ID: 1082965968

View in Genome Browser
Species Human (GRCh38)
Location 11:58966477-58966499
Sequence CAGTGTGTGGAGTGGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 10, 3: 44, 4: 281}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082965968_1082965976 25 Left 1082965968 11:58966477-58966499 CCTGATTCCCACTCCACACACTG 0: 1
1: 0
2: 10
3: 44
4: 281
Right 1082965976 11:58966525-58966547 CCTCTAGTGCGACTGGGTTAGGG 0: 1
1: 65
2: 234
3: 355
4: 282
1082965968_1082965973 19 Left 1082965968 11:58966477-58966499 CCTGATTCCCACTCCACACACTG 0: 1
1: 0
2: 10
3: 44
4: 281
Right 1082965973 11:58966519-58966541 TTAATTCCTCTAGTGCGACTGGG 0: 1
1: 68
2: 262
3: 348
4: 305
1082965968_1082965972 18 Left 1082965968 11:58966477-58966499 CCTGATTCCCACTCCACACACTG 0: 1
1: 0
2: 10
3: 44
4: 281
Right 1082965972 11:58966518-58966540 TTTAATTCCTCTAGTGCGACTGG 0: 1
1: 70
2: 257
3: 353
4: 302
1082965968_1082965974 24 Left 1082965968 11:58966477-58966499 CCTGATTCCCACTCCACACACTG 0: 1
1: 0
2: 10
3: 44
4: 281
Right 1082965974 11:58966524-58966546 TCCTCTAGTGCGACTGGGTTAGG 0: 1
1: 67
2: 238
3: 350
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082965968 Original CRISPR CAGTGTGTGGAGTGGGAATC AGG (reversed) Intronic
900181599 1:1313479-1313501 CATGGTGAGGTGTGGGAATCTGG - Intronic
901850842 1:12014253-12014275 AAGTGTGTAGCCTGGGAATCTGG - Intergenic
903889540 1:26560459-26560481 CAGTGTAGGGAGTGGGAAACAGG - Intronic
904342639 1:29846798-29846820 TGCTGTGTGGTGTGGGAATCAGG - Intergenic
905164687 1:36072817-36072839 CAGTGAGTGGAGTGAAAATGGGG + Intergenic
907385516 1:54122914-54122936 GAGTGTGTGCAGGGGGAACCTGG + Intergenic
910387590 1:86702620-86702642 CAGAGTGTGGACTGGGCATTGGG - Intergenic
911587274 1:99705219-99705241 CAGGGTGTGGAATGGGGATGTGG - Intergenic
911977348 1:104516068-104516090 TAGAGCGCGGAGTGGGAATCGGG + Intergenic
912975750 1:114328746-114328768 CAGTGGTTGGAGTGGGATGCAGG - Intergenic
913577994 1:120196845-120196867 CAGTGGGTGGAGAGAGAATGGGG + Intergenic
913630176 1:120701507-120701529 CAGTGGGTGGAGAGAGAATGGGG - Intergenic
914559910 1:148808265-148808287 CAGTGGGTGGAGAGAGAATGGGG + Intronic
914612923 1:149321950-149321972 CAGTGGGTGGAGAGAGAATGGGG - Intergenic
915107374 1:153542862-153542884 CAGTGGCTGGAGTGGGAGTGAGG - Intergenic
915214586 1:154331298-154331320 GAGCGTGGGGAGAGGGAATCAGG + Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
916580324 1:166101079-166101101 CAGGGTCTGGAGTGGGCCTCTGG + Intronic
916702985 1:167317440-167317462 TAGAGTGCAGAGTGGGAATCAGG + Intronic
916703528 1:167322680-167322702 TAGAGTGCAGAGTGGGAATCAGG + Intronic
916754981 1:167760661-167760683 AAGTTTGGGGGGTGGGAATCAGG + Intronic
916884766 1:169056438-169056460 CAGTCTGTCAAGTGTGAATCAGG - Intergenic
917028855 1:170668173-170668195 GAGAGTGTGGAGTGTGAATGGGG + Intronic
920570905 1:207016555-207016577 CAGAGTGTGGATTGGGAAGGAGG + Intronic
922088284 1:222371514-222371536 CAGGGTGAGGAGTGTGATTCAGG - Intergenic
922933698 1:229408594-229408616 CACAGAGTGGGGTGGGAATCCGG + Intergenic
