTGCTGTGAATGGTAAACACAGG - Intronic
1166383933 19:42370050-42370072 CCGCTGGGATTGTCCAAACCAGG + Intronic
1167210800 19:48133061-48133083 CGGGTGGGATGGGCCAACATTGG + Exonic
1168498426 19:56873529-56873551 CGGCTGGGCTTGGCCACCAGAGG + Intergenic
933219170 2:79668982-79669004 CTGCTGGGATTAGCACACAGTGG - Intronic
933967165 2:87439647-87439669 CAGCTGGGGGTGGCCACCACTGG - Intergenic
935676860 2:105601845-105601867 ATGCAGTGATAGGCCAACACTGG + Intergenic
936326630 2:111510848-111510870 CAGCTGGGGGTGGCCACCACTGG + Intergenic
936473706 2:112821777-112821799 CTGGTGGGATGGGCCATCACAGG - Intergenic
936566845 2:113588745-113588767 TTGCTGGGATTGCCCAGGACAGG - Intergenic
938928310 2:136064282-136064304 TGGCTGGGTTTGGCCAACAGGGG - Intergenic
939152932 2:138494606-138494628 CTGCTGGGACTGACCAGCAAAGG - Intergenic
940864399 2:158803703-158803725 CATCTGAGCTTGGCCAACACCGG + Intronic
941297643 2:163760079-163760101 GTGCTGAAATTGGCCAACAAAGG + Intergenic
945727550 2:213491556-213491578 CTGATGGGAGTGGCCAATGCTGG + Intronic
946003652 2:216504643-216504665 CTGCAGGGAGTGGTCAACAAAGG - Intronic
947158838 2:227191510-227191532 ATGCGGGGAATGGCCAACAGGGG - Intronic
1171134441 20:22684260-22684282 CTGCTGAGATTGGCCGAGATGGG - Intergenic
1174545174 20:51319691-51319713 ATCCTGTGATTGGCCAACTCTGG + Intergenic
1174915569 20:54649678-54649700 CTACAGGGATTGGCAAACAATGG + Intronic
1176428346 21:6562132-6562154 CTGCTGGGGTTGGCAGAGACAGG - Intergenic
1179703836 21:43170448-43170470 CTGCTGGGGTTGGCAGAGACAGG - Intronic
1180803782 22:18649617-18649639 CTGGTGAGAATGGCCAGCACTGG - Intergenic
1181076411 22:20380744-20380766 CTGCTGTGATTGGCTGAGACTGG + Intronic
1184430724 22:44440344-44440366 CTGCTGGGAGTGGCCTCCAGTGG - Intergenic
1185394461 22:50579573-50579595 CTGTAGGGATTGGCCAACCTGGG - Intronic
949234656 3:1793652-1793674 CTCTGGGGATTGGCTAACACTGG - Intergenic
953522174 3:43654173-43654195 ATTCTGGAATTTGCCAACACAGG + Intronic
953577010 3:44120916-44120938 CAGCTGGGAGAGGCCACCACAGG - Intergenic
955988172 3:64596959-64596981 CCGCTGGGATCCGCCAGCACAGG + Exonic
961952187 3:130761848-130761870 CTGCTGTGATAGGACAGCACTGG - Intergenic
969975953 4:11101599-11101621 CTGATAGGAAAGGCCAACACTGG - Intergenic
974088008 4:57281697-57281719 CTGCTTGGATTGGGCACCAAGGG - Intergenic
975760281 4:77613436-77613458 CCCCTGGGATTGGACAACACAGG - Intergenic
977821581 4:101478160-101478182 CTGCTGTGAATGTCCAATACTGG + Intronic
982550877 4:156797781-156797803 CTGCTGTGATTGGCTGAGACTGG + Intronic
984841832 4:184075861-184075883 CTGCTGGGATTCTCAAAGACTGG - Intergenic
992869688 5:80993848-80993870 CTGCTGGGTTTGACCCACAGCGG - Intronic
995469371 5:112484384-112484406 CTGTTGGGTTTGGCCAATAAAGG + Intergenic
997696684 5:135866563-135866585 CTGTTAGGATTGGCCAAACCTGG + Intronic
1000728013 5:164796761-164796783 CTGCTGGGATTGACTAATAGTGG + Intergenic
1004143576 6:13044518-13044540 ATGCTCTGATTGGCCAGCACTGG + Intronic
1019224618 6:170499971-170499993 CTGCTGGGCCCGGCTAACACAGG + Intergenic
1019501250 7:1365817-1365839 CTACTGGGGCTGGCCAACAAGGG + Intergenic
1019855025 7:3596949-3596971 CGCCTGTGATTGGCCAAAACTGG + Intronic
1021019476 7:15578677-15578699 CTGCTGAGATTGGCTGAGACTGG + Intergenic
1021413305 7:20353119-20353141 ATGCTGGGATTGCCCTAAACAGG + Intronic
1023390057 7:39701158-39701180 CTTCTGGGTCTGGCCAACTCTGG + Intronic
1023866184 7:44239431-44239453 CTGCTGGGATGTGACCACACGGG + Intronic
1027230794 7:76271040-76271062 CACCTGGGATGGGCCAACAAAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030742395 7:113125477-113125499 CTGCTGGGCATAGCCCACACTGG - Intergenic
1038567732 8:28634026-28634048 ATGCTGGGACTGTCCAGCACAGG - Intronic
1042521411 8:69715468-69715490 CTGCTGGATTTGGACAACAATGG - Intronic
1043549467 8:81353650-81353672 TTGCTGGCATTGATCAACACAGG + Intergenic
1048852486 8:138658219-138658241 GTGCAGGGTTTGGACAACACTGG - Intronic
1049505227 8:142992649-142992671 CTGCTGGCAATGGCAACCACCGG - Intergenic
1049843552 8:144788979-144789001 CTGCTGGGATTGCTGAACAAAGG - Intergenic
1049885686 9:24787-24809 TTGCTGGGATTGCCCAGGACAGG + Intergenic
1054905387 9:70410296-70410318 TTGTTTGGCTTGGCCAACACAGG - Intronic
1060814041 9:126625586-126625608 CAGCCGGGAATGGCCAACCCTGG - Intronic
1061486932 9:130924759-130924781 CAGCTGGATTTGCCCAACACGGG - Intronic
1187490165 X:19744010-19744032 CTGCTTTGATTGGCTAACATGGG - Intronic
1187886360 X:23892521-23892543 CTGCTGGAATTGGCCAAGGTGGG + Intronic
1197396874 X:125938516-125938538 CTGCTTGGTTTGGCCAAAATTGG - Intergenic
1197612757 X:128657482-128657504 CAGCTGAGACTGGCCAATACTGG + Intergenic