ID: 1082979624

View in Genome Browser
Species Human (GRCh38)
Location 11:59107500-59107522
Sequence GGTGTTCCTGAATCTCGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082979619_1082979624 18 Left 1082979619 11:59107459-59107481 CCAAGAGTTGTACTCCTGAAGAG 0: 1
1: 1
2: 0
3: 7
4: 92
Right 1082979624 11:59107500-59107522 GGTGTTCCTGAATCTCGAGAGGG 0: 1
1: 1
2: 0
3: 6
4: 67
1082979620_1082979624 4 Left 1082979620 11:59107473-59107495 CCTGAAGAGATACTTAGAGATCA 0: 1
1: 0
2: 1
3: 6
4: 150
Right 1082979624 11:59107500-59107522 GGTGTTCCTGAATCTCGAGAGGG 0: 1
1: 1
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082979624 Original CRISPR GGTGTTCCTGAATCTCGAGA GGG Intronic
900576577 1:3385524-3385546 GCAGTTCCTGAACCCCGAGATGG + Intronic
904590372 1:31611503-31611525 GATTTTCCTGAGTCTCCAGAAGG - Intergenic
906456771 1:46003940-46003962 TTTATTCCTGAATCTCGAGCAGG + Intronic
917264228 1:173202924-173202946 GGTTTTCCTGACTCCCCAGAAGG + Intronic
921339403 1:214119640-214119662 GGTGTTCTTGGATCTGGAGTTGG - Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1063750483 10:8939927-8939949 GGTGTTCATGAATATAAAGATGG - Intergenic
1064347726 10:14548185-14548207 GGTGGGCCTGAAGATCGAGAGGG + Intronic
1065239182 10:23687853-23687875 GGTGCTCCTGGACCTCCAGAAGG - Intergenic
1070826053 10:79391237-79391259 GCTGATCCTGAATGTGGAGATGG + Intronic
1072439421 10:95440470-95440492 GGTGGGGCTGAATCTCCAGATGG + Intronic
1078665878 11:13324745-13324767 GGTGATCCTGAAACACGAGGTGG + Intronic
1080509613 11:32955362-32955384 TTTGTTCCTGAAATTCGAGATGG + Exonic
1080891277 11:36410922-36410944 GCTGTTCCTGGATCTTGAGGCGG + Intronic
1082975190 11:59063760-59063782 GGTGTTCCTGAATCTCAAGAGGG + Intergenic
1082979624 11:59107500-59107522 GGTGTTCCTGAATCTCGAGAGGG + Intronic
1084600681 11:70143625-70143647 GGTGTTTCTGAATCTCCCCAGGG - Intronic
1086751623 11:90502100-90502122 AGTGTTCATGAAACTCTAGAAGG - Intergenic
1090362932 11:126185988-126186010 GGTGTTCCTGAACCCACAGAGGG + Intergenic
1090826800 11:130393122-130393144 GATTTTCCTGAATCTGGAGGCGG - Intergenic
1102416029 12:112763713-112763735 GCTGTGCCTGAATTTCAAGAGGG + Intronic
1112464345 13:99630361-99630383 GGTGTTCCTGGAGTTGGAGAAGG + Intronic
1113734209 13:112665581-112665603 AGTTTTTCTGAATCTGGAGAAGG - Intronic
1115237181 14:31218859-31218881 GATGTAACTGAATTTCGAGACGG - Intergenic
1116971059 14:51066429-51066451 GGTGTTCCAGAACCTAGTGAAGG - Intronic
1121590020 14:95097863-95097885 GGTGTTCCTTATTCTTGAAAAGG - Intronic
1122203227 14:100135202-100135224 GGCGTTCCTGATTCTCGTGTGGG + Intronic
1125908025 15:43411568-43411590 GGGGTTTCTCAATCTCAAGAAGG - Intronic
1128979841 15:72178200-72178222 GAAGTTCCTGAAACTCAAGAGGG - Intronic
1129532893 15:76283145-76283167 GGTATTCCTGAATCTGAAGTAGG + Intronic
1146304685 17:31721953-31721975 GCTGTTCCTGAACCAGGAGAGGG + Intergenic
1149459379 17:56814609-56814631 GGAGTTCTAGAATCTGGAGAGGG - Intronic
