ID: 1082971782

View in Genome Browser
Species Human (GRCh38)
Location 11:59030307-59030329
Sequence ATAAGACATCAACACAACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 2, 1: 0, 2: 3, 3: 83, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082971782 Original CRISPR ATAAGACATCAACACAACCT AGG (reversed) Intronic
900033577 1:388801-388823 ATAAGACTTCAAAAGAACCTTGG + Intergenic
900054412 1:618691-618713 ATAAGACTTCAAAAGAACCTTGG + Intergenic
902091297 1:13905820-13905842 ATAACAAATTACCACAACCTCGG + Intergenic
902589587 1:17464074-17464096 ATAAGACTTCAAAAGAACTTTGG - Intergenic
903949130 1:26984358-26984380 ATAAGACATGAACAAAATGTTGG - Intergenic
904387585 1:30154212-30154234 ATGAGACTTCAAAAGAACCTTGG - Intergenic
905076938 1:35280515-35280537 ATAAGAAATTACCACAAACTTGG + Intronic
906891525 1:49721191-49721213 ATAAGACAAAAACAGAACATGGG + Intronic
907289133 1:53401742-53401764 ATAAGAAATCACCACAGACTGGG - Intergenic
908910189 1:69064106-69064128 ATAAGACTTCAAAAGAACTTTGG - Intergenic
909144144 1:71907731-71907753 AAAAGACATGAAATCAACCTAGG + Intronic
910401718 1:86843886-86843908 ATGAGACTTCAAAAAAACCTTGG - Intergenic
911047974 1:93644304-93644326 ATAAGACTTCAAAGGAACCTTGG + Intronic
911107684 1:94149308-94149330 ATAAGACTTCAAAAGAACCTTGG - Intronic
911539233 1:99138501-99138523 ATAAGACTTCAAAAGAACCCTGG + Intergenic
912155199 1:106909853-106909875 CTAAGACACAAACACAACCTAGG - Intergenic
912620510 1:111151629-111151651 ATAAGACTTCAAAAGAACTTTGG - Intronic
912643187 1:111366975-111366997 ATATAACATAAACACCACCTGGG - Intergenic
913543643 1:119845260-119845282 AAAAGAAATCAACATAACCATGG - Intergenic
914397937 1:147288767-147288789 TTAAGAGGTCAGCACAACCTTGG + Intronic
914622069 1:149419754-149419776 GTCCCACATCAACACAACCTGGG - Intergenic
916648100 1:166808676-166808698 GGAAGACAACAAGACAACCTGGG + Intergenic
917439410 1:175053865-175053887 ATAAGAAATAAACACAAACATGG + Intergenic
917469305 1:175313045-175313067 ATAAGACATCACCACAAATTAGG - Intergenic
917581189 1:176379657-176379679 ATAACAAATCATCACAAACTAGG + Intergenic
919283626 1:195523983-195524005 CAAAGACATCAAATCAACCTAGG + Intergenic
920921980 1:210305139-210305161 ATAAGAAATCAAAAAAACATTGG + Intergenic
921897919 1:220420453-220420475 ACACCACATCAACATAACCTCGG + Intergenic
921990864 1:221365141-221365163 TTAAGACTTCAAAAGAACCTTGG - Intergenic
922255936 1:223892956-223892978 ATAAGACTTCAAAAGAACCTTGG + Intergenic
922445158 1:225690832-225690854 ATAAGACACCAAGACAAACAGGG + Intergenic
923380811 1:233416051-233416073 ATAAGACTTCAAAAGAACTTTGG - Intergenic
924337133 1:242995823-242995845 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1063144016 10:3280252-3280274 ATAACACATGATCACAAACTGGG + Intergenic
1064504738 10:16016255-16016277 ATAAGAAAACAACCCAAACTTGG + Intergenic
1065156152 10:22872159-22872181 ATAAGACTTCAAAAGGACCTTGG + Intergenic
1065414244 10:25467267-25467289 ATGAGACTTCAAAAGAACCTTGG - Intronic
1066249075 10:33615547-33615569 ATAAGACTTCAAAGGAACCTTGG - Intergenic
1066558976 10:36647572-36647594 GTACCACATCACCACAACCTTGG - Intergenic
1066619470 10:37329788-37329810 ATAAGACATCATGACAACGTAGG + Intronic
1067371420 10:45686951-45686973 ATAACACAGAAACACAACTTTGG - Intergenic
1067388363 10:45839199-45839221 ATAACACAGAAACACAACTTTGG + Intronic
1067417706 10:46117759-46117781 ATAACACAGAAACACAACTTTGG - Intergenic
1067503118 10:46824646-46824668 ATAACACAGAAACACAACTTTGG - Intergenic
1067554633 10:47260029-47260051 GTAAGACAGCACCACAAACTGGG + Intergenic
1067874893 10:49996866-49996888 ATAACACAGAAACACAACTTTGG - Intronic
1068451452 10:57194784-57194806 ATAAGAAATGATCACAAACTTGG - Intergenic
1069498337 10:68927372-68927394 AAAAGACCTCAACAGAAACTGGG - Intronic
1070135195 10:73687881-73687903 ATAACACAGAAACACAACTTTGG + Intronic
1070905400 10:80067988-80068010 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1070991483 10:80736882-80736904 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1071164442 10:82788213-82788235 ATAAGGCATAAATACAACATAGG - Intronic
1071674155 10:87639051-87639073 GTAAGACTTCAAAAGAACCTTGG - Intergenic
1072972107 10:100026293-100026315 ATAAGACTTCAAAATAACTTTGG - Intergenic
