ID: 1082996396

View in Genome Browser
Species Human (GRCh38)
Location 11:59259110-59259132
Sequence AGTGAAAGGGCCAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082996396_1082996403 13 Left 1082996396 11:59259110-59259132 CCCTCCTCATTGGCCCTTTCACT No data
Right 1082996403 11:59259146-59259168 TTATGGCTACTGCCACAGCCAGG No data
1082996396_1082996401 -4 Left 1082996396 11:59259110-59259132 CCCTCCTCATTGGCCCTTTCACT No data
Right 1082996401 11:59259129-59259151 CACTATGAGAGACCAAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082996396 Original CRISPR AGTGAAAGGGCCAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr