ID: 1082989651

View in Genome Browser
Species Human (GRCh38)
Location 11:59196497-59196519
Sequence CTTCAAAGTCCAATGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082989646_1082989651 15 Left 1082989646 11:59196459-59196481 CCTCTGAGATGCAACGTAGACAA 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1082989651 11:59196497-59196519 CTTCAAAGTCCAATGGACCTGGG 0: 1
1: 0
2: 0
3: 18
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082989651 Original CRISPR CTTCAAAGTCCAATGGACCT GGG Intronic
900952491 1:5865736-5865758 CTTCACAGTCAAATGGGGCTGGG + Intronic
903334086 1:22613565-22613587 CTGCTAAGTCCAATGTACTTTGG - Intergenic
904794545 1:33049441-33049463 CTTCACAGCCCACTTGACCTAGG + Intronic
904888681 1:33761587-33761609 CCTCAAAGACCCAGGGACCTGGG - Intronic
906535020 1:46546627-46546649 CTTCAAAGTCCCATCTACCGTGG - Intronic
906681355 1:47727822-47727844 CTTTGAAGTCAAATAGACCTAGG - Intergenic
906785794 1:48614833-48614855 CTTCAGAGTTCAATAGATCTAGG + Intronic
907494876 1:54836949-54836971 CTTCAAAGTGCAGTTGACATGGG + Intronic
907791688 1:57672169-57672191 CTTCAAAGTCCATTAGAACTGGG - Intronic
908405445 1:63810034-63810056 CTTTAAACTCCATTGAACCTGGG - Intronic
912794789 1:112686303-112686325 CATCAAAGTCCCATGGATCGAGG - Intronic
912806270 1:112759168-112759190 CTTCAGAGTGAGATGGACCTGGG + Intergenic
915321766 1:155060438-155060460 CTTTAAGGTCCAAGGGGCCTGGG - Intronic
919208031 1:194442710-194442732 TCTCAAAGGCCAATGGAACTAGG - Intergenic
919238031 1:194871594-194871616 CTATAAAGTCCAATGGACACAGG - Intergenic
920460985 1:206140184-206140206 CTTCACAGCCAAATGGACCGAGG + Intergenic
920529924 1:206694403-206694425 CTGCACAGGCCAATGGGCCTTGG - Intronic
1064931869 10:20637501-20637523 CTTCTAAGTCCAAGTGACCAAGG - Intergenic
1065861519 10:29876297-29876319 CTTCAAGGTCCAAAGGAACAGGG + Intergenic
1066618849 10:37323241-37323263 CTTCAAAGTCCTAGGGTCATAGG - Intronic
1068051009 10:51949293-51949315 ATTCAAAGCCCAATGCAACTAGG - Intronic
1073081238 10:100862304-100862326 CTCCAAACTCCACTGGACCCCGG + Intergenic
1074471551 10:113731680-113731702 CTTCAAATTGCAATGCACTTAGG - Intergenic
1074861909 10:117516614-117516636 CTTCAAAGTCCAGCAGAGCTGGG - Intergenic
1075838660 10:125477984-125478006 CTCCAAAGTCCCTGGGACCTGGG + Intergenic
1079453896 11:20620748-20620770 CTTCAAAGCCAGATAGACCTGGG - Intronic
1081290082 11:41314030-41314052 CTTTGAAGTCCAAGGGACTTGGG + Intronic
1081438031 11:43049687-43049709 TTTTAAAGTTAAATGGACCTAGG - Intergenic
1081594374 11:44449111-44449133 CCTCAAAGTCCCATAGAGCTTGG + Intergenic
1081953827 11:47071290-47071312 CTTTAGAGTCAAATGGCCCTAGG + Intronic
1082092984 11:48104865-48104887 CTTCAGGGTCCGATTGACCTTGG + Intronic
1082989651 11:59196497-59196519 CTTCAAAGTCCAATGGACCTGGG + Intronic
1083405017 11:62450756-62450778 TCTGAAAGTCCAATGGGCCTAGG - Intronic
1086837647 11:91645018-91645040 TTTGAAAGTCAAGTGGACCTGGG - Intergenic
1087106298 11:94411401-94411423 CTTCAAAATCATCTGGACCTGGG + Intergenic
1097976870 12:65695853-65695875 CCTCAAAGTCCAGTGGTTCTGGG - Intergenic
1103220055 12:119236521-119236543 CTTTGAATTCCAATGGCCCTGGG + Intergenic
1103676722 12:122661561-122661583 CTACAAAATCTAATGGCCCTTGG - Intergenic
1103947112 12:124532791-124532813 CTTCAAAGCCCCATGAGCCTAGG + Intronic
1106118097 13:26834156-26834178 CTTTAAAGTCAGATGGACCCTGG + Intergenic
1106484915 13:30163466-30163488 TTTCCGAGTCCGATGGACCTGGG + Intergenic