1073867764 10:107824714-107824736 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1073980554 10:109148796-109148818 TTAAGACTTCAAAAGAACCTTGG - Intergenic
1073980557 10:109148832-109148854 GTAAGACTTCAAAAGAACCTTGG - Intergenic
1075635199 10:124025992-124026014 ATAATAAATCACCACAAACTTGG - Intronic
1075803800 10:125170691-125170713 ATAACAAATCACCACAAACTGGG + Intergenic
1076653593 10:132006470-132006492 ATGAGACTTCAAAAGAACCTTGG - Intergenic
1076996986 11:302437-302459 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1076999855 11:317167-317189 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1077714530 11:4568382-4568404 ATGAGACTTCAAAATAACCTTGG - Intergenic
1077928117 11:6702766-6702788 ATAACAAATTATCACAACCTTGG - Intergenic
1078512577 11:11996683-11996705 AGCAGGCATCAAGACAACCTTGG + Intronic
1079643461 11:22834567-22834589 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1079661297 11:23040030-23040052 ATAACAAATCACCACAAACTTGG - Intergenic
1080114380 11:28605861-28605883 ATAAGAAATTACCACAACCTTGG + Intergenic
1080460282 11:32448805-32448827 AAAAGACATCGAAACAACCAAGG - Intergenic
1082689555 11:56283033-56283055 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1082954724 11:58857610-58857632 ATAAGACATCAACACAACCTGGG - Intronic
1082971782 11:59030307-59030329 ATAAGACATCAACACAACCTAGG - Intronic
1084879166 11:72157963-72157985 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1085543836 11:77298605-77298627 ATAAGACTTCAAAACAAGTTTGG - Intronic
1086448579 11:86893293-86893315 ATAACACATTACCACAAACTGGG - Intronic
1086856911 11:91876531-91876553 ATGAGACTTCAAAAGAACCTTGG + Intergenic
1087185685 11:95191635-95191657 TTGAGACATAAACACACCCTTGG + Intronic
1087263824 11:96039977-96039999 AAAAAAGATCATCACAACCTGGG + Intronic
1088008888 11:104974780-104974802 ACAAGACTTCAAAAGAACCTTGG - Intergenic
1089361683 11:117892927-117892949 CAAAGACATAAACTCAACCTAGG - Intergenic
1089864151 11:121617096-121617118 AAAAGACGTCAAAAGAACCTTGG - Intronic
1090422348 11:126584204-126584226 AACAGACATCAACATAGCCTGGG + Intronic
1092613717 12:10197487-10197509 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1092629161 12:10360019-10360041 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1097005099 12:55910947-55910969 ATAAGACTTCAAAAGAACCTTGG - Intronic
1097158629 12:57030013-57030035 CCAAGACATCAGCACCACCTGGG + Intronic
1097595941 12:61630927-61630949 ATAAGACTTCATAAGAACCTTGG - Intergenic
1098059875 12:66550338-66550360 ATAAGACAACAATAATACCTTGG - Intronic
1098183456 12:67872155-67872177 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1098316195 12:69195787-69195809 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1098714328 12:73810600-73810622 GTAAAACATTAACACACCCTTGG + Intergenic
1099094473 12:78356187-78356209 ATAAGACTTCAAAAGGACCTTGG - Intergenic
1100090086 12:90957870-90957892 ATAACAAATGATCACAACCTTGG + Intergenic
1100264710 12:92964525-92964547 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1100755635 12:97748355-97748377 GTAAGCCATGAACACAACTTTGG + Intergenic
1100990960 12:100250816-100250838 ATAAAACATTTACATAACCTGGG + Intronic
1101589214 12:106111364-106111386 ATAAGACACCAGGACACCCTGGG - Intronic
1102889495 12:116547437-116547459 ATAAGAAATCATCACAAACTTGG + Intergenic
1103126634 12:118428670-118428692 ATAAAAAATCAAGACAACCAGGG - Intergenic
1103143499 12:118573238-118573260 ATAACAAAACAACACAAACTGGG + Intergenic
1105684840 13:22770710-22770732 ATGAGACATCACCAAAACCATGG + Intergenic
1106380046 13:29227870-29227892 ATAAGACTTTAACAAAACATGGG - Intronic
1106574696 13:30963740-30963762 ATAAGACATCAGAATCACCTGGG - Intronic
1107866129 13:44704935-44704957 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1108046975 13:46392431-46392453 ATAAGACTTCAAAACAACTTTGG + Intronic
1110815983 13:79860386-79860408 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1110939895 13:81336692-81336714 ATAAGATATTACCACAAACTTGG - Intergenic
1111731001 13:92076944-92076966 ATAAGACTTCAGAAGAACCTTGG + Intronic
1112280782 13:98061201-98061223 ATAAAACTTCAAAAGAACCTTGG + Intergenic