923992215 1:239451451-239451473 CAGAGTGTGGACTCAGAATCTGG + Intronic
924243949 1:242063487-242063509 CCCTGTATGGAGTGGGCATCCGG + Intergenic
1063080543 10:2763310-2763332 CAGTGAGTGACCTGGGAATCTGG + Intergenic
1063327592 10:5120315-5120337 TAGAGTGTGGAGTGGTAATCAGG - Intronic
1064385907 10:14891279-14891301 CAGTGTGTGTTGTGTGAATGGGG + Intronic
1064481324 10:15743629-15743651 CAGTGCTTGGAGTGGTATTCTGG + Intergenic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1067766075 10:49088464-49088486 AAGTGTTTGAAGGGGGAATCTGG - Intronic
1067941635 10:50661598-50661620 CCATGTGTGGAGAGGGAATGAGG - Intergenic
1068466039 10:57393478-57393500 CAATGTGTGGAGTGGACATTTGG + Intergenic
1069961872 10:72083943-72083965 AGGTGTGTGGGGTGGGAAGCAGG + Intronic
1070169266 10:73920436-73920458 CAGTCTCTGGAGTGAGAATCTGG - Intronic
1070173443 10:73950354-73950376 CAGTGTGCGGGGAGAGAATCTGG + Intergenic
1070862872 10:79686557-79686579 CCATGTGTGGAGAGGGAATGGGG - Intergenic
1074299990 10:112225201-112225223 GTGTGTGTGGTGAGGGAATCTGG - Intergenic
1075873199 10:125786080-125786102 CAGGGTGTCGAGTGAGACTCTGG + Intronic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1078155205 11:8794258-8794280 CAGAGTGGGGACTGGGACTCAGG - Intronic
1078689326 11:13563164-13563186 TAGAGTGCAGAGTGGGAATCAGG + Intergenic
1079124347 11:17708240-17708262 CAGTGGGTGGGGTGGGGATGAGG - Intergenic
1079349724 11:19682176-19682198 TAGATTGAGGAGTGGGAATCTGG + Intronic
1080465067 11:32488741-32488763 AAATGTGTGGAGTGGGAATTTGG - Intergenic
1080695835 11:34602400-34602422 CAGTGTGTGGAGTGCAAGTCAGG + Intergenic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1081840518 11:46197817-46197839 CAGAGTGTGGTGTGGGACCCAGG + Intergenic
1082767418 11:57180555-57180577 CAGTGTGTGGAAAGGGATGCTGG + Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1084669595 11:70597239-70597261 CAGTGGGTGGAGAGAGAATGAGG - Intronic
1084790069 11:71469434-71469456 TAGAGTGTGGAGTGGGAATCAGG + Intronic
1085259357 11:75195529-75195551 CAGGGTGTGGAGTGGGGAAGTGG - Intronic
1085315942 11:75545011-75545033 CAGTGTGTGGTGGTGGAATGGGG + Intergenic
1089518346 11:119047866-119047888 GAGTGTGGGGAGTGGGAAGCTGG + Intronic
1090391876 11:126394168-126394190 CAGTGTCTGGGGCTGGAATCTGG - Intronic
1090745532 11:129702009-129702031 CAGGGTGGGGCTTGGGAATCTGG + Intergenic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1091275335 11:134345928-134345950 CTGTGGTTGGAGTGGAAATCTGG + Intronic
1091752377 12:3031043-3031065 CAGGGTGTGGCGTGGGAGGCAGG + Intronic
1092126724 12:6079897-6079919 CAGTGTGTGAGGTGGGGAGCAGG - Intronic
1092126915 12:6080950-6080972 CAGTGGGTGGGGTGGGCAGCAGG + Intronic
1093121282 12:15274491-15274513 TGGTGTGTGGTGTGGGCATCTGG - Intronic
1093665872 12:21812105-21812127 TAGTGTGTGCAGTGGTAATTTGG + Exonic
1096275529 12:50204333-50204355 AAGTGAGTGGGGTGGGAACCAGG + Intronic
1099391595 12:82087297-82087319 AAGTGTGGGAAATGGGAATCTGG + Intergenic
1101448572 12:104755931-104755953 AAGGGTGAGGAGTAGGAATCAGG + Intronic
