ID: 1082986561

View in Genome Browser
Species Human (GRCh38)
Location 11:59174384-59174406
Sequence CATCAGAAGGTGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 554}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082986561 Original CRISPR CATCAGAAGGTGAGGGTGGA GGG Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
900888315 1:5430941-5430963 CATCGGCAGGTGTGGGGGGATGG - Intergenic
901189731 1:7402379-7402401 CAGAAGAAGGTGAGGAGGGAAGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
901536414 1:9885126-9885148 CAGCAGAGGGTGAGGGTTCAAGG + Intronic
902380742 1:16051143-16051165 CATCAGGAAATGTGGGTGGAAGG - Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903323145 1:22554441-22554463 CCTCAGAAAATGTGGGTGGATGG + Intergenic
903727122 1:25457353-25457375 CTTCAGAAGGTGGAGGTGGGAGG - Intronic
903757385 1:25672095-25672117 CCTCAGAACCTGGGGGTGGAGGG + Intronic
903811336 1:26036530-26036552 CTCCAGAGGGTGAGGGTGGTGGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904796246 1:33058427-33058449 CATGAGAGGGTGGGGCTGGAGGG + Intronic
905166123 1:36084315-36084337 CAACAGTAGGCGAGGGCGGAGGG + Intronic
905442426 1:38004082-38004104 TAGCAGAGGGTGAGGGTTGAGGG - Intronic
905885844 1:41491476-41491498 CATCCCAAGGTGAGTGGGGAAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906867554 1:49439269-49439291 CATCAGAAAGTGTGGCTAGAAGG + Intronic
906940428 1:50250958-50250980 CTTTAGATGGTGAGGGTGGCAGG + Intergenic
907233549 1:53023854-53023876 CAGCAGAGAGTGAGGGTGAAAGG - Intronic
907272874 1:53300977-53300999 CCTCACAAGGTGAGAGTGAAAGG + Intronic
907399962 1:54219070-54219092 CAGCAGCAGGTGGGGGTGGCGGG + Intronic
907703424 1:56811998-56812020 CATCAAAAGTGGAGGGTAGAGGG + Intronic
907939860 1:59077138-59077160 TTTCAGGAGGTGAGGGTGGCAGG + Intergenic
908376800 1:63551164-63551186 CATCAAAAGCTGAGGTTGCAGGG - Intronic
908396840 1:63733026-63733048 CATGGGAAGCTCAGGGTGGAGGG + Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908692581 1:66799434-66799456 TATCAGAGGGTGAGGGTGAGGGG + Intronic
909122652 1:71623712-71623734 AATCAGAAGATGTGGGAGGAGGG + Intronic
909194967 1:72607690-72607712 CATCTCAAAGTGGGGGTGGAGGG - Intergenic
909228080 1:73051227-73051249 ACTCAGGAGGGGAGGGTGGATGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
911436457 1:97865531-97865553 AATCAGAGGGTGAAGGAGGATGG - Intronic
911786529 1:101956471-101956493 GAAGAGAAGGTGAGGGTAGATGG - Intronic
912311192 1:108622989-108623011 CTTCAGGAGGTCAAGGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913221493 1:116664280-116664302 CACATGAAGATGAGGGTGGAGGG + Intronic
913260077 1:116989831-116989853 CCTCAGATGGTGAGGGTGAGGGG - Exonic
913372987 1:118121203-118121225 CATCAGAGAGGGTGGGTGGAGGG + Intronic
914879075 1:151533918-151533940 AGTGAGAAGGTGAGGGTTGAGGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915319069 1:155046262-155046284 GGCCTGAAGGTGAGGGTGGAGGG + Intronic
916326238 1:163562947-163562969 TATCAGAGGGTGAGGGTGGGAGG - Intergenic
916853459 1:168726936-168726958 CAGCAGCAGGTGAGGGTGCCGGG - Intronic
917071567 1:171157050-171157072 AATAAAAAGGTGAGGGTGAAGGG + Intronic
917265493 1:173216564-173216586 GATCAGAGACTGAGGGTGGATGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917529980 1:175826112-175826134 AATCAAAAGGTGAGGGTAGAGGG + Intergenic
917735890 1:177919989-177920011 GATCAGAAGGTGAGGGGGTTTGG + Intergenic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
919017133 1:192052998-192053020 GATCAGAATGTGAGGGTCAAAGG + Intergenic
919396599 1:197057588-197057610 CATCAGGAGGTGAGGATCAAAGG - Intronic
920165338 1:204031694-204031716 CATCTGCAGGTGAGAGAGGACGG + Intergenic
920350166 1:205332642-205332664 CAGCAGCAGGTGACGGGGGAGGG + Intergenic
922339041 1:224640901-224640923 GATCTAAAGGTGAGGGAGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922471101 1:225877806-225877828 GATCAGATGGTCAGAGTGGATGG + Intronic
922535016 1:226373217-226373239 CAGCAGAACGTGAGCGTGAAGGG + Intronic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
1062769078 10:85574-85596 CTTCATTAGGTGAGCGTGGAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063693071 10:8305702-8305724 AATAAGAAGGAGAGGATGGAGGG - Intergenic
1064088293 10:12362252-12362274 TATCAGAAGGTCAGGGAGGAGGG - Intronic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1067085226 10:43234629-43234651 CATCAGCAGGGCAGGGTGGGGGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069078508 10:64063818-64063840 CATGTGAAGTTGAAGGTGGAAGG + Intergenic
