ID: 1082979797

View in Genome Browser
Species Human (GRCh38)
Location 11:59108926-59108948
Sequence TAGTATGTTCATATTTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082979795_1082979797 20 Left 1082979795 11:59108883-59108905 CCAGAAATTTTTACATTCCTATC 0: 1
1: 1
2: 3
3: 22
4: 292
Right 1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG 0: 1
1: 0
2: 1
3: 31
4: 354
1082979796_1082979797 3 Left 1082979796 11:59108900-59108922 CCTATCAATATTCTTGAGCTTTG 0: 3
1: 20
2: 73
3: 160
4: 601
Right 1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG 0: 1
1: 0
2: 1
3: 31
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082979797 Original CRISPR TAGTATGTTCATATTTTACA TGG Intronic
900903871 1:5536877-5536899 AAGTAAGGTCAGATTTTACAGGG + Intergenic
904805100 1:33125608-33125630 TTATGTGGTCATATTTTACAGGG + Intergenic
907107582 1:51898099-51898121 TAGTATTTTCATCTTTTATGCGG - Intergenic
907558973 1:55370967-55370989 TACTATTTTCATATTTTTGAAGG - Intergenic
907804917 1:57809022-57809044 TTGTAGGTTCATATTTTCCGAGG - Intronic
909108900 1:71449709-71449731 TATTATCTTCATTTTATACATGG + Intronic
910191263 1:84598306-84598328 TGGTATGTTTAAATTTCACAGGG + Intergenic
910603724 1:89059499-89059521 AACTATGTTCATATGTTAGAGGG + Intronic
910637107 1:89420986-89421008 AACTATGTTCATATGTTAGAGGG - Intergenic
911132541 1:94404369-94404391 TATTATGTTCATAAGCTACATGG + Intergenic
911363581 1:96909714-96909736 AAGTCTGATCATATTTTACTGGG + Intergenic
911571844 1:99526899-99526921 TATGATGTTCGTATTTGACATGG + Intergenic
912145767 1:106792291-106792313 GTGTATGTTCACATTTTAAAAGG + Intergenic
913370683 1:118095755-118095777 TGGAATGTTCATATGTTACTTGG + Intronic
916357337 1:163927090-163927112 TAGGATTTTCAGATATTACATGG - Intergenic
917910237 1:179637042-179637064 GAAAATGTCCATATTTTACATGG - Intronic
918316748 1:183328797-183328819 AAGTAGGGTCACATTTTACAAGG - Intronic
918552250 1:185756656-185756678 TTGTCTATTCATATTTTAAATGG + Intronic
918885112 1:190183131-190183153 AAGCATGTTCATAATTTTCAAGG + Intronic
919148626 1:193666744-193666766 TACTCTTTTCATATTTTAAAAGG - Intergenic
919323013 1:196066582-196066604 TAGTATATTCATTTTTTAGATGG - Intergenic
919329585 1:196153391-196153413 TAGTATTTACATATTTTTTAAGG + Intergenic
919975893 1:202612183-202612205 TGGTCAGTTGATATTTTACAAGG - Intronic
920409090 1:205744538-205744560 AAGTATTTTCATAACTTACATGG + Intronic
920601892 1:207334418-207334440 TTGTATTTTCATGTTTTACCTGG - Intronic
920888433 1:209957171-209957193 TAGTATTTTCAGATTTAACATGG + Intronic
921037845 1:211399512-211399534 TAGAGTGATCATATTTTTCATGG - Intergenic
921087940 1:211813966-211813988 AAGAATGTTCATACTTGACAAGG - Intronic
921862231 1:220051954-220051976 GATTAGGATCATATTTTACAAGG + Intergenic
923868643 1:237966692-237966714 CAGTATGTACATATATTATATGG + Intergenic
924774584 1:247106992-247107014 AAGTATTTTAATATTTTAAAAGG - Intergenic
1062999699 10:1904614-1904636 TAATTTGTACTTATTTTACATGG + Intergenic
1063507671 10:6615938-6615960 TTGTATGTTCATATTTACAACGG + Intergenic
1066030245 10:31414123-31414145 TAGTTTTTTCATATATAACATGG + Intronic
1067816985 10:49486957-49486979 TAGTAGGTTAATATATTACTAGG - Intronic
1067987778 10:51170286-51170308 TAGTGTGTTGATATAATACAGGG + Intronic
1068367676 10:56071974-56071996 TTATATGTTCATATTATATATGG + Intergenic
1068572420 10:58644958-58644980 TATTATGTTCACATTCTAAAAGG + Intronic
1069184108 10:65400860-65400882 TCATATGTGCAGATTTTACAGGG - Intergenic
1069203695 10:65655535-65655557 TTGTATGTTCTTTTTATACAGGG - Intergenic