1102205508 12:111088111-111088133 CAGGGAATGGAGTGGGAATGGGG + Intronic
1102756725 12:115347628-115347650 CAGTGTGTGTAGGGGGGGTCAGG + Intergenic
1103452551 12:121039437-121039459 CAGGTGGTGGAGTGAGAATCTGG + Intergenic
1104908021 12:132225658-132225680 CAGTGTGTGGAGTGTGTGTGTGG - Intronic
1104908074 12:132225951-132225973 CAGTGTGTGGGGTGTGCATATGG - Intronic
1104908197 12:132226685-132226707 CAGTGTGTGGGGTGGGTGTTTGG - Intronic
1104908208 12:132226746-132226768 CAGTGTGTGGGGTGGGTGTATGG - Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1107694745 13:42989418-42989440 CAGTGTGGGGATTAGGAATATGG - Intronic
1107802455 13:44121595-44121617 CAGTGACTGGAGTGGGACACAGG - Intergenic
1108005694 13:45944181-45944203 CAGTTTTTGGAGTGGGTGTCAGG + Intergenic
1108865718 13:54919968-54919990 TAGAGTGCAGAGTGGGAATCAGG + Intergenic
1109326472 13:60873305-60873327 CAGTGTGTGGATAGGGAAAGAGG + Intergenic
1109490053 13:63085965-63085987 CAGTCTGTGGCCTGGGAATTGGG - Intergenic
1111414854 13:87926822-87926844 GAGGGTGTGGAGTGGGAAGAGGG + Intergenic
1112852063 13:103718297-103718319 CAGTGTGGGGGCTGGAAATCAGG - Intergenic
1113144097 13:107187548-107187570 GAGTGTGTGGGGTGGAAGTCAGG - Intronic
1113424388 13:110195973-110195995 CAGGGTGTGGAGTGGGGCTGTGG + Intronic
1113927084 13:113947593-113947615 CAGTGGGTGGAGCGGGGAGCTGG + Intergenic
1115504650 14:34081609-34081631 CAGTGTGTGGAATGGGAGTTAGG - Intronic
1115779006 14:36748848-36748870 AAGTCTGTGGAGGGAGAATCTGG - Intronic
1116238752 14:42313754-42313776 TAGAGTGTGGAGTGGGAATCAGG + Intergenic
1118294309 14:64554832-64554854 AAGTGTGTGGAGTGGGTAAAGGG + Intronic
1118968074 14:70606868-70606890 CAGTGTGTGCAGTGGTGATTTGG - Intergenic
1119087161 14:71749299-71749321 CAGTGAGAGGAGTGGGGAACAGG - Intergenic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1121104055 14:91269468-91269490 CTGAGGGTGGGGTGGGAATCTGG - Intergenic
1121302808 14:92885446-92885468 GAGTGTGAGGAATGGGGATCTGG + Intergenic
1121679738 14:95783562-95783584 CACTGTGTGGAGTGGAAATGAGG - Intergenic
1121711598 14:96042823-96042845 CACTGTGTGGAGTGGGGCTGGGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123984875 15:25636479-25636501 TAGAGTGCAGAGTGGGAATCAGG - Intergenic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1124621932 15:31278851-31278873 CAGTGGGTGGGGTGGGCATGAGG + Intergenic
1126329833 15:47520348-47520370 CAGAGTGAGGAATAGGAATCAGG + Intronic
1126539732 15:49808624-49808646 TAGTGTGTGGAGTGTGACTTTGG - Intergenic
1127281913 15:57500096-57500118 GGGTGTGGGGAGTGGGAATGGGG + Intronic
1127360149 15:58238048-58238070 CAGCGTGTGGAGTGGGAAATAGG - Intronic
1128315676 15:66657759-66657781 CAGTGAGCGGAGTGGGCCTCAGG - Intronic
1129749078 15:78047796-78047818 CAGTGTCTGGAGTGGGGGGCAGG + Intronic
1129751459 15:78067717-78067739 CAGTGTGAGAAGTGGGGATTTGG - Intronic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130009856 15:80142624-80142646 CAGAGTGCAGAGTGGGAATCAGG + Intergenic
1130059239 15:80557723-80557745 GAATGTGTGGAGTGGGATTGAGG - Intronic