1069593363 10:69655364-69655386 CACCAGGAGGTGAGGGAGGAAGG + Intergenic
1069639377 10:69945019-69945041 TGTCCGAGGGTGAGGGTGGAGGG + Intronic
1069959211 10:72069847-72069869 CATAAGAAGGTGATGGAAGAAGG - Intronic
1070335712 10:75453703-75453725 GAGCAGAAGGTGAGAGGGGATGG + Intronic
1070434016 10:76370839-76370861 CATTATAAGTTGAGGATGGAAGG + Intronic
1071149965 10:82622306-82622328 CTTCAGGAGGTGGGGGTGGGAGG + Intronic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072714209 10:97738485-97738507 CATCAGAACGTGAGGGGAGTGGG + Exonic
1072758326 10:98035860-98035882 CAGCAGGAGGTGAGAATGGATGG - Intergenic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073254672 10:102143090-102143112 AATCAGAAGGTGAGGGAACATGG + Exonic
1073918614 10:108433539-108433561 AATTAAAATGTGAGGGTGGAGGG + Intergenic
1074699269 10:116079094-116079116 CACCAGAAGGTGATGGTGTGAGG + Intronic
1075002467 10:118808698-118808720 CAGCAGAGGGGCAGGGTGGAGGG - Intergenic
1075025713 10:118981780-118981802 CAACAGTAGGGGTGGGTGGAAGG - Intergenic
1075051274 10:119184017-119184039 CAACAAAAGGGGAGGGGGGAGGG + Intergenic
1075170402 10:120108249-120108271 CATCATAAGATGAGCCTGGATGG + Intergenic
1075248324 10:120844699-120844721 CATCAGTAGGTTAGGGTGTGGGG + Intergenic
1075455686 10:122583383-122583405 GGTCACAAGGTGAGGGAGGAAGG + Intronic
1075457809 10:122596086-122596108 GGTCACAAGGTGAGGGAGGAAGG + Intronic
1075576106 10:123578697-123578719 CCTCAGAAGGGTAGGGAGGAGGG - Intergenic
1075581729 10:123623884-123623906 CATGAGAGGGTAAGGGTGGGGGG + Intergenic
1075627771 10:123974930-123974952 AAGCAGAAGGTGACAGTGGAAGG + Intergenic
1076887334 10:133268734-133268756 CCTGAGCAGGTGAGGGTGGTGGG - Exonic
1077049888 11:561793-561815 GAGCTGAAGGTGTGGGTGGATGG + Exonic
1077233355 11:1468474-1468496 CATCAGAAGACAAGGGTGGGTGG + Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078444141 11:11391536-11391558 AATCAGAAAGTGAGGCTGGCAGG - Intronic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1079896214 11:26121857-26121879 CAGCAGAAGGTGAGCATGCAAGG - Intergenic
1081023696 11:37981860-37981882 CAGCAGGAGGTGAGCGTGGGTGG + Intergenic
1081112855 11:39158329-39158351 CATCAGTAAGTGAGAGGGGATGG - Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083558326 11:63651017-63651039 CATCAGAATGTGAGTGAGTAAGG - Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085711321 11:78831418-78831440 CATCAGACTGTGAGAGTAGAGGG - Intronic
1086171679 11:83843366-83843388 CTTCTGGAGGTGAGGGTAGAGGG - Intronic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087563889 11:99828421-99828443 CATCATATGGTGAAGATGGAAGG + Intronic
1087642579 11:100771365-100771387 CTTTAAAAGGTGGGGGTGGAGGG - Intronic
1087906998 11:103709946-103709968 GGTCAGGAGGTGGGGGTGGAGGG - Intergenic
1088597215 11:111449534-111449556 CATTTGAATGGGAGGGTGGAGGG - Intronic
1088789721 11:113213903-113213925 CACAGGAAGGTGAGGCTGGATGG - Intronic
1090073149 11:123561383-123561405 CAGCAGAAGGAGAGGATGAAAGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091295848 11:134473639-134473661 AAGCAGAAGGTGAGGGCGGGGGG - Intergenic
1091369508 11:135046875-135046897 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369523 11:135046926-135046948 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369538 11:135046977-135046999 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369553 11:135047028-135047050 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369568 11:135047079-135047101 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092097098 12:5851760-5851782 CATCAGAGGTGGGGGGTGGAAGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092722422 12:11454930-11454952 TATCAGAGGGTGAAGGTGGAAGG + Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092906771 12:13107460-13107482 TATGAGAAGCTGAGGGAGGATGG + Intronic
1093195779 12:16128125-16128147 GTTCATAAGGTGAGTGTGGAGGG + Intergenic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095227646 12:39695870-39695892 CATCTGAAGCTAAGGGTGGAGGG - Intronic
1095905066 12:47369154-47369176 CCTGAGAAGGTGAGGGGGGCTGG + Intergenic
1096596700 12:52700440-52700462 CCACAGAAGGTGAGGGAGGAAGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098929970 12:76400160-76400182 TTTCAGAGGGTGAGGGTGGGAGG - Intronic
1100119231 12:91348855-91348877 GATCAGATACTGAGGGTGGAAGG + Intergenic
1100554866 12:95683484-95683506 CATCAGCAGGTGAATGTGCAAGG - Exonic
1101631376 12:106498308-106498330 CAGCCCGAGGTGAGGGTGGAGGG + Intronic
1102043299 12:109814637-109814659 CATCAGCCGGTGAGGGCGAAAGG + Exonic
