ID: 1082997358

View in Genome Browser
Species Human (GRCh38)
Location 11:59264572-59264594
Sequence ATGAAGAAACAGGCTCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082997358_1082997367 1 Left 1082997358 11:59264572-59264594 CCCACCTGAGCCTGTTTCTTCAT No data
Right 1082997367 11:59264596-59264618 TTTAAAATGGGGCATGGGTCAGG No data
1082997358_1082997366 -4 Left 1082997358 11:59264572-59264594 CCCACCTGAGCCTGTTTCTTCAT No data
Right 1082997366 11:59264591-59264613 TCATCTTTAAAATGGGGCATGGG No data
1082997358_1082997365 -5 Left 1082997358 11:59264572-59264594 CCCACCTGAGCCTGTTTCTTCAT No data
Right 1082997365 11:59264590-59264612 TTCATCTTTAAAATGGGGCATGG No data
1082997358_1082997364 -10 Left 1082997358 11:59264572-59264594 CCCACCTGAGCCTGTTTCTTCAT No data
Right 1082997364 11:59264585-59264607 GTTTCTTCATCTTTAAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082997358 Original CRISPR ATGAAGAAACAGGCTCAGGT GGG (reversed) Intergenic
No off target data available for this crispr