1112605900 13:100905465-100905487 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1112672483 13:101656182-101656204 ATAAAACTTCAAAAGAACCTTGG - Intronic
1113066441 13:106377644-106377666 CTAAGACATCTACTTAACCTTGG + Intergenic
1113215343 13:108033883-108033905 ATAACACATGAACACAAACTTGG - Intergenic
1113218261 13:108068821-108068843 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1116131842 14:40864734-40864756 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1116471877 14:45295075-45295097 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1117209664 14:53482353-53482375 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1117483752 14:56173526-56173548 ATAACACATTACCACAAACTTGG + Intronic
1118505910 14:66411626-66411648 ATAACAAATTACCACAACCTAGG + Intergenic
1120072633 14:80121043-80121065 ATAACAAATCACCACAAACTTGG + Intergenic
1120107526 14:80514017-80514039 ATAAGACTTCAAAAAGACCTTGG + Intronic
1120425079 14:84337313-84337335 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1120466283 14:84861795-84861817 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1120689993 14:87581761-87581783 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1121268515 14:92621668-92621690 ATGAGACTTCAAAAGAACCTTGG - Intronic
1121731689 14:96192006-96192028 ATAAGACTTCAAAAGAACCCTGG + Intergenic
1123128035 14:105963659-105963681 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1202928495 14_KI270725v1_random:16443-16465 CAAAGACATGAACTCAACCTAGG - Intergenic
1123408558 15:20039825-20039847 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1123517889 15:21046535-21046557 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1123669707 15:22643555-22643577 ATAAGACTTCAGAAGAACCTTGG + Intergenic
1123876509 15:24629057-24629079 ATGAGACTTCAAAAGAACCTTGG + Intergenic
1124033217 15:26030212-26030234 ATAAGACTTCAAAAGAATCTTGG - Intergenic
1124525680 15:30449997-30450019 ATAAGACTTCAGAAGAACCTTGG + Intergenic
1124772975 15:32557688-32557710 ATAAGACTTCAGAAGAACCTTGG - Intergenic
1125248356 15:37670028-37670050 ATAAGAAATAAATACAATCTGGG + Intergenic
1125686535 15:41566773-41566795 ATAAACCTTCAAAACAACCTGGG - Intronic
1125978003 15:43972855-43972877 ATAAGAGATCAACTCCACCCAGG + Intronic
1127032960 15:54884204-54884226 ATAAGACATCAAAACTACTGAGG + Intergenic
1127414302 15:58742847-58742869 AGAAAACAACAACACAGCCTGGG + Intronic
1127507247 15:59609370-59609392 ATAAGATTTCAAAAGAACCTTGG + Intronic
1127797316 15:62449776-62449798 AGAAAACAACAACAAAACCTTGG + Intronic
1127924939 15:63530140-63530162 ACAAAACAAAAACACAACCTTGG + Intronic
1128630107 15:69256315-69256337 AAAAGACATAAACACACCATCGG - Exonic
1128858365 15:71041056-71041078 TTCAGAAATAAACACAACCTAGG + Intronic
1129396735 15:75253869-75253891 ATGACACAGCAACCCAACCTTGG + Intergenic
1129473963 15:75770852-75770874 ATGACACAGCAACCCAACCTCGG + Intergenic
1131112733 15:89775880-89775902 ATAAGGCATCAAGACAAGCCCGG - Intronic
1131894931 15:97016908-97016930 CCAAGACATCAAATCAACCTAGG - Intergenic
1133545359 16:6801139-6801161 CCAAGACATCAACATCACCTAGG - Intronic
1133809918 16:9154059-9154081 ATAAGAAATGACCACAGCCTGGG + Intergenic
1133949673 16:10380429-10380451 ATAAGACTTCAAAAGAACCTTGG - Intronic
1134001985 16:10790039-10790061 ATAAGACTTCAAAAGAACCTTGG - Intronic
1134179993 16:12039884-12039906 ATCTGACATCATCACAACCAAGG - Intronic
1134328962 16:13232820-13232842 ATAAGACTTCAAAAGAACCTTGG - Intronic
1135306740 16:21373651-21373673 ATCTGACATCATCACAACCAAGG - Intergenic
1135866721 16:26109597-26109619 CTATGAGATCAACACAGCCTTGG + Intronic
1135966881 16:27042947-27042969 ATATGACATAAACACATCATGGG + Intergenic
1136303481 16:29352793-29352815 ATCTGACATCATCACAACCAAGG - Intergenic
1138107294 16:54295008-54295030 ATAAGAAATTACCACAAACTAGG - Intergenic
1140054328 16:71512294-71512316 ATAAGACTTCAAAAGAACCTTGG - Intronic
1140747317 16:77992488-77992510 ATGAGACTTCAAAAGAACCTTGG - Intergenic
1140797595 16:78454469-78454491 AAAACACAAAAACACAACCTAGG - Intronic
1144187517 17:12810206-12810228 ATAACAAATCACCACAAACTGGG + Intronic
1145024699 17:19459299-19459321 ATGAGACATCAAAAGAACCTTGG + Intergenic
1145223586 17:21108926-21108948 ATAAGACTTTAAAAGAACCTTGG + Intergenic