1130230354 15:82092263-82092285 CACTGTGGGGTGTGGGAGTCCGG - Intergenic
1130522536 15:84673539-84673561 CAGTGTATGGAATGGGAGTTTGG - Intronic
1131053121 15:89360891-89360913 CAGTGAGTGGAGGGGGTGTCTGG + Intergenic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1133953369 16:10418013-10418035 TAGAGTGCGGAGTGGGAATCAGG + Intronic
1133954012 16:10423939-10423961 TAGAGTGTGGAGCAGGAATCGGG + Intronic
1135549850 16:23389677-23389699 CAGTGTCTGGGGTGGGACCCTGG + Intronic
1135748628 16:25038470-25038492 CAGGGTGGGGAGTGGGTACCAGG + Intergenic
1136600480 16:31283982-31284004 CAGGGTCTGGAGTGGAACTCCGG - Intronic
1136871063 16:33808585-33808607 CAGCGTGTGGTGTGGGAGCCTGG + Intergenic
1137579062 16:49622352-49622374 CATTGTGGGGAGTGAGAATGGGG - Intronic
1137799948 16:51254158-51254180 CAGGGTCTGGAGTGGGCCTCTGG - Intergenic
1138311091 16:56024591-56024613 CAGAGTGTGGTGTGTGAATGAGG - Intergenic
1139710287 16:68770772-68770794 CAGTGTGTGGAGTGGGCAAGAGG + Intronic
1139957110 16:70698332-70698354 CAGTGCCTGGAGTGGGACTGGGG + Intronic
1203101109 16_KI270728v1_random:1307473-1307495 CAGCGTGTGGTGTGGGAGCCTGG - Intergenic
1145716683 17:27029470-27029492 CAGGGTCTGGAGTGGGCCTCTGG + Intergenic
1145816188 17:27796729-27796751 CAGTGTGGGGAGCTGGAGTCAGG + Intronic
1146304599 17:31721429-31721451 CGGTAGGTAGAGTGGGAATCGGG + Intergenic
1147146087 17:38485292-38485314 CTGTGGGTGGAGTGGGAGTTTGG + Intronic
1148429174 17:47627882-47627904 CAGTATGTGGAGTGGCTATTAGG + Intergenic
1148475865 17:47928173-47928195 CAGTGTTGGGAGCGGGGATCGGG - Exonic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1151532714 17:74717271-74717293 CAGTGTATGGAATGGGAATCTGG + Intronic
1151927662 17:77210808-77210830 CAGTGTGTTTCGTGTGAATCGGG + Intronic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1152564642 17:81094775-81094797 TGGTGTGTGGGGTGAGAATCAGG - Intronic
1154102742 18:11491081-11491103 AAGAGTGTGGATTTGGAATCGGG - Intergenic
1155889575 18:31249832-31249854 AAATGTGTGGAGTGGGACTGAGG + Intergenic
1157772308 18:50359748-50359770 CATTGTGTGGAGTGGGGCTCGGG + Intergenic
1158104890 18:53874286-53874308 CAATGTGTGGTGTGGTGATCAGG - Intergenic
1158554492 18:58464173-58464195 CAGTGAGTGGAGGGTTAATCAGG + Intergenic
1159300661 18:66562124-66562146 CAGGGTGGGGAGTGGGCATGGGG + Intronic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1161281778 19:3449424-3449446 CAGTGTCTGGGGTTGGAATGGGG - Intronic
1161630806 19:5354508-5354530 CAGAGTGAGGAGTGGGAAAGAGG + Intergenic
1162270320 19:9609283-9609305 TAGAGTGCAGAGTGGGAATCGGG - Exonic
1162380620 19:10329612-10329634 CAGTGTGTAGAGTGGGCCTCTGG - Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1164230755 19:23285716-23285738 CAGAGTGCAGAGTGGGAATCAGG - Intergenic
1166091171 19:40510044-40510066 CAGTGTGGGGAGTGCGAGTGTGG + Intronic
1166111535 19:40626163-40626185 AAGTCTTTGGAGTGTGAATCGGG - Intronic
1166303596 19:41925606-41925628 TAGTGTGTGGATTGGTGATCAGG + Intronic
1166331715 19:42081551-42081573 CAGTGTGTAGAGTGGAATTTGGG + Intronic
1166971921 19:46574628-46574650 CAGTGTGTGGCGTGGGGGTTGGG - Intronic