1102647169 12:114411175-114411197 CCTCACAAGGTGGGGGTGGGGGG + Intergenic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1102753734 12:115319934-115319956 CTTCAGTAGGTCTGGGTGGAGGG - Intergenic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103769611 12:123311307-123311329 CCTAAGAAGGTGAGAATGGAAGG + Intronic
1103922311 12:124405366-124405388 AACCAGAGGGTGAGGGTGGAAGG - Intronic
1104091513 12:125521611-125521633 GGCCAGAGGGTGAGGGTGGAGGG + Intronic
1104388199 12:128369018-128369040 CCTGAGAAGGTGTGAGTGGATGG + Intronic
1106393517 13:29358614-29358636 CATCAGAGAGTGAGAGGGGATGG + Intronic
1108269133 13:48741264-48741286 CATCAGAAGGTGGAGGTCAATGG + Intergenic
1109127086 13:58530928-58530950 CTTCAGAATGTGGGGGTGGTGGG - Intergenic
1110863111 13:80365971-80365993 CATCTCAAAGTGAGGGGGGAAGG + Intergenic
1111002411 13:82203012-82203034 CATTAGATGGTGAGAGTGTATGG + Intergenic
1111931416 13:94516718-94516740 CATCACATGGTGAGGGGGGGTGG - Intergenic
1111947580 13:94681851-94681873 CCTCACAAGGTGAGTGTGAATGG - Intergenic
1112853994 13:103743272-103743294 CATAAGAATGTGGGGGTGGGAGG + Intergenic
1113667950 13:112153991-112154013 CATGAGCAGGTCAGGGTGGATGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114454236 14:22845080-22845102 CGGCGGAAGGTGGGGGTGGAAGG - Intronic
1114619794 14:24088489-24088511 CACCAGAATGTGATGGTGTAGGG - Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115909445 14:38239428-38239450 CATCAGATGGTGGGGGTGTTGGG + Intergenic
1116010845 14:39350159-39350181 CTTCAGAATGTGGGGGTGGGGGG - Exonic
1117696478 14:58369808-58369830 TATCTGAAGGTGATGGTGAATGG + Intronic
1118767799 14:68921860-68921882 AATCTGGAGGTGGGGGTGGAGGG - Intronic
1118897102 14:69954285-69954307 ATTCAGGAGGTGTGGGTGGAAGG - Intronic
1119408599 14:74413981-74414003 GACCAGAAGGAGAGGGTGGCAGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1122088369 14:99322327-99322349 AACCAGAAGGAGAGGGGGGACGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123017424 14:105382050-105382072 CAGCTGCAGGTGGGGGTGGAGGG + Exonic
1123097546 14:105773628-105773650 CATCAGAAGGTGAGCATGGCTGG - Intergenic
1124065739 15:26342084-26342106 CAGCTGAAGGTGAGGGTGAGGGG - Intergenic
1124922901 15:34043757-34043779 CAGCTGAGAGTGAGGGTGGAAGG - Intronic
1124948591 15:34294234-34294256 CGTCTCAAGGTGGGGGTGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126382855 15:48066535-48066557 CAACAAAGGGTGAGGGTGAAAGG - Intergenic
1126948882 15:53857015-53857037 GATCACGAGGTGAGGGTGAAGGG - Intergenic
1127430603 15:58903537-58903559 CATCTGACGGGGAGGGGGGAGGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127974899 15:63990064-63990086 CCACAGAGGGTGAGGGTGGGTGG - Intronic
1128305072 15:66593078-66593100 CATCTGTAGGGCAGGGTGGAAGG - Intronic
1129055446 15:72816809-72816831 CACCAAAAGGTGTGGGGGGAAGG + Intergenic
1129422033 15:75436048-75436070 CCTCAGAAGTTGAGGCTGCAAGG + Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130330493 15:82918485-82918507 CCTCAGCAGGTGAGGCTGGGTGG + Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1133002001 16:2856491-2856513 CAGCAGAGAGTGAGGATGGAGGG - Intronic
1133130074 16:3671514-3671536 CAGAAGAAGGTGGGGGTGGCTGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133723914 16:8520160-8520182 CATCAAAAGTTGAGGATGAAAGG - Intergenic
1133843746 16:9435450-9435472 CATCAGAAGGTGAGCATGGCTGG + Intergenic
1134479163 16:14602668-14602690 CATCAGGAGGGAAGGGTGGGAGG + Intronic
1134872780 16:17666871-17666893 CAACAGAAGGAGAGGGGGAAAGG - Intergenic
1135531257 16:23256712-23256734 TCTCATAAGGTGATGGTGGAAGG - Intergenic
1136093722 16:27938706-27938728 AGTAAGAAGGTGAGGATGGATGG + Intronic
1136273735 16:29165522-29165544 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136991820 16:35157199-35157221 ACTCAGAAGGGGAGGGTGGGAGG + Intergenic
1137912310 16:52390425-52390447 GATCAGGAGGGGAGGGCGGAGGG + Intergenic
1138290221 16:55840357-55840379 CATCAGAAGGTGGTGGTGATGGG - Intergenic
1138423675 16:56916343-56916365 CATCAGGAGGTGGGGGTTAAGGG + Intergenic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139578553 16:67857861-67857883 GGACAGAAGGTGTGGGTGGAGGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140685032 16:77425310-77425332 CATCAGGAATTGAGGCTGGAGGG + Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141428603 16:83959329-83959351 CAGCAGGGGGTGTGGGTGGATGG - Exonic
1142077277 16:88127267-88127289 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1142368008 16:89660435-89660457 CACCAGAGGGTGGGGGAGGAAGG + Intronic