1107631175 13:42344138-42344160 CTCCAAAACTCAATGGACCTGGG - Intergenic
1107891464 13:44918300-44918322 CTGCAAAGTCCAAAAGAACTGGG + Intergenic
1110758003 13:79198627-79198649 CTTGAAAGTCTGATGGGCCTTGG + Intergenic
1112503327 13:99958298-99958320 ATTCAAAGTCAAATGGAAATTGG - Intergenic
1114308432 14:21444062-21444084 CTTTGAAGTCCAAGGGACCTGGG + Intronic
1114310064 14:21458284-21458306 CTTCAAAAACCAATGGACATTGG + Intergenic
1116513294 14:45773469-45773491 CTTAAACGTCAAAAGGACCTGGG - Intergenic
1124990388 15:34667371-34667393 TTTCAGAGTGCAAAGGACCTAGG + Intergenic
1125745972 15:41997321-41997343 CTTCAGGGTCCATTGGACCTAGG + Intronic
1128347950 15:66866408-66866430 CTTCTGAGTCCAATCCACCTGGG - Intergenic
1132166906 15:99602402-99602424 CTTAACAGTCCAATGTCCCTAGG + Intronic
1132196748 15:99919336-99919358 CTGCCAAGTCCAGTGGACATGGG + Intergenic
1134140022 16:11710412-11710434 CTTGAAAATGCAATGGCCCTTGG - Intronic
1134769229 16:16791723-16791745 CTTCAAATTCAGATGGACCTGGG - Intergenic
1136026698 16:27473290-27473312 CTGCTAAGTCTCATGGACCTGGG + Intronic
1137821230 16:51447988-51448010 CTTTAAGGTCAAATGAACCTGGG + Intergenic
1138806898 16:60100630-60100652 CCTCAAAGTCCACTGGCTCTGGG + Intergenic
1144582353 17:16466099-16466121 CTTCATAGTCCTGAGGACCTTGG + Intronic
1146658396 17:34648780-34648802 CTTCAGAGGCCAATGGGTCTGGG - Intergenic
1148094514 17:45043051-45043073 GTTCAGAGTCAAAGGGACCTTGG + Intronic
1153663886 18:7351025-7351047 CCTCTAAGCCCAATGGTCCTGGG + Intergenic
1168007172 19:53499831-53499853 TTTCAAAGTCAAATGAAGCTGGG + Intergenic
927430004 2:23019507-23019529 CTTCAAAATCCAGGGCACCTGGG + Intergenic
928302161 2:30135151-30135173 CTCCAAAGTCCACTGGAGCCAGG + Intergenic
931082713 2:58793324-58793346 CTGCAGAGTCACATGGACCTGGG - Intergenic
931996036 2:67840094-67840116 CTTTAAATTCAAATGGACCTGGG - Intergenic
933969946 2:87462161-87462183 CTGCAAAGACCAAAGCACCTGGG - Intergenic
936323835 2:111488335-111488357 CTGCAAAGACCAAAGCACCTGGG + Intergenic
938813253 2:134872989-134873011 TTTCAAAGTCAAATTGACCTGGG + Intronic
943970282 2:194395767-194395789 ATTCTAAGTCCAAAGGCCCTGGG - Intergenic
945507786 2:210662790-210662812 TTTCAAAGTCCACTGGGCATTGG - Intronic
945849776 2:214992058-214992080 ATTTAAAGTCCCCTGGACCTTGG + Intronic
947746767 2:232511981-232512003 CCTCAAAGTCCCATAGGCCTGGG + Intergenic
1172860961 20:38051584-38051606 CTTTAAAGTCGTATAGACCTGGG - Intronic
1175852516 20:62101452-62101474 CTTCAAAGTCCAGTGACCCTTGG + Intergenic
1178708653 21:34895176-34895198 CTTCTCAGCCAAATGGACCTTGG - Intronic
1179970687 21:44835660-44835682 CTTCAAAGTCCCAGGCACCTCGG - Intergenic
1180520521 22:16197780-16197802 TTTCAAATTCAAATAGACCTAGG - Intergenic
1182120880 22:27785898-27785920 CGTTAAAGTCTAATGGACATTGG - Intronic
1182871079 22:33648183-33648205 CTTCAAAAGCCAATGGTCTTTGG + Intronic
1184615027 22:45632128-45632150 CCTCAAAGTCCAATGCTCCTTGG - Intergenic
949106203 3:203197-203219 GTTCAAAGTCCAAGGGACATTGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
956410945 3:68978805-68978827 CCTTATAGTCTAATGGACCTGGG - Intronic
957009818 3:74990867-74990889 CCTCAAAGACCAATTGATCTGGG - Intergenic
958983718 3:100755571-100755593 CTTATAATTCCAAGGGACCTAGG - Intronic
962290727 3:134134399-134134421 CTTCAAAGTACAAAGGGCCTTGG + Intronic
965841057 3:172906187-172906209 CTTAAAACTCCAAGGGACCTTGG + Intronic