1070212545 10:74340943-74340965 AAGTATTTTCATATTTTATGAGG - Intronic
1072219755 10:93317239-93317261 GAGTATGCTCTCATTTTACATGG + Intronic
1072330242 10:94341342-94341364 TAGTTTGTAAATATTTTACTTGG - Intronic
1073194243 10:101675154-101675176 AAGTGTGTGCATATATTACATGG + Intronic
1074937982 10:118205039-118205061 TAGCATGTTCAGATTTTGGAGGG + Intergenic
1075467917 10:122665215-122665237 CAATATGTTCCTATTTTAAAAGG - Intergenic
1076040535 10:127243835-127243857 AAGTATGTTAATATTTTTAAAGG - Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077592277 11:3501415-3501437 TAGTATGTTCTGTTTTTATAGGG + Intergenic
1078167670 11:8902719-8902741 TATTATGCTTATAGTTTACATGG + Intronic
1078307105 11:10200230-10200252 TAGTATCTTCATTTTTTATATGG - Intronic
1078707766 11:13761555-13761577 TAGCACCTTCATATTTTCCAGGG - Intergenic
1079604287 11:22345095-22345117 TAGCATTTTAATATTTGACAAGG - Intronic
1079747688 11:24154159-24154181 TAGTATCTTCCTTTTTTATATGG - Intergenic
1079814724 11:25041095-25041117 TATTTTGTTCATTTTTTTCATGG + Intronic
1080060375 11:27950333-27950355 TAGTTTGTTCATTTGTAACATGG - Intergenic
1080151061 11:29052585-29052607 TAGAATGATTATATTTTAAATGG - Intergenic
1081375999 11:42359405-42359427 TAACATGTACATATTTTTCAAGG - Intergenic
1081560002 11:44204870-44204892 TAATGTATTCATATTTTATAAGG + Intronic
1082959840 11:58907769-58907791 CAGTACGTTGTTATTTTACATGG + Intronic
1082975375 11:59065191-59065213 TAGTACCTTGATATTTTACATGG + Intergenic
1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG + Intronic
1084248113 11:67874136-67874158 TAGTATGTTCTGTTTTTATAGGG + Intergenic
1086022023 11:82241691-82241713 TAGAAAGTACATATTTTATAAGG + Intergenic
1086593856 11:88547814-88547836 TAGCATATTTTTATTTTACAAGG + Intronic
1088412307 11:109548047-109548069 TGCTAAGTTCATATTTTAGATGG + Intergenic
1088541078 11:110914238-110914260 TAGTATGATCATAGCTGACAGGG + Intergenic
1089009662 11:115122115-115122137 TAGTATCTTCATTTTACACACGG - Intergenic
1089113528 11:116075493-116075515 TAGTATGTTAATATTTTAAATGG + Intergenic
1092150259 12:6243076-6243098 TATTATATGCATATTTCACAAGG + Intergenic
1093056772 12:14563881-14563903 CAGTATGTTCATTCTTTACACGG - Intronic
1093552524 12:20431689-20431711 TAGTATGTCTAAATTTTTCATGG + Intronic
1093809432 12:23473671-23473693 CATTATGTTTATATTTTTCATGG - Intergenic
1094023038 12:25934490-25934512 TATTATGAACATATTTAACAAGG + Intergenic
1095110143 12:38285892-38285914 TATTATGTTAATATTTTTCCAGG - Intergenic
1095150244 12:38785570-38785592 TAGCAAAGTCATATTTTACATGG - Intronic
1095758005 12:45792961-45792983 TAGTCTGTTTATATTTAATATGG + Intronic
1097744835 12:63289934-63289956 GTGTCTGTTCATATTTTAAAAGG + Intergenic
1098285415 12:68902176-68902198 TAGTATGCTCATATTCTTCTTGG - Intronic
1098661350 12:73098579-73098601 TATCATGTTCATATTTTTCTGGG + Intergenic
1099600041 12:84723325-84723347 AAGTAAGTTCATATTTTAAAAGG - Intergenic
1100071034 12:90718084-90718106 TATTATATTCAGTTTTTACATGG - Intergenic
1100211320 12:92401368-92401390 TAGAATGTTTATACTTCACAGGG + Intergenic
1100486823 12:95037427-95037449 TAGTACCTTTGTATTTTACAAGG - Intronic
1101091903 12:101295819-101295841 TAGTATGATCTCATTTTGCAAGG + Intronic
1103205362 12:119124847-119124869 TAAAATGTTCTTATTTTAAATGG - Intronic
1104091855 12:125524210-125524232 AAGCATGTTCATATTTTTTATGG - Intronic
1104690921 12:130825871-130825893 TCGTTTCTTCATGTTTTACAAGG + Intronic
1106008786 13:25797671-25797693 TAGTATTTTTACATTTTAAAGGG + Intronic