1142381119 16:89732791-89732813 CAGCAGAGGGTGAGGGCGCAGGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143246300 17:5488307-5488329 GAACAGAAAGAGAGGGTGGAGGG + Exonic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143433120 17:6901532-6901554 CATCAGTAGGTGAATCTGGATGG - Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143674535 17:8422298-8422320 CAAAAAAAGGTGGGGGTGGAGGG - Intronic
1144770990 17:17759471-17759493 CATCAGAGGGTGGGGGTGGTGGG - Intronic
1146015921 17:29233494-29233516 ACTCAGGAGGGGAGGGTGGAAGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146677034 17:34780779-34780801 GATCAGAAGAGGAGGGTGGGAGG + Intergenic
1147142143 17:38466007-38466029 CATAAGTGGGTGGGGGTGGAAGG - Intronic
1147165744 17:38592281-38592303 GATCGGAAGCTGAGGGAGGAGGG + Intronic
1147452708 17:40515837-40515859 CATCAGAGGGTGGGGGAGGGTGG - Intergenic
1148765242 17:50035070-50035092 CTTCTAAATGTGAGGGTGGAAGG + Intergenic
1149200704 17:54182876-54182898 AGTGAGAAAGTGAGGGTGGAGGG - Intergenic
1150617958 17:66786475-66786497 GGTCAGAAGGTGGGGGTGGCCGG - Intronic
1151358176 17:73572429-73572451 CATCAGGATGTGGGGGTGGATGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152147021 17:78574545-78574567 TCTCAGCAGGTCAGGGTGGACGG + Intronic
1152246247 17:79186138-79186160 AATCTGGAGGTGAGGCTGGAAGG - Intronic
1152378246 17:79929585-79929607 CGGCTGAGGGTGAGGGTGGAGGG + Intergenic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1154214184 18:12403342-12403364 GATTTGAAGGTGAGGGTGGCAGG + Intergenic
1155298791 18:24409807-24409829 CATGGGAAGCTGAGGCTGGAGGG + Intergenic
1155691651 18:28632156-28632178 CTTGAGAAAGTGAGAGTGGATGG + Intergenic
1156708641 18:39914427-39914449 GATCACAAAGTGAAGGTGGATGG - Intergenic
1156737778 18:40282401-40282423 ACTCAGAAGGTGAAGATGGAGGG + Intergenic
1156766130 18:40657785-40657807 CTTCTGAAGGTGAGGGAGGCAGG + Intergenic
1157100137 18:44721791-44721813 CCTCAGAAGGTGGGGGAAGAGGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1158494287 18:57940183-57940205 CAACGTAAGGTGAAGGTGGATGG - Intergenic
1158608594 18:58918440-58918462 CATCAGAAGATGATGGTGCGTGG - Exonic
1160032126 18:75271296-75271318 TATCCGAAGGAGAGGCTGGAGGG - Intronic
1160335550 18:78035639-78035661 CATCTGAAGGTCAGGGTAGTTGG - Intergenic
1160953073 19:1676745-1676767 CGTCAGAAGTTGGTGGTGGAAGG - Intergenic
1161249115 19:3270921-3270943 CAGAACAAGGTGGGGGTGGAGGG + Intronic
1161437576 19:4273006-4273028 CTTCAGAGGGTGAGGGTAGGGGG - Intergenic
1161515649 19:4694849-4694871 CGTCAGAAGGTGTGGGTGGCCGG + Intronic
1161658258 19:5529454-5529476 CATCAGAAGGATGGGGTGGGAGG + Intergenic
1162373634 19:10292883-10292905 CACCAGAAGGTGGGGGGCGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1163713978 19:18863517-18863539 GAGCAGAAGGTGCTGGTGGAGGG + Exonic
1164275364 19:23712642-23712664 TATCAGAGGTTGAGGGTGGTGGG - Intergenic
1164516800 19:28943688-28943710 GGCCAGAAGGTGGGGGTGGAAGG - Intergenic
1164873442 19:31666596-31666618 CATCAGAAAGTGAAGGTGGATGG - Intergenic
1165393570 19:35551702-35551724 CATCAGAGTGTGGGGGTGGGGGG + Intronic
1165561941 19:36687626-36687648 CAACCGAAGGTGAGGCTGGTGGG + Intronic
1166137341 19:40785808-40785830 GTTCAGTGGGTGAGGGTGGAAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166771179 19:45283452-45283474 GATTAGTAGCTGAGGGTGGAAGG - Intronic
1167782631 19:51609479-51609501 CATAAGAAGGTCAGGGAGGGTGG - Intergenic
1167907197 19:52671517-52671539 CACCAGAGGTTGAGGGTGCAAGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168020685 19:53606693-53606715 CACCGGGCGGTGAGGGTGGAGGG + Intergenic
1168020698 19:53606743-53606765 CACCGGGCGGTGAGGGTGGAGGG + Intergenic
1168507999 19:56952493-56952515 CAGCAGGACGTGAGGGTGGGTGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
925738876 2:6987612-6987634 CATCTGCAGGTGAGGGTGAAGGG - Intronic
925976709 2:9146790-9146812 CATCAGATGTGGAGGATGGATGG - Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928519302 2:32072736-32072758 TTTCAGAAGATGAGGATGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928605506 2:32942029-32942051 CATCAAAAGGTAGGGGTGGGGGG - Intergenic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
932331142 2:70899124-70899146 CGGCAGAAGGTGAGGTTGGGGGG - Intergenic
933117258 2:78489810-78489832 TATCAGAGGGTGGGGGTGGGTGG + Intergenic
933774464 2:85763879-85763901 GATCATAAGATTAGGGTGGAGGG + Intronic
934654639 2:96110802-96110824 CACCTGGAGGTGAGGGTGGTGGG - Intergenic
934948683 2:98561094-98561116 CATCAGTAGGGGAGGGAGAAAGG - Intronic
935294961 2:101640794-101640816 CATCAGACGATGAGGGAGTATGG + Intergenic