1151366639 17:73621825-73621847 GGTGTTAGTGAAGCTCAAGAAGG + Intronic
1160039396 18:75332454-75332476 GGTGTGTCTGATTCTAGAGACGG + Intergenic
1164686338 19:30168955-30168977 GGTCTTCCTGAATGACTAGAAGG + Intergenic
930203728 2:48568091-48568113 GGTGTTCCTGAGGCTTGAGTAGG + Intronic
940594000 2:155766891-155766913 GCTGTTGCTGAAGCTCGAGTAGG - Intergenic
946088646 2:217199451-217199473 TCTGTTCCTGAATCTGGTGAAGG + Intergenic
1171322627 20:24259777-24259799 AGTGCTCCTGAAGCTTGAGATGG + Intergenic
1171874952 20:30565652-30565674 GATGTTCCTGAATCCCGGGTTGG + Intergenic
1174079791 20:47962700-47962722 GGGGTTCCTGAAACTCCACAGGG + Intergenic
1174759024 20:53188122-53188144 GGTTTTCATGAATTTTGAGAAGG - Intronic
1179612522 21:42561706-42561728 GGCGTTTCTGAATTTCGAAATGG - Intronic
1181136178 22:20768104-20768126 GGTGTTCCTCAATTCCCAGACGG + Intronic
1183387363 22:37522608-37522630 GGTGCTCCTGAATCAAGGGAGGG - Intergenic
954380808 3:50218058-50218080 TGTGGTCCTGAATGTGGAGAGGG + Intronic
962108826 3:132420484-132420506 TGTGTTCCTGAATCTCAGGAGGG - Intronic
967662741 3:192133144-192133166 GGTTTTCCTGGATCTCTAGACGG - Intergenic
971325191 4:25637749-25637771 GCTGTCCCTGAATCTCCACAAGG + Intergenic
971505756 4:27365067-27365089 GGTGTACCTGTATCTCTGGAAGG - Intergenic
989273866 5:39564211-39564233 CGTGTTCCTGAATACAGAGATGG + Intergenic
991204275 5:64032222-64032244 TGTGTTCCAGGATCTAGAGAGGG - Intergenic
1001226243 5:169946849-169946871 GCTGGACCTGAATATCGAGATGG + Intronic
1007119892 6:39371113-39371135 GATGTTCCTGAATTTGGAGTTGG + Intronic
1007994973 6:46297404-46297426 GCTTTTCCTGAACCTCCAGAGGG + Intronic
1008708039 6:54187143-54187165 GATTTTCCTAAATCTCTAGATGG - Intronic
1015151300 6:130041510-130041532 GGTTTTCTTGAATCCTGAGAAGG + Intronic
1015496608 6:133889690-133889712 GGTGGTCTTGAGTCTGGAGAAGG - Exonic
1034129373 7:148700693-148700715 AGTGTTCCTTAAGCTTGAGAGGG + Intronic
1035627022 8:1078086-1078108 GGTTTTCCTAAATTTCGAGATGG + Intergenic
1047893805 8:129343197-129343219 AATGTTCCTTACTCTCGAGAAGG + Intergenic
1049716548 8:144095622-144095644 GGTGTTCCTGGATCCTGAGCCGG - Intronic
1051615163 9:18999696-18999718 GGTGCTCCTCACTCTCCAGATGG - Intronic
1051615180 9:18999776-18999798 GGTGCTCCTCACTCTCCAGATGG - Intronic
1053479211 9:38403488-38403510 GGTGTCCCTGAATCTCCATGTGG - Intergenic
1056058745 9:82860469-82860491 GGTATTCTTGCATCTCAAGATGG + Intergenic
1059954345 9:119500248-119500270 GGTGTCCCTGACTCTGGAGGGGG + Intronic
1203794090 EBV:167025-167047 GCTGTGCCTCACTCTCGAGATGG - Intergenic
1187472369 X:19580497-19580519 GGTGTCCCTGGCTCTCGAGATGG + Intronic
1191148916 X:57199340-57199362 GGTGTTCCTGAATGACCAGTGGG - Intergenic
1192699439 X:73452211-73452233 GGTGTTCCTGAATGTAAAGAGGG + Intronic
1194846232 X:98812623-98812645 GCTGTTCCTGAATCTCAAGTGGG - Intergenic
1198283921 X:135171330-135171352 GGTGTCCCTGACTCTCCTGAGGG - Exonic
1199669432 X:150130591-150130613 GGTGACCCTGAATCTCCAGTAGG - Intergenic