1106961230 13:35000504-35000526 TACTTTGTTAACATTTTACATGG + Intronic
1107115899 13:36745054-36745076 TGTTTTGTTCATATTTTAAAGGG - Intergenic
1107425752 13:40291152-40291174 TAATGTTTTAATATTTTACAAGG + Intergenic
1108497240 13:51037105-51037127 TACTATGTTCAAATATTACTGGG - Intergenic
1108811465 13:54229719-54229741 TTTTATATTCATATTTTCCAGGG + Intergenic
1108980854 13:56511456-56511478 TAGAATTCACATATTTTACAGGG - Intergenic
1108986937 13:56603209-56603231 GAATATGTACATATGTTACACGG + Intergenic
1109490231 13:63088146-63088168 TTGTATGTTCAGTTTTTACAGGG - Intergenic
1109491304 13:63103253-63103275 TATTATGTTAACATTTTATATGG - Intergenic
1110322945 13:74180914-74180936 TAGTCTGCTCAAATTTTAAAAGG + Intergenic
1111051733 13:82891535-82891557 TCGTTTGTATATATTTTACATGG + Intergenic
1111339023 13:86859831-86859853 TATTATGTTGATATATTACTTGG - Intergenic
1112526702 13:100155559-100155581 TAGAATGCTCATAATTTACAAGG + Intronic
1112585815 13:100717761-100717783 AAGTATGTTCTTATTAAACAAGG + Intergenic
1114387642 14:22271374-22271396 AATTGTGTTCACATTTTACATGG - Intergenic
1114822913 14:26043160-26043182 TAGTATCTTAATATGTTACCTGG + Intergenic
1115089846 14:29560723-29560745 TAAGATATTCATGTTTTACATGG + Intergenic
1115459458 14:33644203-33644225 GAGTATGTTCACATTTTCAATGG - Intronic
1115467188 14:33728287-33728309 TATTATTTTCATATTTTAGGTGG + Intronic
1116194335 14:41703257-41703279 TAGCATGTGCATATGTTATAAGG + Intronic
1116212156 14:41962286-41962308 TATTTTGTTTATATTTAACATGG + Intergenic
1116389146 14:44371648-44371670 TAGAATGTTCAGATTTTTCTAGG - Intergenic
1116613992 14:47110319-47110341 TAGTATGTACATACTTTAATGGG + Intronic
1117126423 14:52631881-52631903 TTGTTTATTCATATATTACAAGG + Intronic
1117127286 14:52643046-52643068 TAGTTTTTTAATATTTTACATGG - Exonic
1117620695 14:57583370-57583392 AAATGTGTTCATATTTTAAAAGG - Intronic
1118109712 14:62703762-62703784 TAGAATGTGCATATCATACATGG - Exonic
1118110302 14:62711168-62711190 TATTTTATTGATATTTTACATGG - Intronic
1118113596 14:62750057-62750079 AAATATGTAAATATTTTACATGG + Intronic
1118552271 14:66967246-66967268 TTGAATGTTGATATTTTAAAAGG + Intronic
1120034872 14:79685281-79685303 TAGTTTCTTCATATTTAAAAGGG - Intronic
1120142821 14:80947467-80947489 TAGCATATTCATTTTTCACAGGG - Intronic
1120301745 14:82716069-82716091 TATTATGTATATATTTTATAGGG - Intergenic
1120450460 14:84660159-84660181 TAGTATGTTAAGATTATAAAAGG - Intergenic
1121742018 14:96260600-96260622 TAGTTTGGTCATTTTTTGCAGGG - Intronic
1122755160 14:103972780-103972802 TAGGATGTTCATATTTTCACTGG + Intronic
1124120120 15:26882000-26882022 TAGTATTTGCATTTTTAACAGGG + Intronic
1125264181 15:37860765-37860787 TCACATTTTCATATTTTACAGGG + Intergenic
1126733162 15:51705343-51705365 TTTTATATTCATTTTTTACATGG - Intronic
1126826803 15:52559625-52559647 TGGTATAGTCATATCTTACATGG - Intronic
1127101584 15:55571216-55571238 TAGTATGTGTATACTATACATGG - Intronic
1129577396 15:76764752-76764774 TAGTAAATTGATATTTTGCAGGG - Intronic
1129864292 15:78891893-78891915 TAGTATTTTCTTATTTACCATGG - Intronic
1134617618 16:15663762-15663784 TAGTTTTATCATAATTTACATGG + Intronic
1139042950 16:63020741-63020763 TAGTAGTTTAATATTTTGCAGGG + Intergenic
1140715988 16:77726094-77726116 TAGTATTTTCACATTATACTGGG - Intronic
1141044343 16:80703113-80703135 GTGTATGTGCATATTCTACATGG - Intronic
1142543143 17:677614-677636 TATTATATACATATTTTACAAGG + Intronic
1144801661 17:17932952-17932974 TAATGTTTTAATATTTTACAAGG - Intronic