1146811233 17:35905364-35905386 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1149378507 17:56069600-56069622 ATAAGAAATTACCACAAACTAGG + Intergenic
1151132875 17:71916341-71916363 ATAAGACTTCAAAAGGACCTTGG + Intergenic
1155133337 18:22961505-22961527 ATAAGACATGAAAAGAACATAGG + Intronic
1155955333 18:31952053-31952075 ATAAGACTTCAAAAGAACTTTGG + Intronic
1156585687 18:38428489-38428511 ATAAGATTTCAAAAGAACCTGGG - Intergenic
1156710378 18:39936998-39937020 ACAAGAAATCAGAACAACCTTGG - Intergenic
1157059446 18:44270704-44270726 ATAAGGAAGTAACACAACCTAGG - Intergenic
1157430533 18:47620721-47620743 CTAAGACTTCAACATATCCTTGG + Intergenic
1157909769 18:51604769-51604791 ATAAGACATCAAAATAACCTTGG - Intergenic
1158368019 18:56762172-56762194 ATAATACATCAAAACAAAATTGG - Intronic
1159444446 18:68523866-68523888 GTAACAAATTAACACAACCTTGG - Intergenic
1159653515 18:71004832-71004854 CTAAGACTTCAAAAGAACCTTGG - Intergenic
1159740793 18:72167598-72167620 CAAAGACATGAACTCAACCTAGG + Intergenic
1159937980 18:74383684-74383706 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1160037393 18:75314522-75314544 ATAAGACATCTACACAATTCAGG + Intergenic
1164175261 19:22768049-22768071 ATATGCCATGAACACAACTTTGG + Intronic
1164396668 19:27870715-27870737 AAAAGAGATCTACACTACCTTGG + Intergenic
1165368926 19:35390120-35390142 GTAAGACTTCAAAAGAACCTTGG - Intergenic
1165379833 19:35471199-35471221 GTAAGACTTCAAAAGAACCTTGG + Intergenic
1166418287 19:42612146-42612168 ATAAGACTTCAAAAGAACCTTGG + Intronic
1166577951 19:43862034-43862056 CTAAGACATGAAATCAACCTGGG + Intergenic
1168084478 19:54035281-54035303 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1168498153 19:56871481-56871503 ATAAGACTTCAAAAGAACCCTGG + Intergenic
925601043 2:5609001-5609023 ATAAGCCATCAACAAAAACTAGG + Intergenic
926502091 2:13668286-13668308 GTAACAAATCAACACAAACTAGG - Intergenic
927125526 2:20009715-20009737 ATAAGACTTCAAAAGAACATTGG + Intronic
927433267 2:23044893-23044915 ATAACACATTACCACAAACTTGG - Intergenic
927662572 2:25005314-25005336 AAAAGGCACCAACTCAACCTTGG + Intergenic
929428019 2:41863726-41863748 TTAAAACAACAACACAACATTGG - Intergenic
930539237 2:52683581-52683603 ATAACACATCAACAGAACGAAGG + Intergenic
931416780 2:62089067-62089089 ATAAGACTTCAAAGGAACCTTGG - Intronic
931418151 2:62100698-62100720 ATAAGACTTCAAAAGAACCTTGG - Intronic
932943328 2:76195798-76195820 ATAAGACAGCAAGACAACCTGGG - Intergenic
933417335 2:82002887-82002909 AGAAGACATCAGCACAACTGAGG - Intergenic
934155698 2:89198078-89198100 ATATGACTTCAAAAGAACCTTGG + Intergenic
935889627 2:107662250-107662272 GTAAGACTTCAAAAGAACCTTGG - Intergenic
937821890 2:126319462-126319484 ATATTACATCAAAACTACCTTGG - Intergenic
938668192 2:133560995-133561017 ATAAGCCATCAACCAAACCAGGG - Intronic
940473749 2:154133204-154133226 ACAATACCTCAACACAAACTGGG - Intronic
942097827 2:172549987-172550009 ATAAAACTTCAAAAGAACCTTGG - Intergenic
942481211 2:176390406-176390428 AAAAAAAATCAACTCAACCTTGG - Intergenic
945405900 2:209448482-209448504 ATAAGAAATTATCACAAACTTGG + Intronic
945710358 2:213287292-213287314 ATTAGAAATCAACACAACTTGGG + Intronic
945899562 2:215522846-215522868 ATAAGACATGAATACAGGCTGGG + Intergenic
946654791 2:221935107-221935129 ATAAGATAACAACACAACACAGG + Intergenic
947020258 2:225666666-225666688 TTAAGACTTCAAAAGAACCTTGG - Intergenic
947172303 2:227324109-227324131 ATAAGACTTCAAAAGAACCTTGG + Intergenic
947896411 2:233677900-233677922 AAAAGACATGAAATCAACCTAGG + Intronic
948016357 2:234693946-234693968 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1168823119 20:790281-790303 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1168823231 20:791404-791426 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1168824957 20:804012-804034 ATAAGACCTCAAAAGAACCTTGG - Intergenic
1168843778 20:927856-927878 ATGAGACTTCAAAAGAACCTTGG - Intergenic
1169324210 20:4662031-4662053 ATAAGACTTCAAAAGAAACTTGG - Intergenic
1173399028 20:42707961-42707983 ATAAGAAATTACCACAAACTTGG - Intronic
1173533714 20:43791863-43791885 ATAAAACATCAAAATAACCAGGG - Intergenic
1174068758 20:47885351-47885373 CAAAGCCACCAACACAACCTGGG - Intergenic
