ID: 1082996396 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:59259110-59259132 |
| Sequence | AGTGAAAGGGCCAATGAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1082996396_1082996403 | 13 | Left | 1082996396 | 11:59259110-59259132 | CCCTCCTCATTGGCCCTTTCACT | No data | ||
| Right | 1082996403 | 11:59259146-59259168 | TTATGGCTACTGCCACAGCCAGG | No data | ||||
| 1082996396_1082996401 | -4 | Left | 1082996396 | 11:59259110-59259132 | CCCTCCTCATTGGCCCTTTCACT | No data | ||
| Right | 1082996401 | 11:59259129-59259151 | CACTATGAGAGACCAAGTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1082996396 | Original CRISPR | AGTGAAAGGGCCAATGAGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||