1146279301 17:31534828-31534850 TAGTAGACTCAGATTTTACATGG + Exonic
1149013920 17:51886494-51886516 TAGTATTCTCATATTTTCCTGGG - Intronic
1149043275 17:52215874-52215896 TAGTATGTTTATAATTTTTAGGG + Intergenic
1149382919 17:56111422-56111444 CAGTATGATCATATTTCAAAGGG - Intronic
1149766361 17:59281974-59281996 TAGAACATTCATATTTTACAAGG - Intergenic
1153078257 18:1191005-1191027 TAGTAATTTGATATATTACATGG - Intergenic
1153442533 18:5136400-5136422 TTGTATATTCAGATTTCACAGGG - Intergenic
1153461526 18:5339147-5339169 TAGTCTGTTAATTTTTGACAAGG - Intergenic
1153475076 18:5489964-5489986 GAAGATGTTCATATTTTAGAAGG - Intronic
1154402606 18:14055869-14055891 TAGTATGTTTATTTTTTATTTGG - Intergenic
1154932545 18:21014983-21015005 TAGAATGTTCATCTTTTCCATGG - Intronic
1156202100 18:34845188-34845210 CAGTATGTTCAAATTATACAAGG - Intronic
1156570381 18:38245631-38245653 TATAATGGTCATATTTTATATGG - Intergenic
1156976734 18:43231093-43231115 TAGTATGTGCAAATATTACACGG - Intergenic
1157083104 18:44549562-44549584 AAGTAGGTTCATCTTTTAGAGGG + Intergenic
1158527858 18:58231493-58231515 TAGTATCTTCACAGTTTTCAGGG - Intronic
1159039761 18:63312900-63312922 TAGTGGGTTAATATTTAACAAGG + Intronic
1159193153 18:65074906-65074928 TACTTTGTACATATTTTTCATGG + Intergenic
1159663421 18:71127516-71127538 TACTATGTTTATATATTAAAAGG - Intergenic
925673571 2:6337129-6337151 TAATTTGTTAATATTTTACTGGG + Intergenic
926090517 2:10045870-10045892 TACTAAGTTCATATTTTTCTTGG - Intronic
928361770 2:30668689-30668711 AAGTATGTGCATATTTAACCTGG - Intergenic
928642701 2:33317335-33317357 TATTATGTTGGTATTATACATGG + Intronic
929175768 2:38974192-38974214 GAGCATGTTCATATTTAACATGG + Exonic
929279189 2:40059772-40059794 GAGAATGTTCATTTTTAACAAGG - Intergenic
929365211 2:41146370-41146392 TAAAATGTTGATATTTTTCACGG - Intergenic
930637074 2:53818398-53818420 TAGAATTTACATATTTTACATGG - Exonic
930694624 2:54398758-54398780 TTGTATGATAATATTTTAAAGGG - Intergenic
930975482 2:57454243-57454265 AAGTATGTCCAGATGTTACATGG + Intergenic
931003001 2:57810705-57810727 TAGTTTGCTTATATTTTAAATGG - Intergenic
931896295 2:66733805-66733827 TAGTATTTTGCTATTTTTCAAGG + Intergenic
933011088 2:77064577-77064599 AAGTATGTGCATATCTTAGAAGG + Intronic
933207194 2:79520654-79520676 TATTTTGTTCATTTTTTAGATGG - Intronic
933306331 2:80604401-80604423 TAGTATGTTCTTCTTTCTCAAGG - Intronic
934150084 2:89138048-89138070 TAGTAGCTTCAATTTTTACAGGG - Intergenic
935315326 2:101827751-101827773 CAGTATCTTCATATTGAACATGG + Intronic
936017051 2:108967273-108967295 TTGCAGGTTCATATTTCACAGGG + Intronic
936868100 2:117100233-117100255 AAGTATGTTCATATTTGAAGAGG + Intergenic
937534533 2:122869478-122869500 TAATATGTTTATATATTAAAGGG - Intergenic
937739180 2:125329469-125329491 CAGCATGTTCATCTTTTAAATGG - Intergenic
938673966 2:133611903-133611925 AAGTACATCCATATTTTACAGGG - Intergenic
939028053 2:137038044-137038066 TCCTATGTTAAAATTTTACAAGG - Intronic
939726711 2:145729580-145729602 CTGTAAGTTCATATTTTACTTGG - Intergenic
940737456 2:157469474-157469496 AAGTATTTTCATAATTGACAAGG + Intronic
941332400 2:164194811-164194833 TAGCAAAGTCATATTTTACATGG - Intergenic
941437980 2:165495557-165495579 TCATATGTGCATCTTTTACAAGG - Intronic
941695662 2:168548547-168548569 TTGTGTGTTCATATATTAAATGG + Intronic
942561647 2:177226185-177226207 TTGAATGTTGATTTTTTACATGG + Intergenic
942713329 2:178863236-178863258 CAGTATGTTCATTTTTCAGATGG - Intronic
942922073 2:181386859-181386881 TAGTCAGTTGATTTTTTACATGG + Intergenic