935576416 2:104716297-104716319 CACCTGAAGCTGCGGGTGGAGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935836805 2:107063927-107063949 TATCAGAAGGTGTGGGTGACAGG - Intergenic
935924258 2:108050430-108050452 CAACAAAAGTTGAGGGTGAATGG - Intergenic
937117629 2:119419945-119419967 GATCACATGGTGAGGGAGGAAGG + Intergenic
937440956 2:121915637-121915659 CTTCAGAAAATGAGGGGGGATGG + Intergenic
937903170 2:127038145-127038167 CATGAGGAGGAGAGTGTGGAGGG - Intergenic
938442448 2:131348058-131348080 CAACAGAAGGTGAGGAAGGCAGG - Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938722502 2:134079010-134079032 GGTCAGCAGGGGAGGGTGGAGGG + Intergenic
938735084 2:134178493-134178515 CATCAGAAGCTGGGAGGGGAAGG - Intronic
939182643 2:138822226-138822248 AATAAGAAGGTCAGGGTGGAGGG - Intergenic
939283187 2:140091438-140091460 CATCAGAAAGTGAGTATGAAGGG + Intergenic
939391946 2:141579557-141579579 AATCAGAATCTGGGGGTGGAAGG + Intronic
939786615 2:146521361-146521383 CATCAGTAGTTGAGTGTAGATGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940790391 2:158025230-158025252 TATAAAAAGGTCAGGGTGGAGGG + Intronic
941106385 2:161359075-161359097 ACTCAGAAGGTTAAGGTGGAAGG - Intronic
942054972 2:172173521-172173543 CATCAGCATGTGTGGGTGTACGG + Intergenic
942712308 2:178850658-178850680 CAGCAGAAATTGAGAGTGGAGGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943936804 2:193929192-193929214 GATTGGAAGGTGGGGGTGGAGGG - Intergenic
944320293 2:198332547-198332569 CATAAGAAGGGGAGGTGGGATGG + Intronic
944442450 2:199756336-199756358 CAGGAGAAGGTGTGGGTGAAAGG + Intergenic
944636452 2:201680153-201680175 TAGCATAAGGTGAGGGTGGTGGG + Intronic
945134603 2:206613882-206613904 CATTAGTAGGTGATGGTGGTAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946368709 2:219267018-219267040 CAGCAGATGGGCAGGGTGGAGGG - Intronic
947379149 2:229528272-229528294 CATGAGAAGGTGACTGTTGACGG + Intronic
947858687 2:233342864-233342886 CTTCAGAAGCTGAGGTAGGAGGG - Intronic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
948372794 2:237500921-237500943 AACAAGACGGTGAGGGTGGAGGG - Intronic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948818111 2:240523851-240523873 CACCAGCTGGTGGGGGTGGAGGG - Intronic
1168935734 20:1664044-1664066 CATCACATGGTGAGAGAGGAAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1172489697 20:35325918-35325940 AATCAGAAGGTGGAGCTGGAAGG + Intronic
1173333531 20:42095345-42095367 CAGCAGAAGGTGAGGTCAGAGGG - Intronic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173564922 20:44031789-44031811 CAGCAGAAGTGGAGGGTGAAGGG + Intronic
1173839006 20:46144818-46144840 CCTCAGAAGGTGGGTGTGGCTGG + Intergenic
1173982790 20:47237697-47237719 CAGCAGAATGTGAGGTTGAAAGG - Intronic
1174216691 20:48921588-48921610 AGACAGAAGGCGAGGGTGGAGGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174950306 20:55035236-55035258 AAGCAGAAGGTGATTGTGGAAGG + Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175391143 20:58628211-58628233 CATCAGGACATGAGGCTGGAAGG - Intergenic
1175943159 20:62547176-62547198 CTGCTGAGGGTGAGGGTGGAGGG - Intergenic
1177422935 21:20884939-20884961 CACCACAAGGTGAGAATGGAGGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178349265 21:31860623-31860645 GATCACATGGTGAGGGAGGAAGG + Intergenic
1178660234 21:34501669-34501691 CAGCAGAACCTGAGGGTGTAAGG + Intergenic
1181359731 22:22325082-22325104 GAACTGAAGATGAGGGTGGAGGG - Intergenic
1181369804 22:22406821-22406843 GAACTGAAGTTGAGGGTGGAGGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181592769 22:23895175-23895197 CACCAGAAGGTTGGGGTGGGCGG - Exonic
1182198342 22:28542350-28542372 CCACAGAAGGTGAGGAAGGAGGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182875905 22:33690852-33690874 CATGGAAAGGTGTGGGTGGAGGG - Intronic
1183785162 22:40025000-40025022 CAGCAGGAGGCGAGGGCGGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184416618 22:44355576-44355598 CATCAGGAGGTGAGGATGCTTGG - Intergenic
949341206 3:3032912-3032934 CATCGGTAGGAGAGGGTGGCAGG + Intronic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950758680 3:15201218-15201240 GCTCAGAAGGTGAGGGTGTCAGG - Intergenic
950887449 3:16374112-16374134 CATGAGATGGTGAAGGTGAAAGG - Intronic
951342126 3:21501031-21501053 CATTAGAAGGCTAGGGTGGGAGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
953827855 3:46269583-46269605 CACCAGAGGGTGAGGATGGATGG - Intergenic