1167433044 19:49464216-49464238 CAGTGTGTGGAGCGAGAGGCTGG + Exonic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
925227678 2:2199827-2199849 TACTGTGTGTAGTGGGAAGCAGG - Intronic
925995042 2:9285349-9285371 CAGTGTTTGAAGTGGGGATGGGG - Intronic
926498612 2:13622788-13622810 CAGTGAGTGGAGTGGGAAGGTGG + Intergenic
927753058 2:25686995-25687017 CTGTGTGCCGACTGGGAATCTGG - Intergenic
927856392 2:26530303-26530325 CAGTTTGTTGAGTGAGAGTCGGG + Intronic
928101663 2:28440863-28440885 CAGGGTGTGGGGTGGGGATGGGG + Intergenic
928450210 2:31371807-31371829 CACTGTGTGGACTAGGAATCAGG - Intronic
929662089 2:43797144-43797166 CAGTGTGTGTATTGGGGATGGGG + Intronic
930621466 2:53648408-53648430 CTTTCTGTGGATTGGGAATCTGG - Intronic
932157979 2:69435692-69435714 TAGTGTGGGGAGTGGCAGTCAGG - Intronic
932356062 2:71069084-71069106 CAGGGTGGGGAGTGGGAGTGGGG + Intronic
932894765 2:75628793-75628815 CAGTGTGTGGAGTACATATCTGG + Intergenic
934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG + Intergenic
934641741 2:96031001-96031023 CAGGGTGAGGGGTGGGAATGGGG - Intronic
935215890 2:100975107-100975129 CAGAGTGTGGAGAGGTGATCAGG - Intronic
935227354 2:101064412-101064434 CAGTGTGTGGAGGGGGATGGAGG + Intronic
936642019 2:114323979-114324001 CAGGGTGTGGTTTGGGAACCAGG + Intergenic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
939448027 2:142334768-142334790 CAGTGCTTTGAGTGGGGATCTGG + Intergenic
940749796 2:157612536-157612558 CAGTGTGTGGAGTTGGGAAGGGG + Intronic
943270480 2:185795938-185795960 CACTATCTGGAGTGGGAATTTGG - Exonic
943560873 2:189460428-189460450 GAGGGTGTGGAGTGGGAAGGAGG - Intronic
943681908 2:190777509-190777531 CAGGGTCTGGAGTGGAACTCTGG - Intergenic
946361882 2:219223848-219223870 CAGTGAGTGGAGTTGGAGTTAGG - Exonic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
948175619 2:235940351-235940373 GGGTGTGGGGAGTGGCAATCTGG - Intronic
948660093 2:239501703-239501725 CAGTGTGGGGAGTGGGAGATTGG + Intergenic
1169027255 20:2381397-2381419 AAGTGCTTGGGGTGGGAATCAGG - Intronic
1169260808 20:4136619-4136641 CACAGGGTGGAGTGGGAACCAGG + Intronic
1169327638 20:4687677-4687699 CACTGTGTTGTGTGAGAATCTGG - Intronic
1170607255 20:17883522-17883544 GAGTGTGTGGAGGGGGAGTTTGG + Intergenic
1171142443 20:22754965-22754987 CAGAGTGTGGAGCAGGATTCTGG - Intergenic
1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG + Intergenic
1172173939 20:32961103-32961125 CAGAGTGGGGAGCGGGAATGGGG - Intronic
1173617461 20:44412494-44412516 CAGAGTGTGTAGGGGGAAGCCGG + Intronic
1173858757 20:46268508-46268530 CCGTGTGTGGGGTGGGAATGGGG - Intronic
1174796614 20:53527819-53527841 CAGTCTGTGGACTGAGACTCAGG - Intergenic
1175591158 20:60193259-60193281 CAGTGTATCTGGTGGGAATCAGG + Intergenic
1178683009 21:34689021-34689043 CAGTGTGGGGTGAGGGAATGAGG + Intronic
1179107039 21:38410550-38410572 CTGTATGTGGAGTGGGAGTGGGG + Intronic
1179133469 21:38660205-38660227 CCTTGTCTGGAGTGGAAATCAGG - Intronic
1179880505 21:44291548-44291570 CCCTGTCTGGAGTGGGACTCTGG - Intronic