1174665950 20:52258019-52258041 ATATGACATGAATAAAACCTGGG + Intergenic
1174956240 20:55101942-55101964 ATAACACCTCAAAAGAACCTTGG - Intergenic
1176590520 21:8645086-8645108 CAAAGACATGAACTCAACCTAGG - Intergenic
1177156582 21:17506980-17507002 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1177175981 21:17701206-17701228 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1177271302 21:18851992-18852014 ATAAGACTTCAAAAAAACCTTGG - Intergenic
1177957264 21:27614200-27614222 AAAAGACATGAAATCAACCTAGG - Intergenic
1178175728 21:30096173-30096195 AAAAGACATGAAACCAACCTAGG + Intergenic
1179678963 21:43004343-43004365 ATAAGACATCAAATCATCTTGGG - Exonic
1180273348 22:10622119-10622141 CAAAGACATGAACTCAACCTAGG - Intergenic
1180578475 22:16804612-16804634 ATAAGACTTCAAAAGAACCTTGG + Intronic
1182521376 22:30886386-30886408 ATAAGACTTAAAAAGAACCTTGG - Intronic
1182720589 22:32395596-32395618 TTAAGACAACACCAAAACCTTGG + Intronic
1182878040 22:33709113-33709135 TTAAGGCTTCAACACAACTTCGG + Intronic
1183515270 22:38261922-38261944 GTAAGCCATCAACCCACCCTGGG + Intronic
1183637597 22:39074040-39074062 ATGAGACTTCAAAATAACCTTGG - Intronic
1183644025 22:39112104-39112126 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1184333218 22:43838949-43838971 ATAAGACACCACCAGATCCTTGG + Exonic
1184848641 22:47104760-47104782 ATAAGACTTCAAAAGAACCTTGG + Intronic
949136758 3:576589-576611 CAAAGACATGAACTCAACCTAGG + Intergenic
949235997 3:1808683-1808705 ATAAAACATCAGCAAAAACTAGG + Intergenic
951574958 3:24103974-24103996 ATAACAAATCACCACAAACTTGG - Intergenic
951667931 3:25147493-25147515 ATAACACTTCAACACAACCCAGG - Intergenic
953427393 3:42806041-42806063 ACAAGACTTCAAAAGAACCTTGG - Intronic
953725308 3:45392712-45392734 ATAAGACAGCAACATAATGTGGG - Intronic
953829636 3:46284750-46284772 GAAAGACATAAACACAAACTTGG + Intergenic
954798472 3:53173460-53173482 ATAAAACAAAAACAAAACCTAGG - Intronic
956210960 3:66800858-66800880 CTAAGACACAAACACACCCTAGG - Intergenic
956818069 3:72926881-72926903 ATCAGACATTATCATAACCTTGG - Intronic
957297643 3:78353445-78353467 ATAAGACTTCAAAAGAATCTTGG + Intergenic
957313808 3:78551877-78551899 ATAACAAAACACCACAACCTGGG - Intergenic
957600193 3:82324078-82324100 ATAAGACTTAAAAAGAACCTTGG + Intergenic
958566423 3:95817040-95817062 ATAAGACTTCAAAAGAACGTTGG + Intergenic
958600863 3:96294985-96295007 AGAAGATATCAACACAATTTTGG - Intergenic
959062693 3:101630413-101630435 ATAAGACTTCAAAATAACTTTGG + Intergenic
959559737 3:107765857-107765879 ATAAGATACAAACAAAACCTGGG - Intronic
961839385 3:129696199-129696221 ATGAGACTTCAAAAGAACCTTGG + Intronic
962094732 3:132281565-132281587 ATAAGACTTCAAAGGAACCTTGG + Intronic
963412771 3:144952969-144952991 ATAAGACTTCAAAAGAACCTTGG - Intergenic
963433195 3:145235646-145235668 GTAAGACTTCAAAAGAACCTTGG + Intergenic
963669338 3:148231997-148232019 ATAAGACTTCAAAAGAACTTTGG - Intergenic
964364429 3:155934246-155934268 ATAACAAATCACCACAAACTAGG + Intronic
964612745 3:158631372-158631394 ATAAGACTTCAAAAGAACTTTGG - Intergenic
964919552 3:161879936-161879958 AAAAGACATGAAATCAACCTAGG + Intergenic
965180415 3:165395480-165395502 ATAAGACTTCAAAGGAACCTTGG + Intergenic
965350876 3:167609919-167609941 ATGACACTTCTACACAACCTGGG + Intronic
967467006 3:189819242-189819264 ATATAACTTCAACACAGCCTGGG - Intronic
970527958 4:16951455-16951477 GTAACACATTAACACAAACTTGG - Intergenic
970878764 4:20903455-20903477 ATAAGACTTCAAAAGAACCTTGG + Intronic
970950320 4:21748114-21748136 ATAACAAATCATCACAAACTAGG - Intronic
971713566 4:30148158-30148180 ATAAGACTTCAAAAGAAACTTGG + Intergenic
971751976 4:30662124-30662146 ATAAGACTTGAAAAGAACCTTGG + Intergenic
972023290 4:34342341-34342363 ACAAAACATGAAAACAACCTTGG + Intergenic
972034538 4:34504807-34504829 ATAAGATTTCAAAAGAACCTTGG - Intergenic
973532814 4:51850385-51850407 AAAAGACATCATCACATCCAGGG - Intronic
974293292 4:59962276-59962298 AAAAGAAATCAAGTCAACCTGGG + Intergenic
974369915 4:61002474-61002496 AATAGACAGCAACACAACATAGG + Intergenic
976011236 4:80491985-80492007 ATAAGACTTCAAAAGAACTTTGG + Intronic
976970789 4:91099797-91099819 ATAAGACCTCAAAAGAACCTTGG - Intronic
