ID: 1082979908

View in Genome Browser
Species Human (GRCh38)
Location 11:59110457-59110479
Sequence TCTAGGGATCTGTACAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082979904_1082979908 -2 Left 1082979904 11:59110436-59110458 CCTTATACAAGGTGAATAAGTTC 0: 2
1: 0
2: 1
3: 12
4: 143
Right 1082979908 11:59110457-59110479 TCTAGGGATCTGTACAGCATGGG 0: 1
1: 0
2: 1
3: 3
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082979908 Original CRISPR TCTAGGGATCTGTACAGCAT GGG Intronic
902992381 1:20197383-20197405 TGTGGGGATCTGGAGAGCATGGG + Intergenic
908104807 1:60830455-60830477 TCTAGGGATTTATACAGCTCAGG + Intergenic
908865781 1:68547603-68547625 TCCAGGGGTCTGAGCAGCATTGG + Intergenic
916763894 1:167841841-167841863 TCTAGGCATCTGAAATGCATCGG - Intronic
920597134 1:207283413-207283435 TCCAGGGTTCTGTATAGCCTTGG + Intergenic
921337400 1:214102028-214102050 TCTAGGAACCTGTACATCAAAGG + Intergenic
1063058672 10:2528354-2528376 TCATGGCATCTGTCCAGCATGGG - Intergenic
1065596764 10:27320401-27320423 TATCGGGGTCTGTACAGGATTGG + Intergenic
1070815802 10:79322513-79322535 TCTTGGGATCTGCAGACCATGGG - Intergenic
1073098636 10:100995801-100995823 TCCAGGGATCTGAACAGACTGGG - Intergenic
1076117474 10:127910250-127910272 TCTTGGGATCTGGAAAGCTTTGG - Intronic
1076260819 10:129064336-129064358 TCTAGGGCACAGGACAGCATCGG + Intergenic
1079218294 11:18535650-18535672 TCCAGGGGTCTGTACCGCATAGG - Intronic
1082979908 11:59110457-59110479 TCTAGGGATCTGTACAGCATGGG + Intronic
1085945993 11:81274115-81274137 TCTAGGAATCTGCACATCATAGG + Intergenic
1094355413 12:29572746-29572768 TCTAGGGAGAATTACAGCATTGG + Intronic
1096872984 12:54606121-54606143 TCTAGGGAACAGTACAGTCTTGG + Intergenic
1097955927 12:65485036-65485058 TCCAGGGATCTCTAGAGCAGGGG + Intronic
1098508705 12:71285345-71285367 TCTAGAGATCTGTACAACATTGG - Intronic
1100997471 12:100317881-100317903 TCTAGTGCTCTGTAAACCATGGG - Exonic
1101085667 12:101233381-101233403 TCTTGGGCTCTGTATGGCATGGG + Intergenic
1102385427 12:112505128-112505150 TGTAGGGATCTGGGAAGCATCGG + Intronic
1106107696 13:26748143-26748165 TCCAGGGATGTGTACAACACAGG + Intergenic
1106590470 13:31094146-31094168 TCTTGGTATCTGTAGAGAATGGG - Intergenic
1107355747 13:39564470-39564492 TCTTGGGTTTTGTACTGCATGGG - Intronic
1109554746 13:63957585-63957607 TCGAGGGATCTGTATTCCATGGG - Intergenic
1112049978 13:95635637-95635659 TCTCGGGCTGTGTACAGCACTGG + Intronic
1115274627 14:31593577-31593599 TCTAGGTATCTGCAGGGCATTGG - Intronic
1118301919 14:64623934-64623956 TCTAGGCTTCTGTTCAGCCTTGG + Intergenic
1125864098 15:43028188-43028210 TTTAGGGATTAATACAGCATGGG - Intronic
1133727962 16:8554937-8554959 TCTGGGGGTCTGCAGAGCATAGG - Intergenic
1144480658 17:15626414-15626436 TCTAAGGATGTTTACAGTATAGG - Intronic
1144917651 17:18737327-18737349 TCTAAGGATGTTTACAGTATAGG + Intergenic
1147460943 17:40568647-40568669 TCCAGGGAGCTGAGCAGCATTGG + Intergenic
1152513298 17:80804884-80804906 TGAGGGGATGTGTACAGCATGGG + Intronic
1153796401 18:8626814-8626836 TCTGTGCAGCTGTACAGCATGGG + Intronic
1156275425 18:35579483-35579505 GCTACAGACCTGTACAGCATGGG + Intergenic
1156712864 18:39967532-39967554 TCTAGACATCTGTAAAGAATGGG + Intergenic
1158696015 18:59704680-59704702 TCAAGTGATCTGTTCAGCCTCGG - Intergenic
1161114246 19:2488112-2488134 CCTAGGGATCTGTAAAGCTGTGG - Intergenic
1163120346 19:15213724-15213746 CCTAGGGATCTGGACACCTTGGG - Intergenic
1163860918 19:19742490-19742512 ACTAGGGCCCTGTAGAGCATGGG - Intergenic
1166274015 19:41738836-41738858 TATTGGGATCAGTACACCATTGG - Intronic
926919574 2:17927117-17927139 TCTACAGATCTCTACAGCAGGGG + Intronic
928420434 2:31134319-31134341 TCTAGGCATCTTCCCAGCATGGG - Intronic
930277063 2:49323845-49323867 GCTACAGACCTGTACAGCATAGG - Intergenic
932271961 2:70418860-70418882 ACTACGCATGTGTACAGCATGGG - Intergenic