954358403 3:50102597-50102619 AAGCAGAAGGTGTGGGGGGAAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954588357 3:51756827-51756849 CATCACATGGTGAGAGAGGAAGG + Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
959323442 3:104906904-104906926 CAGCAGGATGTGGGGGTGGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960050757 3:113237302-113237324 CATGAGAAGGGCAGGGGGGATGG - Intronic
960129744 3:114043309-114043331 CAGCAGGAGATGAGGTTGGAGGG + Intronic
960523355 3:118681229-118681251 CATCACATGGTGAGAGAGGAAGG - Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961057195 3:123799185-123799207 CATCAGGGGGTGAGGGGTGAGGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961222693 3:125212686-125212708 CAGGAGCAGGTGAGGGCGGAAGG - Intronic
961471006 3:127112605-127112627 CTTCAGAAGGTGAGGGTCCTGGG + Intergenic
961523295 3:127480635-127480657 CAACAGAAAGTGGGTGTGGAGGG + Intergenic
962256414 3:133872918-133872940 CAAAAGAAGGTGAGGGAGGGAGG + Intronic
962387740 3:134946360-134946382 CATAAGAAGCTGGGGGTGGCAGG - Intronic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962805985 3:138928270-138928292 CTTAAGAAGGTGTGTGTGGAAGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964508181 3:157422018-157422040 CAGGAGAAGGTGAGGGAGAAAGG - Intronic
965683710 3:171278882-171278904 TATCAGAATTTCAGGGTGGAGGG + Intronic
965770534 3:172177090-172177112 GATCAGAAATTGAGGATGGAGGG + Intronic
965781366 3:172289465-172289487 GATCAGAAGGGGAGTGTGGTAGG - Intronic
966249635 3:177849419-177849441 GACCAGATGGTGAGAGTGGAGGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967136168 3:186514721-186514743 CCACAGAAGGGGTGGGTGGAAGG - Intergenic
967651078 3:191988001-191988023 AAGCTGAAGGTGGGGGTGGAGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969287433 4:6212931-6212953 CATCAGAAGATAAGAATGGAGGG - Intergenic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970235649 4:13955681-13955703 CACCAGAAGGTGAGCGGGGTGGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970485424 4:16520190-16520212 CATCAGATGATGGGGGTGGGGGG + Intronic
971185766 4:24374399-24374421 TATCAGAGGGTGGGGGTGGAAGG + Intergenic
971341739 4:25775738-25775760 CACCAGAAGGTTAGGAAGGAGGG + Intronic
971409000 4:26350623-26350645 CATTAAGAGGTGAGGATGGAGGG + Intronic
972278897 4:37584689-37584711 CAGCAGAAGGCGGGGATGGAGGG + Intronic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
972602061 4:40581608-40581630 GATGAGAAGGTGGGGGTGGTGGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973100007 4:46254839-46254861 CAGCAGGAAGTGAGAGTGGATGG - Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
973898750 4:55445009-55445031 CATCAGTAGGTGGTGCTGGAGGG + Intronic
974049572 4:56928067-56928089 CATAAGAAATTTAGGGTGGAGGG + Intronic
975607016 4:76165063-76165085 AATTAGAAGTTGGGGGTGGAGGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975822526 4:78286453-78286475 CATCAGCAGGGGAGGCTGGCAGG - Exonic
978137446 4:105280238-105280260 CATCAGAAAGGCAGGGTGGTAGG + Intergenic
978260728 4:106754604-106754626 TATCAGAGGCTGAGGGTAGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978482062 4:109204137-109204159 AAACAGAAATTGAGGGTGGAGGG + Intronic
979028891 4:115613856-115613878 CTCCAGAAGCTGAGGTTGGAAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979306786 4:119155074-119155096 CATCACATGGTGAGAGAGGAAGG + Intronic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980282700 4:130741034-130741056 TACCAGAGGTTGAGGGTGGAGGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984556364 4:181218731-181218753 CCTGAGAAGGTGAGGTGGGATGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986122756 5:4857429-4857451 CATCAGAGGGTGATGGGAGATGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
986751881 5:10794816-10794838 CATCAGAGTGAGAGGGTGCAGGG - Intergenic
987040179 5:14055051-14055073 CCTCAGAAGGTTGGGGTGGGAGG + Intergenic
987692665 5:21287426-21287448 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989664759 5:43841123-43841145 CATTAGAATGTGAGCTTGGAGGG + Intergenic
990951876 5:61306417-61306439 TTTTAGAAGTTGAGGGTGGAAGG + Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991511559 5:67382924-67382946 CATGAGAAGGGTAGGGTTGAGGG - Intergenic
991747690 5:69762621-69762643 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
991750039 5:69792703-69792725 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
991799268 5:70342475-70342497 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
991801612 5:70372508-70372530 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
991826984 5:70637518-70637540 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