972104877 4:35471036-35471058 CTTCAAAGTCTAATAGACACTGG - Intergenic
974667949 4:64989805-64989827 CTTCAGAGTCAGATAGACCTGGG - Intergenic
975367131 4:73542334-73542356 CTTTGAAGTCAAATGGACTTTGG - Intergenic
976659653 4:87526621-87526643 CTTCAGAGTCCAATGCATCTGGG - Intronic
977269701 4:94901134-94901156 CTTCAATGACCAATGTACCCAGG - Intronic
977457017 4:97274338-97274360 CTTCAAAATTCAATGCATCTGGG + Intronic
977569946 4:98618662-98618684 CTTTAGAGTCCCGTGGACCTAGG - Intronic
983311415 4:166066763-166066785 CTCCAGAATACAATGGACCTCGG + Intronic
988895767 5:35673185-35673207 CCTTAAAGCCCAATGGACCATGG + Intronic
993199369 5:84793642-84793664 TTTGAAATTCCAATGTACCTGGG + Intergenic
994456069 5:100009740-100009762 CCTCATAGTGCAATGGAGCTGGG + Intergenic
1001049455 5:168402732-168402754 CTTCAAAATCCAGTAGTCCTGGG - Intronic
1001741062 5:174053070-174053092 CTTCATAGTCCTAGAGACCTGGG + Intronic
1001785864 5:174412614-174412636 TTTCAAAGACCAAAGGATCTGGG + Intergenic
1002101219 5:176858635-176858657 CTGCTCAGTCCAAAGGACCTAGG - Intronic
1002890983 6:1331592-1331614 CTGGTAAATCCAATGGACCTGGG + Intergenic
1006460557 6:34155230-34155252 CGGCAAAATCCAAAGGACCTGGG + Intronic
1011156634 6:84340851-84340873 ATTCTCAGGCCAATGGACCTAGG + Intergenic
1015866434 6:137731462-137731484 CTTTAAAGTCAAATGGCCCTGGG + Intergenic
1019890337 7:3941237-3941259 CTGCAAAGTCCAATGGGTCAAGG - Intronic
1020331358 7:7020228-7020250 CTTCAAAGTCAAATAGACAATGG + Intergenic
1023196392 7:37644137-37644159 CTTCATGGACCCATGGACCTGGG - Intergenic
1024889931 7:54188394-54188416 CTTCAAAGAGCCATGCACCTCGG - Intergenic
1024976474 7:55118348-55118370 TCTCAAACTCCAATGGACATAGG - Intronic
1025096239 7:56097501-56097523 CTTCAACGTCCAGAGTACCTGGG - Intergenic
1026382272 7:69811658-69811680 TTTTCAAGTCCCATGGACCTGGG - Intronic
1027602747 7:80259646-80259668 CTTCAAAGTCAAATGGAGACAGG + Intergenic
1030789074 7:113700939-113700961 TTTCAAATTCCAATGGAAATTGG + Intergenic
1032710749 7:134458611-134458633 CTTCACAGACCGGTGGACCTCGG - Intronic
1033048876 7:137986369-137986391 CTTCCCAGTCCCATGGAGCTGGG - Intronic
1035382082 7:158446621-158446643 CTTGAAAATCCAATGGTCCCTGG + Intronic
1037516834 8:19640085-19640107 TTTCAATGTTCAATGCACCTGGG + Intronic
1038902517 8:31859817-31859839 CTTCAAAGTCAAATGGAACCTGG + Intronic
1038945105 8:32350473-32350495 TTTGAAAGTCAGATGGACCTTGG + Intronic
1040655584 8:49503758-49503780 CTTTAAAGTCAAACAGACCTGGG + Intergenic
1042598784 8:70477540-70477562 CTTCAAAGTGCAACGAGCCTGGG + Intergenic
1044402696 8:91790952-91790974 CTTCAAAAACCAATGAATCTAGG + Intergenic
1050022403 9:1298284-1298306 CTTCAGAGTCTGATGGATCTGGG + Intergenic
1050372623 9:4937158-4937180 CTTAGTAGTCCAATGTACCTGGG + Intergenic
1059955183 9:119508479-119508501 CTTCAGAGTCTCTTGGACCTGGG - Intronic
1061725324 9:132579377-132579399 CTTCCAGGTCCAAAGGAGCTGGG - Intergenic
1187123801 X:16434564-16434586 CTCCAAACTCCACTGAACCTAGG + Intergenic
1191673837 X:63774260-63774282 ATTAAAAGTCAGATGGACCTGGG - Intronic
1192373814 X:70538663-70538685 CTTCATAGGACAATGGTCCTTGG - Intronic
1193039589 X:76990520-76990542 CTTCAAAAATCAATGGATCTAGG + Intergenic
1194649415 X:96497811-96497833 CTCCAAAATCCTATGGACCTGGG - Intergenic
1194860390 X:98991503-98991525 CATCAAAGTCCAAGAGACCTAGG - Intergenic
1196690142 X:118550321-118550343 CTTCAATGTCCCAAGTACCTGGG - Intronic
1200000533 X:153057577-153057599 CATCAAAGGCCAGTGCACCTGGG - Exonic