933434090 2:82222694-82222716 TATTGGGATCTTAACAGCATTGG + Intergenic
935356775 2:102208645-102208667 TATGGGGATCTGGTCAGCATGGG + Intronic
938761349 2:134429175-134429197 TCAAGGGATCTTTACACAATAGG + Intronic
941108697 2:161393250-161393272 TATAGGTAGCTGTATAGCATAGG + Intronic
944611373 2:201411950-201411972 TCTAGTGCTCTGTAAACCATGGG + Intronic
947924611 2:233910441-233910463 TGCAGAGATCTGTAAAGCATGGG - Intergenic
948782263 2:240329207-240329229 TCTAGGGTGCTGTTGAGCATGGG + Intergenic
1176932119 21:14826018-14826040 TCTCAGGAACTGTACATCATTGG - Intergenic
951677932 3:25263050-25263072 TCTAGGGATCAGCACAGAAGGGG + Intronic
951834976 3:26973022-26973044 TCTAGGGACCTCACCAGCATAGG - Intergenic
952695877 3:36264578-36264600 TCTAGGGAGCTGAGCAGCCTTGG - Intergenic
955574560 3:60346207-60346229 GCTAGTGCTCTTTACAGCATTGG + Intronic
960044149 3:113180000-113180022 TCTAGAGTTCTGTACAAAATAGG - Intergenic
962716952 3:138134618-138134640 TCTAGGGATCTGTAAAGTCCAGG - Intergenic
967722648 3:192831631-192831653 TCTAGTGATTTGTAAAGCAACGG - Intronic
974129546 4:57736664-57736686 TTTAGGTACCTGTTCAGCATAGG - Intergenic
974855014 4:67451130-67451152 TGTAGGAAGCTGTACATCATAGG - Intergenic
977058896 4:92231864-92231886 TCTAGTGATCTAGACAACATAGG + Intergenic
981051222 4:140311353-140311375 CCTAGGGGTATTTACAGCATTGG - Intronic
984469546 4:180149899-180149921 TGTAGCCATCTGTACAGCACAGG - Intergenic
985645323 5:1082222-1082244 TCTAGGGTTCTGGAAAGCCTGGG + Intronic
985645415 5:1082585-1082607 TCTAGGGTTCTGGAAAGCCTGGG + Intronic
985645564 5:1083187-1083209 TCTAGGGTTCTGGAAAGCCTGGG + Intronic
985645571 5:1083217-1083239 TCTAGGGCTCTGGAAAGCCTGGG + Intronic
988703816 5:33703477-33703499 TCTGGAGATCTGTACAATATAGG - Intronic
997871328 5:137507551-137507573 TCTAGAAATCTGTACAACATTGG - Intronic
1007377339 6:41465913-41465935 TCTAGGGAAATGTACAGTCTGGG - Intergenic
1007377349 6:41465979-41466001 TCTAGGGAAATGTACAGTCTGGG - Intergenic
1007377360 6:41466045-41466067 TCTAGGGAAATGTACAGTCTGGG - Intergenic
1007917864 6:45577624-45577646 TCTAAGGATCTGAACATCTTTGG - Intronic
1008398749 6:51039298-51039320 TCTAGGGATCAGTAGGGGATTGG - Intergenic
1011721149 6:90157842-90157864 TCTAGTGATCAGTACAGGAGTGG - Intronic
1023248918 7:38236806-38236828 TCTAATTATCTGAACAGCATTGG + Intergenic
1024987984 7:55212477-55212499 GCTAATGATCTGTACAGCCTGGG + Intronic
1028580983 7:92409411-92409433 TGGATGGATCTGTATAGCATGGG - Intergenic
1032753733 7:134868270-134868292 TCTAGGGATCTGCATAGTACAGG + Intronic
1039965504 8:42280924-42280946 TCTAGGGATTTATAGAGCCTGGG + Intronic
1041200913 8:55451534-55451556 TCTGGGGGCCTGTACGGCATAGG - Intronic
1042603246 8:70520353-70520375 TCTATTGATCTTCACAGCATAGG + Intergenic
1042787352 8:72563568-72563590 TCTAGGGATCAGGACAGGAAAGG + Intronic
1042848296 8:73190219-73190241 GCAAGGAATCTGTACAGCTTTGG + Intergenic
1046266469 8:111837304-111837326 TCTAGGCTTCAGGACAGCATTGG + Intergenic
1051193892 9:14542516-14542538 TCTAGGGATCTCTGTAGCCTTGG + Intergenic
1053650959 9:40169435-40169457 TCTAGGGATGTAAACAGCTTTGG + Intergenic
1054533621 9:66206768-66206790 TCTAGGGATGTAAACAGCTTTGG - Intergenic
1055009273 9:71546049-71546071 GCTAGGGATCTTTGCAGCTTGGG - Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1056186332 9:84138604-84138626 GCTACAAATCTGTACAGCATGGG - Intergenic
1059692686 9:116700555-116700577 TCTAAGGAATTGTACAACATAGG + Exonic
1059741237 9:117151968-117151990 TGTAGGGATCTGGACAGACTTGG + Intronic
1060778687 9:126395570-126395592 TAAAGGGAACTGAACAGCATGGG + Exonic
1195638831 X:107151233-107151255 CCTGGGGATCTGTAGAGCAAAGG + Intronic
1197015091 X:121615046-121615068 TCTATGGATTTGTAAAGAATAGG - Intergenic
1198872740 X:141193390-141193412 TCTACTGATCTCTACAGCAGGGG - Intergenic
1200306308 X:155029160-155029182 TCTAGGCTTCCTTACAGCATAGG - Intronic
1200971238 Y:9154711-9154733 TCTAGGCATTTTTACAGCCTAGG + Intergenic