1180260514 21:46665544-46665566 CACTGAGTGGAAGGGGAATCGGG - Intergenic
1181787964 22:25241288-25241310 CTGTGTGTGGAGTGAGTCTCAGG + Intergenic
1182676351 22:32042637-32042659 CAGGCTGTGGAGGGGGAGTCAGG + Intergenic
1182869022 22:33629610-33629632 CAGGGGTTGGAGTGGGAATGGGG + Intronic
1183475862 22:38035427-38035449 CAGTGGGGCAAGTGGGAATCAGG + Intronic
949837639 3:8286530-8286552 CAATCTGTGGAGTGGGCATAGGG + Intergenic
950177240 3:10883360-10883382 GAGTGAGAGGAGCGGGAATCTGG - Intronic
950790815 3:15470461-15470483 CAGTGTGTGGAGTGGCAGGCAGG - Intronic
951658585 3:25036806-25036828 CAGGGTGGGGAGGGGGGATCTGG + Intergenic
952931391 3:38363796-38363818 CAGTGCTGGGAGTGGGAGTCAGG + Intronic
953606987 3:44418756-44418778 CAGTGGCAGGAGTGGGAATTGGG - Intergenic
953767647 3:45756091-45756113 CAGGGTGTGGTGTGGGCATCTGG + Exonic
953995382 3:47515232-47515254 CTGTGTGTGGAGTCCTAATCTGG + Intergenic
954755183 3:52835349-52835371 CAGTGTGTGGGGTGGGTGTGGGG + Exonic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
956019930 3:64923449-64923471 CACAGTGTGGAGGGGGAATATGG - Intergenic
956518527 3:70078410-70078432 CTGGGTGTGGAGTGGCAATGTGG + Intergenic
958544892 3:95533280-95533302 CAGTTTGTGGAGTGGGTCTTTGG + Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959502398 3:107121406-107121428 AAGTGTGTGAAGTGGGGAGCAGG - Intergenic
959941519 3:112086320-112086342 CAGTGGGTGGAGTGTGAGGCGGG + Exonic
960783909 3:121351213-121351235 CAGGGTCTGGAGTGGAACTCAGG - Intronic
962869179 3:139473329-139473351 CAGTGTGTGGAGTGGGTCACTGG + Intronic
965315363 3:167183496-167183518 TAGAGTGCGGAGTGGGAATCAGG + Intergenic
966047636 3:175572025-175572047 TTGTGTGTGGAGTGGGGATGGGG + Intronic
966511357 3:180766753-180766775 CAGAGTGCAGAGTGGGAATCAGG - Intronic
966911783 3:184563929-184563951 CTGAGTGTGGAGTGGGAGTGTGG + Intronic
967265752 3:187690736-187690758 CTCTGTGGGGAGTGGTAATCTGG - Intergenic
971976783 4:33699878-33699900 TAGAGTGTGGAGTGGGAAACTGG - Intergenic
973780685 4:54285689-54285711 GAGTGGGTGGAGTGAGAACCTGG + Intronic
974581929 4:63814651-63814673 CAGTATGGGGAGTGAGAATGTGG + Intergenic
975893856 4:79062432-79062454 CAATGTGAGGTGTGGGAATGGGG - Intergenic
976138027 4:81959996-81960018 CAGTGTTTGTAATTGGAATCAGG - Intronic
977303774 4:95298366-95298388 CAGTGTGTGCAGTTGGCATAGGG - Intronic
977310273 4:95377696-95377718 CTTTGTGAGGAGTGGGAGTCTGG + Intronic
978200732 4:106021174-106021196 AAGAATGTGGAGTGGGAAACTGG - Intergenic
978205237 4:106073380-106073402 CAGGGTCTGGAGTGGAACTCTGG - Intronic
978327413 4:107575153-107575175 AGGTGTGTGGAGTGGGAAGGTGG - Intergenic
978770218 4:112448394-112448416 CAGAGTGTGCAATGGGAATGGGG - Intergenic
980576304 4:134687459-134687481 CATTGTGGGGAGTTGGTATCGGG + Intergenic
980667152 4:135954940-135954962 TAGAGTGTGGAGTGGGAATCAGG + Intergenic
980667735 4:135960618-135960640 TAGAGTGCGGAGTGGGAATCAGG + Intergenic
980914308 4:139020177-139020199 AAGTGTGTGGAATGTGAATCTGG - Intronic
984254416 4:177373904-177373926 CAGTGAGTGCAGTGGGAGTCAGG + Intergenic