943175545 2:184468044-184468066 TACTATTTTCATAGTTTCCATGG - Intergenic
943863741 2:192900295-192900317 TAATGTGTTCATATATTGCAAGG - Intergenic
943876853 2:193077368-193077390 TATTATGTACATATTTCATATGG + Intergenic
944892933 2:204136137-204136159 TCATATTTTCATTTTTTACAGGG + Intergenic
945230293 2:207581534-207581556 TAGAATGTTAACATTTTAGATGG - Intronic
945720548 2:213413055-213413077 TAGTATGTTGATACTATAAATGG + Intronic
946443506 2:219717658-219717680 TACTATGTTCATAAGTTACTAGG - Intergenic
946950906 2:224873769-224873791 TAGTATATTAATATTTTATTAGG + Intronic
948167710 2:235875914-235875936 TTGTTTGTTTATATTTAACATGG + Intronic
1169566920 20:6864608-6864630 TCTTATGTACAAATTTTACAAGG + Intergenic
1170146983 20:13186252-13186274 TGTTATGTACATATTTAACAAGG - Intergenic
1170149250 20:13211852-13211874 TTATATGGTCATATTTTAAATGG + Intergenic
1171006378 20:21469266-21469288 TTTCATATTCATATTTTACAAGG + Intergenic
1171165815 20:22969501-22969523 TAGTATTTTCCTGTTGTACAAGG - Intergenic
1171891584 20:30723253-30723275 AAGTATGTTTTTATTTTATAGGG - Intronic
1172165955 20:32899464-32899486 TAATGTTTTCATTTTTTACATGG - Intronic
1175005792 20:55681297-55681319 TGGTATCTTAATATTTTTCAAGG - Intergenic
1176949497 21:15028519-15028541 TTGTATGTATATTTTTTACAAGG + Intronic
1177547138 21:22573574-22573596 TACTATGTTTATAATTGACAGGG + Intergenic
1177929014 21:27256869-27256891 TAATATCTTCATATATTAAATGG - Intergenic
1178888176 21:36498653-36498675 TCCTATGTTCATTTTTTCCAGGG - Intronic
1179227448 21:39467556-39467578 TTGTATGCTCAGATTTTAAAAGG + Intronic
1182974532 22:34610651-34610673 TCCTATGTTTCTATTTTACATGG + Intergenic
1183582644 22:38735100-38735122 TATTATGTATATATTTTTCAAGG - Exonic
1184558386 22:45246475-45246497 AAGTATGTTAATGATTTACAAGG - Intergenic
949364700 3:3268329-3268351 TAGTATTTTCATAGTTTCAAAGG + Intergenic
949491848 3:4596926-4596948 TAGTGTGTTGATATGTTACCAGG + Intronic
949785686 3:7738764-7738786 TAGTGTGTTGATATTTGACAAGG + Intronic
950457994 3:13103960-13103982 TAGTATCTTCATTTTATAGATGG + Intergenic
951231467 3:20184728-20184750 TGTTATGTTCATAATTTACTGGG - Intronic
951702048 3:25506681-25506703 TTGTTTGTTTATATTTTCCATGG - Intronic
951865684 3:27304747-27304769 CAGCTTCTTCATATTTTACAAGG - Exonic
951986252 3:28624703-28624725 TAGTATGTTTAAATCCTACATGG + Intergenic
953240684 3:41146607-41146629 AAGTATTTTCATTTTTAACATGG - Intergenic
953400762 3:42613885-42613907 TAGTATGTTGCTTTTATACATGG - Intronic
953553905 3:43926941-43926963 AATAATGTTCATATTTTATATGG + Intergenic
954269764 3:49498630-49498652 TACCATGTTCCTATTTTAAATGG - Intronic
956308781 3:67856005-67856027 TAGGATATTCAGATCTTACATGG + Intergenic
956342086 3:68236655-68236677 GAGTGTGTTAATATTTTTCATGG + Intronic
956981679 3:74646151-74646173 TAATATGCAGATATTTTACAAGG + Intergenic
958003372 3:87780231-87780253 TATTCTGGTCATATTTTCCATGG - Intergenic
958778932 3:98518720-98518742 TATTCTGTTGATATTTTAGAAGG - Intronic
959011392 3:101080868-101080890 TAGTCAGTACCTATTTTACAAGG + Intergenic
959245158 3:103857204-103857226 GAGCATGCTCATATTTTGCAAGG + Intergenic
960849641 3:122038215-122038237 TATTCTGTTCTTATTTTACTTGG - Intergenic
961048190 3:123723889-123723911 TAGTTTTTACATATTTTAAATGG + Intronic
961896077 3:130168745-130168767 TAGTATGTTCTGTTTTTATAGGG + Intergenic
962089224 3:132225636-132225658 TAGTATTTTAATCTTTTATATGG + Intronic
963404211 3:144842020-144842042 TAGTATGCTATTATGTTACAAGG - Intergenic
963570876 3:146993735-146993757 TTGTATTTTAATATTTTATATGG + Intergenic