991829329 5:70667561-70667583 CATCAAAAAGTGAGGGAAGAGGG - Intergenic
991891627 5:71341902-71341924 CATCAAAAAGTGAGGGAAGAGGG + Intergenic
991960086 5:72035709-72035731 TGTCAGAAGGAGAGGATGGAGGG - Intergenic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993552486 5:89291095-89291117 CAACAGAATGTGCGGGAGGAGGG - Intergenic
993836120 5:92822352-92822374 TATTAAAAGGTGAGGGTGGGAGG - Intergenic
994372490 5:98983119-98983141 CAGCAGATGGTGATGGGGGAGGG + Intergenic
994598718 5:101873700-101873722 CATAAAAAGGTGAGAGAGGATGG + Intergenic
995404656 5:111781142-111781164 TATCAGAAGTGGAGGGTGGGAGG - Intronic
996557709 5:124796301-124796323 GATGGGAAGGTGAGGGTGGAGGG - Intergenic
996995171 5:129686956-129686978 CATCAGCAGGAGAGGATGGGAGG - Intronic
997410063 5:133684264-133684286 CAGAGGAAGGTGAGGGTGCAGGG - Intergenic
997419993 5:133758836-133758858 CATCTGAAGGTGTGGCTGGCTGG + Intergenic
998498855 5:142614583-142614605 CAACGCAACGTGAGGGTGGAGGG - Intronic
998638356 5:143982150-143982172 CATGAGAAGGTGAGATGGGATGG - Intergenic
998869370 5:146537139-146537161 CAGCAGAAGGTGCAGGTGCAGGG + Intergenic
998930641 5:147177300-147177322 CATGAGAAGCTCAGGGTGCATGG + Intergenic
999175696 5:149630360-149630382 GATCAGCAGTTGAGGGTGGCAGG + Intronic
1000079421 5:157830915-157830937 CTACTGGAGGTGAGGGTGGAGGG + Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1002400690 5:178990281-178990303 AATCTGAGGGTGAGGGTGGGAGG - Intronic
1002616644 5:180460372-180460394 CCTCAGAAGCTCAGGGTGAACGG - Intergenic
1005626788 6:27669919-27669941 CAGAAGAAGATGAGTGTGGAAGG - Intergenic
1005990405 6:30898613-30898635 GACCAGAAAGTGGGGGTGGATGG + Intronic
1006029009 6:31165557-31165579 CTTCAGGAGGTAAGGGTGGGAGG - Exonic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007279129 6:40697412-40697434 CACCAGACGGAGAGGGTGTAGGG + Intergenic
1007642683 6:43355236-43355258 CAGGAGAAGGTGGGTGTGGATGG + Exonic
1007780989 6:44254646-44254668 CAGCAGAAGGGGATGGTGGGAGG + Exonic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009364696 6:62848905-62848927 TATCACAAGGTGCGGGGGGAAGG + Intergenic
1011168075 6:84473058-84473080 CATCAAATTTTGAGGGTGGAGGG - Intergenic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1013041718 6:106440789-106440811 CATCAGAAAGAGATGGTGGGTGG - Intergenic
1014069134 6:117161245-117161267 CATCAGAAAGAGAGGGTTGTGGG - Intergenic
1014511545 6:122328546-122328568 GAGCTGAAAGTGAGGGTGGAAGG - Intergenic
1014681586 6:124437494-124437516 AATCAGAAGGTGAGAAAGGAAGG - Intronic
1016083921 6:139888911-139888933 CAACATGGGGTGAGGGTGGAGGG + Intergenic
1017040641 6:150305948-150305970 CATCTGAAGGTGTGGGTAGAGGG - Intergenic
1017147743 6:151249999-151250021 CTTCGGGAGGTGAGGGTGGGAGG + Intronic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018608094 6:165620312-165620334 CATGAGAAGGTGATGATGGGGGG + Intronic
1019095413 6:169575424-169575446 AATCAGTAGGTGATGGTGGGTGG - Intronic
1019353784 7:568552-568574 CATCAGAAGGTCTGGGAGGAGGG + Intronic
1019411025 7:906817-906839 GGTCAGATGGTGATGGTGGATGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019720377 7:2566921-2566943 CATCAGAAGGAATGGGTGGGTGG - Intronic
1019757469 7:2783446-2783468 CCTCAGAGGGTGAGGATGAATGG - Intronic
1021362577 7:19734011-19734033 CATCACAGGGTTGGGGTGGAGGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022127470 7:27372274-27372296 CATTACATGGTGAGGGAGGAAGG + Intergenic
1022231466 7:28417562-28417584 AATCAGAATGTCAGAGTGGAAGG - Intronic
1022567252 7:31415864-31415886 CCTGAGAAGGGCAGGGTGGAGGG - Intergenic
1023134132 7:37034115-37034137 CATAGGAATTTGAGGGTGGAAGG - Intronic
1024027416 7:45424463-45424485 CATCACATGGTGAGGAGGGAGGG + Intergenic
1024117473 7:46207531-46207553 CATCGCATGCTGAGGGTGGAAGG - Intergenic
1024141698 7:46468698-46468720 CTTCAGAATGTGAGGGTCAAAGG + Intergenic
1025234210 7:57222948-57222970 CTTCTGAAGTTGAGGGGGGAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026269285 7:68822461-68822483 CATGAGAAGGGGAGGTTGCAGGG - Intergenic
1027538151 7:79432968-79432990 CAGAAGAAGGTGAGGTTGGGAGG + Intronic
1027566945 7:79807046-79807068 CAGCAGGAGGTGGGGGGGGAGGG - Intergenic
1027991235 7:85363765-85363787 TATCAGAGGATGAGGGTGGGGGG - Intergenic
1028739276 7:94253512-94253534 GGTCAGAAGGTGAGGTAGGAAGG - Intergenic
1030369868 7:108686656-108686678 CATCTGAAGGTCAGGGCAGAGGG + Intergenic
1030921658 7:115397103-115397125 ACCCAGAAGGGGAGGGTGGAAGG - Intergenic
1031791610 7:126113132-126113154 CTTCAGAAGATGACAGTGGAAGG - Intergenic