984298223 4:177881289-177881311 CAGTTTGTGGAGGGGGAAGCAGG + Intronic
985783086 5:1881086-1881108 CAGTGTGGGGAGCGGGGATGTGG + Intronic
986686969 5:10283168-10283190 CACTTTATGGACTGGGAATCAGG + Intronic
987574614 5:19708848-19708870 TACAGTGGGGAGTGGGAATCAGG - Intronic
988610135 5:32715188-32715210 CAATGTGTGGGGTGAGAATCAGG + Intronic
988909631 5:35826438-35826460 CCGTGTGTGGGGTGGGTATGGGG - Intergenic
993495101 5:88600002-88600024 CAGTCTGTGGCCTGGGAGTCAGG + Intergenic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
997235858 5:132271625-132271647 CAGGGGGTGGAGAGGGAATCGGG - Intronic
997680229 5:135745099-135745121 TAGAGTGCAGAGTGGGAATCAGG + Intergenic
997809427 5:136953332-136953354 CAGGGTCTGGAGTGGACATCTGG - Intergenic
1000174203 5:158734867-158734889 GAGTGTGTGGACTGGGTATTTGG - Intronic
1000725767 5:164769024-164769046 TAGAGTGTGGAGTGGGAATCAGG + Intergenic
1002415695 5:179119799-179119821 GAGCCTGTGGAGTGGGAATGTGG - Intronic
1002669614 5:180855978-180856000 CAGTGAGTGGAGTGGCAGTGAGG - Intronic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005106453 6:22229257-22229279 GAGTGTGTGCAGTGCGTATCTGG + Intergenic
1005811595 6:29520087-29520109 TAGAGTGTAGAGTGGGAATCAGG + Intergenic
1006259736 6:32857838-32857860 CAGTTGGTGGTGTGGGACTCTGG + Intronic
1007886485 6:45236140-45236162 TAGCGTGTGGAGTGGGAAATCGG - Intronic
1007946540 6:45832219-45832241 CAGTGTGGTGAGTGGGAAACAGG + Intergenic
1008166696 6:48147811-48147833 CAATGTCTGGAGTGAGAATGTGG - Intergenic
1008553171 6:52652697-52652719 CAGTCTGGGGAGTGGAGATCAGG + Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011323431 6:86122307-86122329 CAGTGTGTTGTGTGGTAATGGGG + Intergenic
1011557848 6:88588141-88588163 CAGTGGGTGGGTTGGGAAGCGGG - Intergenic
1013402817 6:109815412-109815434 CAGTGTAGGGAGTGAGAACCTGG - Intronic
1014206892 6:118665782-118665804 CAGTGTGTGAGATGGCAATCAGG - Intronic
1014461385 6:121699837-121699859 GTGTGTGTGTGGTGGGAATCAGG + Intergenic
1017018316 6:150118953-150118975 CAGTGCGGGGAGTGGGAGGCTGG + Intergenic
1017022064 6:150148261-150148283 CATTTTGTGGAGGTGGAATCAGG + Intronic
1017350776 6:153439281-153439303 CAGTGGGTGGAGTGAAAGTCAGG + Intergenic
1018146309 6:160893015-160893037 CAGTGGGTGGAGTGAAAGTCAGG - Intergenic
1018584904 6:165346716-165346738 GAGTGTGTGGCGTGGGATTGTGG - Intronic
1021418327 7:20416285-20416307 CAGAGTGTGGAGTGGGAAATCGG + Intergenic
1021565616 7:22013880-22013902 CATTGTGTTTAGTGGGCATCTGG - Intergenic
1022298827 7:29083382-29083404 CAGGGTGTGGAGTGGGCCTCAGG + Intronic
1023664970 7:42513404-42513426 GTGTGTGTGGAGTGGGATGCAGG + Intergenic
1025728400 7:64088681-64088703 TAGTGTGTGGAGTGGGGAATCGG + Intronic
1026122799 7:67552156-67552178 CAGGGTATGGACTGGGAATCTGG + Intergenic
1028980185 7:96959224-96959246 AAGTGTGTAAAGTAGGAATCAGG + Intergenic
1031343575 7:120636229-120636251 CAGTTTGTGGGGTGGGTATCAGG + Intronic
1034354896 7:150444220-150444242 CCGTGGGGGGAGTGGGGATCTGG - Intergenic
1034489725 7:151386814-151386836 AGGTGTGTGGAGTGGAAACCAGG - Intronic