964215569 3:154276997-154277019 TAGAAGGTTAATATTTTAGAAGG - Intronic
965765479 3:172125635-172125657 TAATGTGTTCAAATCTTACAAGG - Intronic
966074003 3:175914183-175914205 TAGTATTGTCATATTCTGCATGG - Intergenic
967295504 3:187960399-187960421 TAGTATGTTCATATGTGAAATGG - Intergenic
969009244 4:4047880-4047902 TAGAGTGATCATATTTTTCATGG + Intergenic
969408062 4:7008039-7008061 TAGTTTGTTCATCTGTAACAGGG + Intronic
970454408 4:16208267-16208289 TAGTATAGTCATATTCAACATGG - Intronic
971290413 4:25332906-25332928 TATTATGTTCACATTTTAAATGG + Intronic
971406568 4:26326541-26326563 TAATAAGTTGATAATTTACATGG + Intronic
971661097 4:29417131-29417153 TAGTATTTTCATTTTGTACTTGG + Intergenic
971766077 4:30833591-30833613 TAGTATATTCATAGGGTACATGG + Intronic
971774587 4:30946319-30946341 CAATATGTTAATATATTACAGGG - Intronic
971910856 4:32795762-32795784 TAGTATCTTCTTATTTTATATGG + Intergenic
971922762 4:32964189-32964211 TAGAATGTTAATATTTGACTTGG - Intergenic
974270758 4:59648840-59648862 TATTATTTTCATATCTTAAAAGG + Intergenic
974798750 4:66786552-66786574 TATTCTTTTCATATTTTAAAAGG - Intergenic
975167125 4:71188782-71188804 TAGCATGTAAATAATTTACATGG + Intronic
975895094 4:79079417-79079439 TTGTATGTTCAGATTTTTCTTGG + Intergenic
976638052 4:87307941-87307963 AAGTTTGTTCATAGTTTATATGG + Intronic
977121373 4:93105924-93105946 TAGTATATTCACAGATTACAGGG + Intronic
977257461 4:94757415-94757437 TAATGTGTTCATTTTTTACAAGG + Intergenic
978263415 4:106791679-106791701 TTGTTTGTTCATATTATAAATGG + Intergenic
978454291 4:108870844-108870866 TAATATGTTGAAAGTTTACACGG + Intronic
978460399 4:108945518-108945540 TAGAATGGACATATTTTACTTGG + Intronic
978555579 4:109976637-109976659 TATTATTTTCAGATTTTACATGG + Intronic
979399454 4:120230655-120230677 TTGTTTGTTCACATTTTGCAGGG + Intergenic
981010899 4:139923589-139923611 TTGTATGTACATATTTTAAGGGG + Intronic
982183988 4:152778111-152778133 TAGTTTGTTCATAGTTTCCTTGG - Intronic
982494964 4:156078839-156078861 TTGTGTGTTTATATCTTACAAGG + Intergenic
983012615 4:162565789-162565811 TAATAGGTACATATGTTACAAGG - Intergenic
983105451 4:163681131-163681153 CAGTATCTCCATATTTTAAAGGG + Intronic
983586617 4:169362538-169362560 TAGTATGTGCATATTTTTACAGG - Intergenic
984742485 4:183179296-183179318 CAGTATTTTAATACTTTACAAGG + Intronic
985321473 4:188716518-188716540 CAGTATGTTCATCTATAACATGG - Intergenic
986120711 5:4833510-4833532 ACGTATGTGCATATTTTTCATGG + Intergenic
986951193 5:13086881-13086903 TAACATGTTTGTATTTTACATGG - Intergenic
987281160 5:16414878-16414900 TGGTATATTAATATTTTCCATGG + Intergenic
987466895 5:18282960-18282982 TAGTTTGTTCATTTTTTAATCGG - Intergenic
987663826 5:20909536-20909558 TAATAAGTCCATAATTTACAAGG + Intergenic
987730594 5:21766324-21766346 TAGTATGTTCTTATAATACCAGG + Intronic
987821965 5:22976791-22976813 TAGTTTGTTCATGTTTTCTAAGG - Intergenic
988318145 5:29658449-29658471 GCATATGTTCATATTTTAAAGGG + Intergenic
988653359 5:33178626-33178648 TAGTAGGTTTATTTTTCACAGGG - Intergenic
988758859 5:34292659-34292681 TAATAAGTCCATAATTTACAAGG - Intergenic
989719574 5:44508615-44508637 TATTATCTTCATTTTTTATATGG - Intergenic
990121044 5:52451844-52451866 TAGTATGGTCATAATTAAAAAGG - Intergenic
991467897 5:66934168-66934190 TAGTATATTCACATTGTAAAGGG - Intronic
991726747 5:69543159-69543181 AAGTATGTTAATATTTTAAAGGG + Intronic
991868210 5:71084715-71084737 AAGTATGTTAATATTTTAAAGGG - Intergenic
992937285 5:81721152-81721174 TAGTAGGTTTATATTTTTTATGG - Intronic