978493722 4:109336023-109336045 AAAAGACATCTTCATAACCTTGG - Intergenic
979239989 4:118439482-118439504 ATAAGACTTCAAAAGAACCTTGG - Intergenic
980738059 4:136916978-136917000 ATAACACATTATCACAAACTAGG + Intergenic
980974652 4:139599011-139599033 GTAACACATCACCACAAACTTGG - Intronic
982650561 4:158083146-158083168 ATAACAAATCACCACAAACTGGG + Intergenic
983273807 4:165593345-165593367 ATAAGACTTCAAAAGAATCTTGG - Intergenic
983280692 4:165677374-165677396 ATAACAAATCACCACAAACTGGG - Intergenic
983638195 4:169919417-169919439 ATGAGACTTCAAAAGAACCTTGG + Intergenic
983822785 4:172217059-172217081 ATAAGATTTCAAAAGAACCTTGG - Intronic
984438033 4:179728458-179728480 ATGAGACTTCAAAAGAACCTCGG - Intergenic
984794974 4:183651641-183651663 ATAAGACATCAACTTATCCGTGG + Intronic
984897658 4:184556244-184556266 ATAAGAATTCAAGAAAACCTAGG + Intergenic
985171337 4:187153445-187153467 ATAACACACCACCACAAACTGGG + Intergenic
986114230 5:4753748-4753770 ATAAGAAATCAACACAAATGTGG - Intergenic
986781024 5:11066003-11066025 ATAAGACTTCAAAAGAACCTTGG + Intronic
986893073 5:12332574-12332596 ATGAGACTTCAAAAGAACCTTGG - Intergenic
987199768 5:15564579-15564601 AAAAGAAACCAACAAAACCTTGG + Intronic
987462915 5:18235277-18235299 ATAAGACTTCAAAAGAACCTTGG - Intergenic
987786615 5:22508607-22508629 ATAAGACCTCAAAAGAACCTTGG + Intronic
988075990 5:26355417-26355439 ATACCACATCAACAAAACCAAGG - Intergenic
988101197 5:26681168-26681190 CCAAGATATGAACACAACCTAGG - Intergenic
988568060 5:32336354-32336376 ATAAGACTTCAAAAGAACCTTGG - Intergenic
988879313 5:35483426-35483448 AAAAGACATAAACATAACCATGG + Intergenic
989209228 5:38843682-38843704 ATAACACATTACCACAAACTTGG + Intergenic
989673574 5:43947616-43947638 ATAACACACCAAAACAACCAAGG + Intergenic
989806095 5:45607430-45607452 ATAAGACATCAAGACCAAGTTGG + Intronic
990431836 5:55743074-55743096 ATAACAAATTAACACAAACTGGG + Intronic
990623650 5:57587735-57587757 AAAAGACATCAAGAAAACCTAGG + Intergenic
991119937 5:63000977-63000999 ATAACAAATCACCACAAACTTGG + Intergenic
991463719 5:66887338-66887360 ACCAGACATCAACACAACTCTGG - Intronic
993965463 5:94355154-94355176 ATGAGACATCAAAAGAACCTTGG - Intronic
994423332 5:99550700-99550722 TTAAGATATTAACACAACTTGGG - Intergenic
994641226 5:102411993-102412015 ATGAGACTTCAAAAGAACCTTGG + Intronic
995128880 5:108609030-108609052 GTAAGACTTCAAAAGAACCTTGG + Intergenic
995587159 5:113659986-113660008 ATAAGAAATCACCACAAACTAGG - Intergenic
995741278 5:115358465-115358487 ATAAGACTTCAAAAGAACTTTGG + Intergenic
996116723 5:119628421-119628443 AGAGGACATCAACAGAACCAAGG - Intronic
996207199 5:120755642-120755664 AAAAGACATAAAATCAACCTAGG - Intergenic
996478319 5:123946331-123946353 ATAAGACTTCAGAAGAACCTTGG + Intergenic
997048344 5:130347740-130347762 ACAAGACATGAAATCAACCTAGG - Intergenic
997844783 5:137276578-137276600 ATAAGATAACAATCCAACCTCGG + Intronic
998727248 5:145031656-145031678 ACAAGACTTCAAAAGAACCTTGG + Intergenic
999222608 5:149993555-149993577 ATAAGACATGGATACAACCAGGG - Exonic
999969110 5:156841225-156841247 ATAAAAAATCAAAAAAACCTTGG - Intergenic
1000627586 5:163556916-163556938 ATAACAAACCAACACAAACTGGG - Intergenic
1001096217 5:168777572-168777594 GTAAGGCATCAAAACAACCCAGG + Intronic
1001906348 5:175476745-175476767 ATAAGACAACTGCAAAACCTTGG - Intergenic
1002740243 5:181430067-181430089 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1006938601 6:37736295-37736317 ATAAGACATAAACACAGAATAGG + Intergenic
1007311426 6:40949285-40949307 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1008218747 6:48828001-48828023 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1008776235 6:55041378-55041400 ATAATAAAGCAACACAATCTGGG - Intergenic
1011121321 6:83956509-83956531 GTAAGACTTCAAAAGAACCTTGG - Intronic
1011152888 6:84294043-84294065 CCAAGACATGAAAACAACCTAGG - Intergenic
1013835378 6:114328889-114328911 ATAAGACATCATCACAATAAAGG - Intronic
1014442923 6:121494053-121494075 ATAAAACTTCAAAAGAACCTCGG + Intergenic
1016557898 6:145360223-145360245 ATAAGAATTCAAAAGAACCTTGG - Intergenic
1016593597 6:145773656-145773678 ATAACAAATGACCACAACCTTGG + Intergenic
1017247452 6:152241724-152241746 AAAAGACACCAACCCAACCCTGG + Intronic