1032111528 7:129080090-129080112 CATCAGAATGTAAGAGGGGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033432319 7:141300424-141300446 AATGAGAAAGTGAGGGAGGATGG + Intronic
1033444981 7:141412777-141412799 CCTCAGAATGTGAGAGTTGAGGG - Intronic
1033741817 7:144282064-144282086 CATGAGGAGGTGAGGATGAAAGG + Intergenic
1033752084 7:144367550-144367572 CATGAGGAGGTGAGGATGAAAGG - Intronic
1034274674 7:149818813-149818835 GATCAGAAGTTGAGGCTGGAAGG - Intergenic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035302313 7:157905773-157905795 CATTAGAAGGTGGGAGGGGAGGG + Intronic
1035354523 7:158269127-158269149 CAACAGAAGGTGGGGGTGACCGG - Intronic
1036481388 8:9142671-9142693 TACCAGAAAGTGAGGGTAGAGGG - Intronic
1037225055 8:16577234-16577256 CATTAGGAGGTGAGGTTGTAAGG - Intergenic
1037689765 8:21172031-21172053 CAGCAGGAGGTGAGAGGGGATGG - Intergenic
1038084592 8:24180522-24180544 CCTAAGAAGGTGGGGGTGGGGGG + Intergenic
1038411787 8:27364682-27364704 GATGAGAAGGTGGGGCTGGAAGG - Intronic
1038426162 8:27465261-27465283 AATTAGAAGGGGAGGGAGGATGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038687715 8:29733800-29733822 CATCAGAGGGTGAAGGGAGAGGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039012853 8:33114179-33114201 TATCAGAGGGTGAGGGTAGGAGG + Intergenic
1039411184 8:37356620-37356642 CATAATAAGATTAGGGTGGAGGG - Intergenic
1039886975 8:41660404-41660426 CAGCAGGAGGTGAGGGGGCATGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041041739 8:53853480-53853502 CAGCAGCAGGTGAGGGTAGAAGG + Intronic
1042910139 8:73817921-73817943 CAGCAGGAGATGAGAGTGGAAGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047824581 8:128559603-128559625 CATCTGAGGGTCTGGGTGGAGGG - Intergenic
1048208693 8:132436826-132436848 CCTCAGAAGGTAGGGCTGGAAGG + Intronic
1048385752 8:133911084-133911106 CTTCAGGAGGTGAAGGTGGGAGG + Intergenic
1049226607 8:141454760-141454782 GGTCAGAAGGTGGGAGTGGAGGG + Intergenic
1050382391 9:5042973-5042995 CCTCAGAAGCTGAGGGGGGTGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051805735 9:20990692-20990714 AATCTCAAGGTGAGGGTCGACGG + Intronic
1052474524 9:28941840-28941862 CAAAAGAAGATGAGGATGGATGG + Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1054755299 9:68951462-68951484 AAGCAGCAGGTGAGGGTGGTTGG - Intronic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1057973255 9:99577463-99577485 CATCAGAAGGTGAGTGGGATAGG + Intergenic
1058540114 9:106002982-106003004 CATCTGAAGGAGAGGGATGAAGG + Intergenic
1058951841 9:109911127-109911149 GGTCAGAAGGTGTGGCTGGATGG + Intronic
1061048559 9:128180707-128180729 CACCAGAAGGTGAGGGAGGGAGG - Exonic
1061591981 9:131603619-131603641 CACCAGAAGATAAGGGAGGAAGG + Intronic
1061649116 9:132032051-132032073 CATCAGAAGGTGGATGTGGTAGG + Intronic
1062388977 9:136326686-136326708 CATCGGGAGCTGAGGGTGGGTGG + Intergenic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1186096600 X:6109156-6109178 CTCCAGAGGCTGAGGGTGGAGGG + Intronic
1186546075 X:10451182-10451204 CATAAGCAGGAGAGGATGGACGG - Intronic
1186984825 X:15000784-15000806 CATCAGAAGGTGATGTTTGGAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188596413 X:31906803-31906825 AAGTAGAAGGTGAGGTTGGAGGG - Intronic
1188928396 X:36074790-36074812 CATCAGAGGCTGAAGGTTGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190120655 X:47656723-47656745 CATGTGAAGGTGAGTGTGGCAGG + Intronic
1190126455 X:47709686-47709708 CATCAGTGGGGGTGGGTGGATGG + Intergenic
1190330137 X:49230661-49230683 TCTGAGAAGGTTAGGGTGGAGGG - Intronic
1191675755 X:63790738-63790760 CTTCAGAAAGTGAGAGGGGATGG + Intergenic
1194176142 X:90651005-90651027 CATCTGAAGTTGAGAGTGGAAGG - Intergenic
1194669304 X:96710659-96710681 CATCATATGGTGGGAGTGGAGGG - Intronic
1197838758 X:130723032-130723054 GATCCCAAGGTGAGGATGGAGGG + Intronic
1197912643 X:131501051-131501073 CATCAGAAGGTAAAGGTGTCAGG - Intergenic
1198835590 X:140801769-140801791 AATCTGAAGGTGAGGGGAGAGGG - Intergenic
1199074159 X:143510807-143510829 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199093153 X:143714068-143714090 GATCCGAAGGAGAAGGTGGAGGG - Intronic
1199109098 X:143909318-143909340 TATCCGAAGGTGAGGGTAGGAGG - Intergenic
1199215182 X:145254092-145254114 GATCCGAAGGAGAAGGTGGAGGG + Intronic
1199445342 X:147913428-147913450 CAATAGAAGGTGCGTGTGGAAGG + Intronic
1200522771 Y:4231950-4231972 CATCTGAAGTTGAGAGTAGAAGG - Intergenic
1201479007 Y:14417100-14417122 TTTCAGAAGGTGAGGATGGGAGG + Intergenic
1201669006 Y:16494451-16494473 TATAGGAAGGTGAGGGTGGGAGG - Intergenic