1035074451 7:156169011-156169033 CAGTGTGTGGGGTGGGATGCTGG + Intergenic
1036019816 8:4831978-4832000 CTATGTGTGCAGTGGGAATTTGG - Intronic
1036653505 8:10661061-10661083 CATGGTGTGAAGGGGGAATCAGG - Intronic
1039124337 8:34184182-34184204 CAGGGTGTAGAATGAGAATCAGG + Intergenic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040855317 8:51942962-51942984 CAGTGAGTGGAGAGGGGACCAGG - Intergenic
1040988834 8:53327099-53327121 TAGAGTGTGGAGTGGGAATCAGG - Intergenic
1042105855 8:65325756-65325778 CAGTGGGTGAAGTAGGAAACAGG + Intergenic
1043069020 8:75614945-75614967 TAGTGTGGAGAGTGAGAATCTGG + Intergenic
1043951680 8:86316428-86316450 CAGCGTGTGGAGTAGGAAATTGG + Intronic
1044157850 8:88872199-88872221 CAGTTTGAGGAGTGGGAAAGAGG - Intergenic
1048259784 8:132935965-132935987 GAGGGTGTGGAGTGGGGAGCGGG - Intronic
1049036013 8:140076622-140076644 CAGTGAGTGGCCTAGGAATCGGG - Intronic
1049152480 8:141044237-141044259 CAGAGGGTAGAGTGGGAAGCTGG - Intergenic
1049234721 8:141506908-141506930 CAGGGGTTGGAGTGGGGATCAGG - Intergenic
1050011449 9:1189306-1189328 CAGTGTTTGGAGTGTGACTTTGG - Intergenic
1050607272 9:7314835-7314857 CAGTGTGTAGAGTGGGGAAAGGG + Intergenic
1053464795 9:38297938-38297960 TAGTGTGGGGCGGGGGAATCAGG + Intergenic
1053653988 9:40197238-40197260 CAGGGTGTGGAGCGGGAGTGAGG + Intergenic
1054673734 9:67833184-67833206 CAGGGTGTGGAGCGGGAGTGAGG + Intergenic
1057706949 9:97401491-97401513 CACAGTGTGGTGTGGGACTCTGG - Intergenic
1061623725 9:131828053-131828075 CAGGGTGGTGAGTGGGGATCTGG + Intergenic
1185499359 X:585182-585204 CAGAGGGTGGAGAGGGACTCAGG + Intergenic
1185938375 X:4284830-4284852 AATTCTGTGGGGTGGGAATCTGG + Intergenic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1188038203 X:25341707-25341729 TAGCCTGTGGAGTGGGAAACAGG - Intergenic
1189294599 X:39909669-39909691 GAGTGTGTGGAGGGATAATCGGG + Intergenic
1189967262 X:46387596-46387618 CAGTGGGTGGGGTGGGAACCTGG - Intergenic
1190063946 X:47227497-47227519 CAGCGTGGGGACTGGGAAACAGG + Intronic
1190663306 X:52674794-52674816 CATCGTATGGACTGGGAATCTGG - Intronic
1190676117 X:52783688-52783710 CATCGTATGGACTGGGAATCTGG + Intronic
1192809453 X:74536302-74536324 CAGAGTGTGGAGTGGGCATGGGG - Intergenic
1193849919 X:86524262-86524284 CAGGGGGTGGAGTTGGAGTCAGG + Intronic
1193899691 X:87162002-87162024 CGGTGGGTGATGTGGGAATCTGG + Intergenic
1194162190 X:90467832-90467854 TAGAGTGTGGAGTGGGAATCAGG + Intergenic
1195522415 X:105846363-105846385 CAGTGTGTGGAGTGGAATTGAGG + Intronic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1198588119 X:138145476-138145498 CAGTGTGTGGAATTAGAATGGGG + Intergenic
1200315426 X:155127586-155127608 CATTGTGTTGAGTTGGGATCAGG - Intronic
1200508467 Y:4045569-4045591 TAGAGTGTGGAGTGGGAATCAGG + Intergenic
1201683662 Y:16677836-16677858 CAGGGTGTGGAGTGGGAAATCGG + Intergenic
1201857339 Y:18559235-18559257 GAGAGTGTGGAGTGGGAATCAGG + Intronic
1201875982 Y:18761145-18761167 GAGAGTGTGGAGTGGGAATCAGG - Intronic
1201922272 Y:19246105-19246127 CAGTGTCTGGAGTGGACCTCTGG + Intergenic