1018154835 6:160976182-160976204 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1018189954 6:161301967-161301989 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1018260496 6:161965855-161965877 ATAAGACCTCAGAAGAACCTTGG - Intronic
1018835815 6:167482953-167482975 ATAAGACGTCAAAAGAACTTTGG - Intergenic
1019245355 6:170705667-170705689 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1021118203 7:16767608-16767630 ATAACAAATTAACACCACCTAGG - Intronic
1022219423 7:28297806-28297828 AAATGACATGAACACAACATTGG - Intergenic
1022842256 7:34175904-34175926 ATAACAAAACAACACAACCTGGG + Intergenic
1024432798 7:49309677-49309699 ATAAGAGAACAACACACACTGGG - Intergenic
1026209333 7:68289527-68289549 ATAACACTTCAAAAGAACCTTGG + Intergenic
1026496658 7:70909391-70909413 ATAAGACTTCAGAAGAACCTTGG - Intergenic
1026562230 7:71459848-71459870 ATGAGACTTCAAAAGAACCTTGG + Intronic
1027517150 7:79156465-79156487 AGAAGACTTCAATAGAACCTTGG + Intronic
1027517835 7:79164564-79164586 AGAAGACTTCAATAGAACCTTGG + Intronic
1027979323 7:85197319-85197341 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1028004901 7:85552818-85552840 AGAAGAGAACAACACACCCTGGG + Intergenic
1028281753 7:88938245-88938267 ATAAGACTTCAAAAGAACTTTGG - Intronic
1030186596 7:106768558-106768580 ATAACAAATCACCACAAACTAGG + Intergenic
1030585163 7:111409570-111409592 TTAAGACATCAGTATAACCTTGG + Intronic
1031437017 7:121744927-121744949 ATAGGTTTTCAACACAACCTTGG + Intergenic
1031832581 7:126645764-126645786 AAAAGACTTCAACACTGCCTGGG + Intronic
1031904975 7:127450910-127450932 AAAAGACATGAAATCAACCTAGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032880388 7:136083854-136083876 ACAAGACATCACTACAACATAGG - Intergenic
1033249746 7:139748362-139748384 ATAACACAGCACCACAAGCTGGG + Intronic
1033610368 7:142958820-142958842 ATAAGACTTCAAAAGAACTTCGG + Intronic
1034051421 7:147988222-147988244 ATAAGACTTCAAAAGAACTTTGG - Intronic
1035209243 7:157315614-157315636 ATAAGACTTCAAAATAACCTTGG + Intergenic
1035502772 8:102535-102557 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1036052278 8:5212972-5212994 ATAAGACTTCAGAAGAACCTTGG - Intergenic
1036100550 8:5778555-5778577 AAAAGACCTCTACACAACTTTGG + Intergenic
1037511095 8:19583989-19584011 ATAACACATAAGCACAAACTGGG + Intronic
1038808794 8:30818982-30819004 TTAAGACATGAAATCAACCTAGG - Intergenic
1039006448 8:33043306-33043328 ATAAGAAATCAAAACAGGCTGGG + Intergenic
1039354317 8:36798593-36798615 ATAAGACTTCAGAAGAACCTTGG + Intronic
1039813697 8:41073122-41073144 ATAAGACTTCAAAGGAACCTTGG - Intergenic
1039961695 8:42253137-42253159 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1041136501 8:54764602-54764624 ATAAGACATCAGCCCAACCTTGG - Intergenic
1041317667 8:56581381-56581403 ATAAGACTTCAAAAGAACTTTGG + Intergenic
1041359788 8:57040921-57040943 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1041746668 8:61214664-61214686 ATAACAAATCACCACAAACTGGG - Intronic
1042469974 8:69175839-69175861 ATGAGACATCAAAACACACTTGG + Intergenic
1043559313 8:81471742-81471764 ATAATAAATCAATACAAACTAGG - Intergenic
1044019164 8:87083398-87083420 ATAAGACTTCAAAAGAACCTTGG + Intronic
1045496526 8:102714154-102714176 GTAACAAATCAACACAAACTTGG + Intergenic
1045792053 8:105995374-105995396 GTAAGACTTCAAAAGAACCTTGG - Intergenic
1047114285 8:121823368-121823390 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1047905175 8:129465538-129465560 ATTAGACATCAAAAAACCCTGGG + Intergenic
1049964356 9:765075-765097 ATGAGACTTCAAAACAACTTAGG + Intergenic
1051085777 9:13347361-13347383 AGAGGACATCAAAACAAACTTGG + Intergenic
1051271026 9:15354944-15354966 ATGAGACTTCAAAAGAACCTTGG - Intergenic
1052176947 9:25473690-25473712 ATGAGACTTCAAAAGAACCTTGG + Intergenic
1052524340 9:29594659-29594681 ATAAGACATGAAGAAAACCTTGG + Intergenic
1053078802 9:35157079-35157101 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1053573769 9:39336819-39336841 ATAAGACAGAAACGCAACATGGG - Intergenic
1053641052 9:40080414-40080436 GTAAGACTTCAAAAGAACCTTGG - Intergenic
1053765085 9:41385054-41385076 GTAAGACTTCAAAAGAACCTTGG + Intergenic