993583059 5:89687510-89687532 TAGTCTATTCATATTTAATATGG - Intergenic
994660716 5:102650829-102650851 TTCTATGTACATATTTCACATGG - Intergenic
995137003 5:108689925-108689947 TAGTACATTCATGTTTTACGGGG - Intergenic
995348973 5:111153351-111153373 TAGGATATTAATATTTTACTTGG + Intergenic
995446618 5:112251891-112251913 TACTATGTTCAAAATTTACTTGG - Intronic
995904052 5:117101973-117101995 AAGTATGTTCAAATATTACATGG - Intergenic
995908311 5:117153782-117153804 TAGTAATTTCATATTCTTCAGGG + Intergenic
996009268 5:118462805-118462827 TAATAGCTTCATATTTCACATGG - Intergenic
996437869 5:123455566-123455588 TATTATTTTCAAATTTTAAAAGG + Intergenic
996652354 5:125894918-125894940 TTGTATCTTCATATTTTATTTGG + Intergenic
997486769 5:134237429-134237451 TAGTATCTTCATCTGTAACATGG + Intergenic
998687436 5:144544963-144544985 TACTATGCTAATATTTTAAAAGG + Intergenic
999168484 5:149571991-149572013 AAGTTTGTTCTTATTTTCCAGGG - Intronic
999628779 5:153547943-153547965 TAGGACGTTTATATTTTAAAGGG - Intronic
1000668665 5:164032125-164032147 TAGTATATTCTTAGTTTTCAAGG - Intergenic
1001210096 5:169802926-169802948 TAATATTTTAATTTTTTACAAGG + Intronic
1003658793 6:8041193-8041215 GAGTATGTTCATTTGTTTCATGG + Exonic
1005460398 6:26063825-26063847 TAGATTGTTTATATTTTTCATGG + Intergenic
1005772537 6:29089691-29089713 TATTTTCTTCATATTTTATATGG + Intergenic
1008261949 6:49377519-49377541 TAGTCTGTTAATTTTCTACAAGG + Intergenic
1008457260 6:51725456-51725478 TATTATGTTCATATTTTATTTGG + Intronic
1008788995 6:55205748-55205770 TAGTGTGTTTATTTTTTAGACGG + Intronic
1008964015 6:57296278-57296300 TAGTAAGTTTATTTTTCACAGGG + Intergenic
1009594292 6:65714566-65714588 TTGTAATTTCAAATTTTACATGG + Intergenic
1009610928 6:65939133-65939155 TAGAAAGTACATATTTTTCACGG - Intergenic
1009817100 6:68750432-68750454 TAATAGGTTCATTTTTTTCATGG - Intronic
1009930472 6:70171943-70171965 TCTTATGTTCATATTTAACAGGG + Exonic
1012215954 6:96584217-96584239 TAGCATTTTCATATATTTCAGGG - Intronic
1012473835 6:99600297-99600319 TAGTATATTCACAGTTCACAGGG - Intergenic
1015615951 6:135075561-135075583 TTTTATGTTCATATTTTAAGTGG - Intronic
1018537150 6:164833216-164833238 TATTATGTTAATTTTTTCCATGG - Intergenic
1020761565 7:12273434-12273456 TAATATGTGTATATTTTATAGGG + Intergenic
1021149494 7:17132256-17132278 TAATATATTCATAGTTTCCATGG - Intergenic
1023591287 7:41783191-41783213 TAGTGGGTTCTTATTTTCCATGG - Intergenic
1028216979 7:88145688-88145710 TAGTATTCTCATCTTTTAGATGG - Intronic
1028481865 7:91315127-91315149 TGGGATGTTCATATTTTTCCCGG + Intergenic
1030187052 7:106774292-106774314 AAGAATGTTCAAGTTTTACAGGG + Intergenic
1030975427 7:116116060-116116082 TAGAAAGAACATATTTTACATGG + Intronic
1031308603 7:120164859-120164881 TAGGATTTTTATACTTTACATGG + Intergenic
1031466777 7:122122846-122122868 CAGTATGTTCACGTTTTAAATGG - Intronic
1033246836 7:139724317-139724339 TATTAAGTTTATATTTCACAAGG + Intronic
1035417225 7:158699748-158699770 TAGAATGTAAATATTTTTCAAGG + Intronic
1036113999 8:5938199-5938221 AAGTATGTGCAAATTTCACATGG - Intergenic
1036250519 8:7158554-7158576 TAGAGTGATCATATTTTTCATGG + Intergenic
1036366964 8:8128899-8128921 TAGAGTGATCATATTTTTCATGG - Intergenic
1036369843 8:8153580-8153602 TAGTATGTTCTGTTTTTATAGGG - Intergenic
1036881048 8:12512064-12512086 TAGTATGTTCTGTTTTTATAGGG + Intergenic
1036883916 8:12536762-12536784 TAGAGTGATCATATTTTTCATGG + Intergenic
1036998188 8:13684962-13684984 TAGAATGTTCAAATGTTCCAGGG - Intergenic
1037825585 8:22158702-22158724 TAGTATGTTCATCTGTGAGATGG - Intronic
1038164901 8:25076376-25076398 TAATGTGTTCATTGTTTACAAGG + Intergenic
1038656931 8:29461372-29461394 TAGTATGCTCAGCTTTTGCAGGG + Intergenic
1039417081 8:37404643-37404665 TTGTATGTGCATACCTTACAGGG - Intergenic
1040563267 8:48543515-48543537 TAGTTTGTACATCTTTCACAGGG - Intergenic
1042023508 8:64397922-64397944 TAGAATGTTCTCATATTACATGG + Intergenic
1043199257 8:77342734-77342756 GTGTATGTACATATTTTCCATGG + Intergenic
1043549063 8:81348438-81348460 TAGTATGTTCCTAATCTGCAGGG - Intergenic
1043754205 8:83982298-83982320 TAGTATTTTCATGTTTTGGATGG - Intergenic
1044557007 8:93573975-93573997 TAATATGTTAATATTTTTTAAGG + Intergenic
1045918173 8:107498536-107498558 TAGTATGTGCATATTAAAGAGGG + Intergenic
1046408122 8:113801598-113801620 TTGTATTATCATATTTTAAAAGG + Intergenic
1046691892 8:117295165-117295187 TAGTATGATCCTATTTGCCATGG + Intergenic
1046760343 8:118013781-118013803 AAGTATGTTCAAATATTTCATGG + Intronic
1047047954 8:121075918-121075940 TAATATTTTCATATGTTACAAGG - Intergenic
1048160066 8:132010560-132010582 TTGTATATACATATTTTCCAAGG + Intronic
1050564921 9:6872124-6872146 TGGAATGTTCATATTTAAGAAGG + Intronic
1050936965 9:11410805-11410827 AAATATGTCCATATTTTAAATGG - Intergenic
1051033301 9:12710067-12710089 TAATATGTTAATATTTTACTTGG - Exonic
1052305776 9:27007590-27007612 TACTATGTTCATCTTTTATTTGG + Intronic
1055818058 9:80231110-80231132 CACTATGTTAATATTTTTCATGG + Intergenic
1057434167 9:95024060-95024082 AAGCATGCTCATAATTTACAGGG - Intronic
1058409328 9:104713525-104713547 TAGTATTTTCACATTTTTCTTGG - Intergenic
1058476864 9:105343973-105343995 AAATATGTCCATATTTTTCATGG + Intronic
1058920501 9:109609899-109609921 CACTATGTTCATATTTAGCATGG + Intergenic
1059026860 9:110643970-110643992 CAGAATGTTCATATTTTATTAGG + Intergenic
1061119024 9:128631998-128632020 TAGAATGTTCTTGTTTTACGAGG + Intronic
1186491141 X:9973476-9973498 AAGTATGTTAATATCTTAAAAGG + Intergenic
1188044207 X:25406995-25407017 TAGTATGTGTATAATTTACGGGG + Intergenic
1188095188 X:26012585-26012607 CAGTAAGTTCACATTTCACATGG - Intergenic
1188279239 X:28243331-28243353 TAGTTTGTTAATATTTTACTCGG + Intergenic
1188378424 X:29462230-29462252 AACTATGTTCATAGTTTTCAAGG + Intronic
1188706235 X:33335212-33335234 TAATATATACATATTTTAGAAGG - Intronic
1188825557 X:34828796-34828818 CAGTGTGTTCATATTTTATATGG - Intergenic
1189695663 X:43659285-43659307 TAGTATGTTAATAGTTGAGAGGG + Intronic
1190616387 X:52237382-52237404 GAAAAAGTTCATATTTTACATGG - Intergenic
1192706945 X:73536539-73536561 TAGTATTTTAACATTTTACTTGG - Intergenic
1193606627 X:83576405-83576427 GAGAATGATCATCTTTTACAGGG - Intergenic
1194080068 X:89451362-89451384 AATTATGTTCATTTTTTAAAAGG - Intergenic
1194317128 X:92392803-92392825 TAGTATATCAATATTTTCCAGGG - Intronic
1196353932 X:114765566-114765588 TAGTATGTTCAACATTTCCATGG - Intronic
1197798034 X:130318806-130318828 AAATATTTTCATATTTTCCATGG + Intergenic
1198400876 X:136267051-136267073 TGTTTTGTTCATTTTTTACAAGG - Intergenic
1198570152 X:137946188-137946210 TATTGTGTTCATTTTTTAGATGG + Intergenic
1199079447 X:143560207-143560229 TAGGATGCACATATTTTACCTGG - Intergenic
1199611021 X:149613723-149613745 GAATATGTTATTATTTTACATGG - Intronic
1199783030 X:151081008-151081030 TAGTATGTACATATGTTAGCAGG + Intergenic
1199900904 X:152170946-152170968 TAGTATTTAAATAATTTACAAGG - Intronic
1200432748 Y:3107422-3107444 AATTATGTTCATTTTTTAAAAGG - Intergenic
1200625302 Y:5506120-5506142 TAGTATATCAATATTTTCCAGGG - Intronic