1054095335 9:60895503-60895525 ATAAGACAGAAACGCAACATGGG - Intergenic
1054116797 9:61171427-61171449 ATAAGACAGAAACGCAACATGGG - Intergenic
1054123375 9:61282190-61282212 ATAAGACAGAAACACAACATGGG + Intergenic
1054321794 9:63676710-63676732 GTAAGACTTCAAAAGAACCTTGG - Intergenic
1054543700 9:66296216-66296238 GTAAGACTTCAAAAGAACCTTGG + Intergenic
1054590956 9:67011134-67011156 ATAAGACAGAAACGCAACATGGG + Intergenic
1054992073 9:71340050-71340072 AAAAGAAATCTACACAACATTGG + Intronic
1055820440 9:80255136-80255158 ATAACAAATTAACACAAACTCGG - Intergenic
1055879872 9:80987929-80987951 AGAAGTCATCAACACAATGTGGG - Intergenic
1057862948 9:98656405-98656427 ATAAGACAGCAACACAAGGCTGG - Intronic
1058575118 9:106392798-106392820 ACATCACACCAACACAACCTGGG - Intergenic
1059523647 9:114968228-114968250 ATATGACTTCAAAAGAACCTTGG + Intergenic
1060001309 9:119961504-119961526 TTTAGACATCAACTCTACCTGGG - Intergenic
1060923258 9:127437538-127437560 ATAAGAAATAACCACAAACTGGG + Intronic
1062258814 9:135646989-135647011 ATAAGACTCTAAAACAACCTTGG + Intergenic
1203605551 Un_KI270748v1:54875-54897 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1203620528 Un_KI270749v1:123751-123773 CAAAGACATGAACTCAACCTAGG - Intergenic
1185575301 X:1167681-1167703 ATGAGACCTCAAAAGAACCTTGG + Intergenic
1185795592 X:2961783-2961805 ACAAGACTTCAAAATAACCTTGG + Intronic
1185908929 X:3964751-3964773 ATGAGACTTCAAAAGAACCTTGG + Intergenic
1186255542 X:7714606-7714628 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1187806753 X:23129085-23129107 GTAAGACTTCAAAAGAACCTTGG + Intergenic
1188286029 X:28326403-28326425 ATAAGACTTCCAAAGAACCTTGG - Intergenic
1188876094 X:35431855-35431877 ATAAGACTTCAAAAGAACCTCGG - Intergenic
1188884865 X:35537211-35537233 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1188898112 X:35695020-35695042 ATAAGATTTCAAAAGAACCTTGG + Intergenic
1189319980 X:40082122-40082144 ATAAGCCATCACTCCAACCTTGG + Intronic
1189739873 X:44106637-44106659 ATAACAAATCACCACAAGCTTGG - Intergenic
1189784552 X:44547710-44547732 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1190140404 X:47838035-47838057 ATAAGACATGTACAGAACTTGGG - Intronic
1190586523 X:51949462-51949484 ATAAGCCATCATCACAATCAAGG + Intergenic
1191624691 X:63257870-63257892 ATAAGACTTCAAAAGAACTTTGG - Intergenic
1192132424 X:68565085-68565107 ATAAGACTACAAAAGAACCTTGG + Intergenic
1192728963 X:73783065-73783087 ATTAGACTTCAAAAGAACCTTGG - Intergenic
1193794743 X:85859786-85859808 ATGTGATTTCAACACAACCTTGG + Intergenic
1194089352 X:89565911-89565933 ATAAGGCTTCAAAATAACCTTGG - Intergenic
1194385556 X:93249265-93249287 ATAAAATATGAACAGAACCTAGG + Intergenic
1194724677 X:97381357-97381379 ATAAAAAATCAACACAGTCTTGG + Intronic
1194816757 X:98451088-98451110 ATAACACAGCACCACAAACTGGG - Intergenic
1195267103 X:103192905-103192927 CTAAGATATGAACGCAACCTAGG - Intergenic
1196604967 X:117646542-117646564 ATGAGAAATGAACACAACCTTGG - Intergenic
1197034873 X:121861162-121861184 ATAAGATAATAACACAAACTGGG + Intergenic
1197352554 X:125395759-125395781 ATAAGACTTAAAAAGAACCTTGG - Intergenic
1197473188 X:126888570-126888592 CAAAGACATGAACTCAACCTCGG + Intergenic
1197528726 X:127595568-127595590 ACAAAACATCAAAACAACCTTGG + Intergenic
1199081910 X:143586616-143586638 ATGAGACTTCAAAAGAACCTTGG - Intergenic
1199203614 X:145122586-145122608 ATAAAATATCACCACAAACTTGG + Intergenic
1199867495 X:151865922-151865944 ATAACAAATTAACACAAACTTGG + Intergenic
1200293471 X:154893962-154893984 ATAAGACTTCAAAAGAACTTTGG + Intronic
1200442013 Y:3221958-3221980 ATAAGGCTTCAAAATAACCTTGG - Intergenic
1200801488 Y:7391227-7391249 ATAAGACTTCAAAAGAACCTTGG + Intergenic
1201329042 Y:12798618-12798640 ATAAGACATGGACACACCCAAGG + Intronic
1201472222 Y:14346179-14346201 ATAAGATTTCAAGAGAACCTTGG + Intergenic
1201601034 Y:15728654-15728676 ATAAGACTTCAAAAAAATCTTGG + Intergenic
1202060078 Y:20877578-20877600 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1202068041 Y:20960929-20960951 ATAAGACTTCAAAAGAACCTTGG - Intergenic
1202387734 Y:24341316-24341338 ATAAGATTTCAAAAGAACCTTGG - Intergenic
1202483052 Y:25328812-25328834 ATAAGATTTCAAAAGAACCTTGG + Intergenic